ID: 1165203976

View in Genome Browser
Species Human (GRCh38)
Location 19:34168288-34168310
Sequence AGGTGTTCAGTCCTGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165203969_1165203976 10 Left 1165203969 19:34168255-34168277 CCTTATGCTCATCACTAGCCCTA No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data
1165203972_1165203976 -8 Left 1165203972 19:34168273-34168295 CCCTAGGACTGACCTAGGTGTTC No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data
1165203967_1165203976 25 Left 1165203967 19:34168240-34168262 CCTTTTATCCGTTCTCCTTATGC No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data
1165203973_1165203976 -9 Left 1165203973 19:34168274-34168296 CCTAGGACTGACCTAGGTGTTCA No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data
1165203968_1165203976 17 Left 1165203968 19:34168248-34168270 CCGTTCTCCTTATGCTCATCACT No data
Right 1165203976 19:34168288-34168310 AGGTGTTCAGTCCTGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165203976 Original CRISPR AGGTGTTCAGTCCTGGAACT AGG Intergenic
No off target data available for this crispr