ID: 1165204522

View in Genome Browser
Species Human (GRCh38)
Location 19:34172460-34172482
Sequence CTCAAGCCGCGGCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165204522_1165204533 -8 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204533 19:34172475-34172497 GGCTTGAGGGCGGGAGGCTGGGG 0: 1
1: 0
2: 12
3: 430
4: 6071
1165204522_1165204540 27 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204540 19:34172510-34172532 GCCGGCGCCGCCGCCATGTTGGG 0: 1
1: 2
2: 3
3: 10
4: 83
1165204522_1165204539 26 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204539 19:34172509-34172531 AGCCGGCGCCGCCGCCATGTTGG 0: 1
1: 0
2: 6
3: 13
4: 100
1165204522_1165204532 -9 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204532 19:34172474-34172496 CGGCTTGAGGGCGGGAGGCTGGG 0: 1
1: 0
2: 2
3: 13
4: 293
1165204522_1165204537 3 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204537 19:34172486-34172508 GGGAGGCTGGGGGAGGGTAGCGG 0: 1
1: 2
2: 27
3: 369
4: 6565
1165204522_1165204534 -7 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204534 19:34172476-34172498 GCTTGAGGGCGGGAGGCTGGGGG 0: 1
1: 1
2: 8
3: 74
4: 765
1165204522_1165204536 -3 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204536 19:34172480-34172502 GAGGGCGGGAGGCTGGGGGAGGG 0: 1
1: 3
2: 63
3: 802
4: 6515
1165204522_1165204535 -4 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204535 19:34172479-34172501 TGAGGGCGGGAGGCTGGGGGAGG 0: 1
1: 1
2: 27
3: 286
4: 2520
1165204522_1165204531 -10 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204531 19:34172473-34172495 GCGGCTTGAGGGCGGGAGGCTGG 0: 1
1: 0
2: 3
3: 30
4: 521
1165204522_1165204538 9 Left 1165204522 19:34172460-34172482 CCGCCGCCGCGCCGCGGCTTGAG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1165204538 19:34172492-34172514 CTGGGGGAGGGTAGCGGAGCCGG 0: 1
1: 0
2: 3
3: 60
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165204522 Original CRISPR CTCAAGCCGCGGCGCGGCGG CGG (reversed) Intergenic
903224530 1:21887256-21887278 CTCAAGCTGTGGCGCTGCGATGG - Exonic
911078989 1:93909501-93909523 CTCATCCCGCGGCGGGGCAGGGG + Intergenic
912269241 1:108192633-108192655 CTCAGGCCGCGGAGCTGCGAGGG - Intronic
913047897 1:115089428-115089450 CCCATGCTGCGGCCCGGCGGCGG + Exonic
917817473 1:178725429-178725451 CTCAGGCCGCGGGGCGGTGCGGG + Intronic
919097818 1:193059085-193059107 CTCCAGACGCGGGGCGGCGGTGG + Intronic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
1065099615 10:22320909-22320931 CTCGCTCCGCGCCGCGGCGGCGG - Intronic
1065993129 10:31031942-31031964 CTCCCGCCGCGGCGCCGGGGCGG - Intergenic
1067474469 10:46556753-46556775 CCCGGGCCGCGGCGGGGCGGTGG - Intergenic
1067686091 10:48466681-48466703 CTATCGCGGCGGCGCGGCGGCGG + Intronic
1072635216 10:97173638-97173660 CTCAAGCAGCGGTGAGGCAGAGG + Intronic
1075801867 10:125159449-125159471 CCAAAGTCGCGGCGGGGCGGGGG - Intronic
1080418649 11:32091646-32091668 CCCCGGCCGGGGCGCGGCGGCGG - Intronic
1081699947 11:45146702-45146724 CGCCAGCCTCGGCGCGGCGGCGG - Intronic
1088647235 11:111926983-111927005 CTCCAGCCGCGGCCTGGGGGTGG - Intergenic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1106208747 13:27621769-27621791 CTCACCCCGCGTCGGGGCGGGGG + Exonic
1116828360 14:49693443-49693465 GTCAAGCCCTGGCGCGGCTGTGG - Intronic
1124109455 15:26772964-26772986 CCCGTGCCGGGGCGCGGCGGAGG - Exonic
1126405127 15:48315553-48315575 CACAAGCAGCGGAGCGGTGGGGG - Intergenic
1127606432 15:60592217-60592239 CTCAGGTGGCGCCGCGGCGGTGG + Intronic
1132641988 16:982175-982197 CCCATGCCGGTGCGCGGCGGCGG + Exonic
1132978266 16:2721142-2721164 CTCTGGGCGCGGCGCCGCGGCGG + Intergenic
1135712514 16:24729762-24729784 CTCTCCCCGCGGCGCTGCGGAGG + Exonic
1135745823 16:25015344-25015366 CCCAAACGGCGGCGCGGCGGTGG + Intronic
1140092014 16:71846289-71846311 CTCAGGCCCCGGCGCCCCGGAGG + Intronic
1142093391 16:88226967-88226989 CGCAGGCCCCGGCGCGGAGGAGG - Intergenic
1142093402 16:88227004-88227026 CGCAGGCCCCGGCGCGGAGGAGG - Intergenic
1142093413 16:88227041-88227063 CGCAGGCCCCGGCGCGGAGGAGG - Intergenic
1142093424 16:88227078-88227100 CGCAGGCCCCGGCGCGGAGGAGG - Intergenic
1142130821 16:88430783-88430805 CTGAAGCCGGGGCCCCGCGGCGG - Exonic
1142179791 16:88662859-88662881 CTCAGGGAGGGGCGCGGCGGTGG - Intronic
1142638221 17:1270692-1270714 CTGCAGCCGGGGCGAGGCGGAGG + Exonic
1142804319 17:2363479-2363501 CTCAAGCGGCAGCGCGTCGGAGG + Exonic
1142836813 17:2593662-2593684 CTGGAGCGGCGGGGCGGCGGCGG + Intronic
1146271371 17:31487967-31487989 CTCGCGCCGGGGCGGGGCGGGGG - Intronic
1147400573 17:40178073-40178095 CTCCAGCCCCGGCTCGGCGGGGG - Intronic
1147683907 17:42275994-42276016 CGAACGCCGCGGCGCCGCGGGGG - Intronic
1148271763 17:46267020-46267042 CTGAAGCTGAGGCGCGGCGGCGG - Intergenic
1149556198 17:57575153-57575175 CTCCAGCCGGGGGGTGGCGGGGG - Intronic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151370768 17:73644989-73645011 CTCCGGCCGGGGCGCGGCGGAGG - Intergenic
1151591500 17:75047396-75047418 CTCCAGCGGCTGCGCGACGGCGG - Exonic
1151945924 17:77319862-77319884 AGCAAGCCTCGGGGCGGCGGGGG + Intronic
1153238786 18:3012948-3012970 CTCAACCCGCGCCGCCCCGGAGG + Intronic
1159798457 18:72869083-72869105 CCCCAGCCGCGGCGCGGGTGTGG - Intergenic
1160882047 19:1325353-1325375 TTTAAACCGCGCCGCGGCGGGGG + Intergenic
1160930688 19:1568258-1568280 CTCTGGCTGCGGCTCGGCGGCGG + Intergenic
1161560298 19:4969287-4969309 CCCGAGCCGCGACGCGGGGGCGG - Intronic
1161702368 19:5802514-5802536 CCCCAGCCGCGGCGGGGAGGGGG + Intergenic
1163427251 19:17246181-17246203 CTCCCGCCGCGGCCCGGCAGGGG - Intronic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1167577914 19:50326535-50326557 CTCAGGACGCGGCACGGTGGGGG + Intronic
933666710 2:84970823-84970845 CCCTACGCGCGGCGCGGCGGCGG + Intergenic
933899289 2:86837665-86837687 CACAAGCTGCGGGGCGGGGGTGG + Intronic
935349692 2:102142706-102142728 CTCTAGCCCCGCCGCTGCGGGGG - Intronic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
937045134 2:118847107-118847129 CTCGGCCCTCGGCGCGGCGGCGG - Exonic
942453308 2:176121977-176121999 GGCGAGCCGGGGCGCGGCGGTGG - Intergenic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1171533252 20:25865933-25865955 ATCCAGCCGCTGCGCAGCGGTGG - Intronic
1173523835 20:43717363-43717385 CTAAAGCCGAGGAGGGGCGGGGG + Intergenic
1178334342 21:31731160-31731182 CTCAGGCCGCGGCGCGTCGACGG - Intronic
1179512000 21:41879344-41879366 CGGAAGCCGGGGGGCGGCGGCGG + Exonic
1183577352 22:38700605-38700627 CTCTGGCCGCGGCCCTGCGGAGG + Exonic
1183683770 22:39350209-39350231 CCCCGGCGGCGGCGCGGCGGCGG + Intronic
1185038262 22:48490532-48490554 CTCCAGCCTCGGCGCTGGGGAGG + Intronic
953886198 3:46715633-46715655 CAGAAGCCGTGGCTCGGCGGTGG - Exonic
956813597 3:72888216-72888238 TTCATGGTGCGGCGCGGCGGCGG - Exonic
964484681 3:157175179-157175201 CACAAGAGGCGGCGCCGCGGAGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968960146 4:3739318-3739340 CTCAAGCCAAGGAGCGGCCGCGG + Intergenic
972396573 4:38663872-38663894 CACGAGGCGCGGCGCGGCCGTGG - Intergenic
975883552 4:78939234-78939256 CCCGAGCCGGGGAGCGGCGGCGG - Exonic
1002591036 5:180291857-180291879 CTCTCCCCGTGGCGCGGCGGCGG - Exonic
1002632303 5:180590304-180590326 CTCAGGCGGGGGCGCGGCAGCGG + Intronic
1002838718 6:887634-887656 CTCCAGCTGTGGCGCGGGGGTGG - Intergenic
1004396337 6:15248817-15248839 CTCCAGGCGCGGCGGGGCGGCGG + Intronic
1006547520 6:34792153-34792175 CTCACGCCGCGGCGAGGTGAGGG + Exonic
1007902062 6:45422091-45422113 CGCGCGGCGCGGCGCGGCGGTGG + Intronic
1013227940 6:108134025-108134047 CTCCTGCGGCGGCGAGGCGGTGG + Intronic
1018030299 6:159836552-159836574 CTCGAGCAGCCGCGCGGGGGAGG + Intergenic
1019689666 7:2403607-2403629 CGCTAGTCGCGGGGCGGCGGCGG + Exonic
1020001661 7:4759519-4759541 CACCAGCCAGGGCGCGGCGGGGG + Exonic
1023243723 7:38178345-38178367 CTCAGGCCGGGGCGCGACCGCGG + Exonic
1025829805 7:65038755-65038777 CCCAGGCCGCGGGGCGGAGGTGG + Intergenic
1025917060 7:65873755-65873777 CCCAGGCCGCGGGGCGGAGGTGG + Intronic
1027001671 7:74658254-74658276 CTCGAGACCCGGCGAGGCGGTGG - Intronic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1035553332 8:545550-545572 CTCAGGCCGCGGCAAGGCTGAGG + Intronic
1037811578 8:22089701-22089723 TTCAAGCCCAGGCGAGGCGGTGG - Intronic
1040039141 8:42897911-42897933 TTCTCGCCGCGGCGCGGCCGGGG + Intronic
1041449796 8:57994643-57994665 CTCTACCCGCGGCCCCGCGGCGG + Exonic
1049776720 8:144409384-144409406 CTCACGCGGCGGCGCTGCGCAGG - Intergenic
1049997112 9:1044433-1044455 ATCAAGGCGGGGCGGGGCGGGGG - Intergenic
1052991794 9:34522946-34522968 CTCCCGCCGCGGCGCGACCGGGG + Exonic
1057053128 9:91940887-91940909 CTCAAGGCCCGGCGAGGTGGTGG - Intronic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1057773237 9:97984702-97984724 GCCAAGCCCCGGCGGGGCGGGGG - Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061472121 9:130835199-130835221 CGCAGGCGGCGGCGGGGCGGGGG + Intronic
1062507667 9:136886455-136886477 CGCACGCGGCGGAGCGGCGGCGG + Intronic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1198388097 X:136147551-136147573 CCGAGGCCGAGGCGCGGCGGTGG - Exonic