ID: 1165205226

View in Genome Browser
Species Human (GRCh38)
Location 19:34178684-34178706
Sequence TTGTTCTTGTAGAAGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165205226 Original CRISPR TTGTTCTTGTAGAAGTATCT TGG Intronic
902099179 1:13971610-13971632 TTGTTGTTGTTGTTGTATCTGGG + Intergenic
903620056 1:24691564-24691586 TTTTTCTTCTTGAAGTCTCTGGG - Intergenic
906999795 1:50839794-50839816 TTATTCTTGTTCAAGTATCTTGG - Intronic
908926366 1:69259923-69259945 TTTTTCTCTTTGAAGTATCTTGG - Intergenic
909477767 1:76100761-76100783 AAGTTCTGGTAGAATTATCTGGG + Intronic
909543130 1:76813204-76813226 TTAATCTTGAAGAAGTAACTAGG + Intergenic
911365550 1:96933270-96933292 TTGTTGTTCTAGATCTATCTTGG - Intergenic
912014819 1:105019426-105019448 CTGTTCTTGTACCAGTATCAAGG + Intergenic
912091540 1:106082407-106082429 TTGTTCATGTAAAAGTAAATTGG + Intergenic
914312346 1:146477879-146477901 TAGTTCTTTTAGAAATTTCTAGG + Intergenic
914316278 1:146514948-146514970 TTTTTCAAATAGAAGTATCTGGG + Intergenic
914498077 1:148218413-148218435 TTTTTCAAATAGAAGTATCTGGG - Intergenic
914502003 1:148255457-148255479 TAGTTCTTTTAGAAATTTCTAGG - Intergenic
914871080 1:151474482-151474504 TTGTGCATTTAGAAGGATCTCGG + Intergenic
915231915 1:154452022-154452044 TTGTGCTTTGAGACGTATCTAGG + Intronic
917197893 1:172485605-172485627 TTGTTGTTGTAGGACTATTTGGG - Intergenic
917951168 1:180038391-180038413 TTTTTCTTGTATAAGTACCTAGG + Intronic
918406502 1:184216204-184216226 TTGTTCTGGTTGAAGGAACTGGG - Intergenic
918679942 1:187341321-187341343 TTGCTTTTATAGAAGTATTTGGG - Intergenic
919414867 1:197295433-197295455 TTGAACTTGAAGAAGTAACTTGG + Intronic
919631332 1:199962935-199962957 TTGTTTTAGGAGAAATATCTGGG + Intergenic
922328781 1:224555482-224555504 TTTTTCTTCTATAAGTATTTTGG + Intronic
922382716 1:225048705-225048727 TTTTTCTTGGACAAATATCTAGG + Intronic
923323054 1:232855824-232855846 TTTTTCTTGAATAAATATCTAGG + Intergenic
1063523442 10:6761380-6761402 TTGACCTTGTGGTAGTATCTAGG - Intergenic
1063742894 10:8844202-8844224 GTGTTCTTCTAGAAGGGTCTAGG + Intergenic
1066636136 10:37503489-37503511 ATGTCCTTGAAGAAGTAGCTAGG - Intergenic
1067509724 10:46884897-46884919 GTGTTTTTGTTGAAATATCTAGG + Intergenic
1067652530 10:48166961-48166983 GTGTTTTTGTTGAAATATCTAGG - Intronic
1068336290 10:55636037-55636059 TTGTTCTTGTATATATATCCAGG + Intergenic
1070122482 10:73592065-73592087 TTGTTCTTGGTGATGTAACTAGG - Intronic
1073195778 10:101690270-101690292 TTGTTCTTGTAAACGGAACTAGG + Intronic
1076647903 10:131966037-131966059 ATGTGCATGTAGAAGTTTCTAGG + Intergenic
1080085611 11:28278091-28278113 TTGTTTTTGTACAAGTTTATGGG - Intronic
1085487463 11:76878671-76878693 TTTTTCTTGAATAAATATCTAGG + Intronic
1085748039 11:79131497-79131519 TAGTTCTTGTAGTGGTAGCTGGG - Intronic
1085953874 11:81367445-81367467 TTGTTCTTGTTGAAGAATAATGG - Intergenic
1086359700 11:86045259-86045281 TTCTTCTTGTAGAATAATCCTGG - Intronic
1086590923 11:88512650-88512672 TTATTCTTTTCCAAGTATCTGGG - Intronic
1086986036 11:93250544-93250566 TTGATCTTGAAGGAGCATCTGGG - Intergenic
1087497885 11:98913646-98913668 TTGGTCATGTAGAAGCATCTCGG + Intergenic
1088158234 11:106835818-106835840 TTATTCATGGAGAAGTCTCTTGG - Intronic
1089031578 11:115335415-115335437 TTGTTTATGTTGAAGTATATGGG + Intronic
1092507668 12:9120739-9120761 TTGTCTTTGACGAAGTATCTTGG + Intergenic
1092587682 12:9916916-9916938 TTGTTGTTATAGAAGCATCAGGG - Intronic
1094646127 12:32326242-32326264 TTGTTCTATAAGAAGTATCATGG - Intronic
1094868490 12:34570006-34570028 CTGTTCTTGTAGAATTATGAAGG - Intergenic
1101082177 12:101198641-101198663 TTGTTTTTGTAGAAAGATTTTGG - Intronic
1101494296 12:105238851-105238873 GTGTTATTCTAGAATTATCTCGG - Intronic
1101676684 12:106923511-106923533 TTCTCCTTATAGAAGTATCCTGG - Intergenic
1104105943 12:125659407-125659429 TTGGTCTTGTATATGTATCTGGG + Exonic
1105567135 13:21560749-21560771 TTATGCTTGTAGAAATGTCTAGG + Intronic
1107167109 13:37295522-37295544 TTGTACTAGTAAAAGTATTTAGG + Intergenic
1108346099 13:49548488-49548510 CTGTTCTTGTATAAGTTTTTGGG - Intronic
1110717647 13:78725412-78725434 TTCTTGTAGTAGAAGTCTCTTGG - Intergenic
1113442269 13:110338498-110338520 CTGCTCTAGTAGAATTATCTGGG - Intronic
1117306731 14:54484668-54484690 CTGTTCTTGTAGAATGAGCTTGG - Intronic
1118965717 14:70582680-70582702 TTTTCCTTTTATAAGTATCTTGG - Intronic
1127280075 15:57481716-57481738 TTTTTCTTGGATAAATATCTAGG + Intronic
1127652935 15:61026808-61026830 TTGTTCTGGGAGAAGTTGCTAGG + Intronic
1128121170 15:65147834-65147856 TTGTTCTTCCAGACTTATCTAGG + Intergenic
1129087074 15:73105419-73105441 TTAATATTGTAAAAGTATCTAGG + Intronic
1129551193 15:76451359-76451381 TTTTTCTTGGAGAAATAGCTAGG + Intronic
1131869954 15:96753620-96753642 CAGTTCTTGTAGTGGTATCTTGG - Intergenic
1134398111 16:13884136-13884158 TTATTTTTGTGGAAGTATTTAGG - Intergenic
1139782620 16:69364345-69364367 TTGTTGTATTAGAATTATCTGGG + Intronic
1141233037 16:82188496-82188518 TTCTTATTGTATAAGAATCTTGG + Intergenic
1141545154 16:84762001-84762023 TTGTTCTGTTTGAAGCATCTAGG - Intronic
1142562118 17:816407-816429 GTTTTCTTGCAGAAGGATCTTGG - Intronic
1143146087 17:4776669-4776691 ATATTCTTGTAGATGTATTTAGG + Intronic
1144535477 17:16085373-16085395 TTTTTCTTGTACAATTACCTGGG - Intronic
1145873679 17:28298796-28298818 TTGTTTTTTAAGAAGTATCCGGG - Intergenic
1150572626 17:66400987-66401009 TTGTTCTTCTTTAAGTATTTGGG + Intronic
1150892502 17:69169553-69169575 TTGTTCTTTTTTAAGTATCTTGG - Intronic
1151247981 17:72810244-72810266 TTTTTCTTGTATATGTACCTAGG - Intronic
1153142727 18:1993378-1993400 TTATTCTTGGATAAATATCTAGG - Intergenic
1153356815 18:4146085-4146107 TTACTCTTGTAGAATTATATTGG + Intronic
1154003835 18:10508599-10508621 TTGTTCTTGGAGAACTGTGTAGG - Intergenic
1154093404 18:11386498-11386520 TTCCTCTTGCATAAGTATCTAGG - Intergenic
1155365643 18:25046849-25046871 TTATTCGTGTAGAAGAATCTTGG + Intergenic
1155382314 18:25237566-25237588 TTGTTATTTTTAAAGTATCTTGG - Intronic
1155797349 18:30057245-30057267 TTGTTCTTTTTAAAATATCTTGG + Intergenic
1156770716 18:40719740-40719762 TTGATCTTGTACAATTATCAAGG - Intergenic
1157782496 18:50452202-50452224 TTGGTCTGGTGGAATTATCTCGG + Intergenic
1158838430 18:61357038-61357060 TTGTTTTACTAAAAGTATCTTGG - Intronic
1159366155 18:67468065-67468087 TTGCTCTACTAGAATTATCTGGG + Intergenic
1159367041 18:67480735-67480757 TTTTTCTTGTATAAATACCTGGG - Intergenic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1167820801 19:51926092-51926114 TTACTGTTGTATAAGTATCTAGG + Intronic
926249295 2:11144627-11144649 GTGCTCTTTTAGGAGTATCTGGG + Exonic
926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG + Intergenic
927327875 2:21827266-21827288 TAATTCTTGGAGAAGTACCTGGG - Intergenic
928309456 2:30197428-30197450 TGGTTCTTGCTGAAGTCTCTAGG - Intergenic
929316685 2:40487649-40487671 TTATTCTTAAGGAAGTATCTTGG - Intronic
930658427 2:54029984-54030006 TTGGTCTGGTGGAATTATCTCGG - Intronic
932556586 2:72830037-72830059 TTGGTCCTGTGGCAGTATCTAGG - Intergenic
932922825 2:75936734-75936756 TTGTTCTTTTAGGATTATGTAGG + Intergenic
932925317 2:75966460-75966482 TTGTTCTTGTACAGATATCATGG - Intergenic
933163149 2:79048702-79048724 TTGTTCTTGTAGTAGTTTTGTGG - Intergenic
935507531 2:103924708-103924730 TTATTATTGTAGAATTAGCTGGG + Intergenic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
935839572 2:107094606-107094628 TTGTTCTAGTAGCAGAATTTTGG + Intergenic
935916210 2:107953665-107953687 TTGTTGTTGTTGAGCTATCTGGG - Intergenic
935979802 2:108615562-108615584 GTGTTCATGGAGAAGGATCTGGG + Intronic
937179004 2:119972554-119972576 TCTTTCTTGTATAAGTATCCTGG + Intronic
938052245 2:128185126-128185148 TTGTTTTTGCAGAATTATTTTGG + Intronic
938215634 2:129510874-129510896 TTTTTATTCTAGAAGGATCTAGG - Intergenic
939549720 2:143599223-143599245 TCTTCCTTGTAGAAGCATCTAGG - Intronic
941264792 2:163348205-163348227 TTGTTCTAGTAGTAGTAGGTGGG - Intergenic
942408113 2:175676911-175676933 ATTTTCTTCTAGAAGTATTTGGG + Intergenic
943891542 2:193293260-193293282 TTGTTCTTCTAGAAGTTTTATGG - Intergenic
945859741 2:215107036-215107058 TTGTACTTTTAGAGGTATTTAGG + Intronic
946173626 2:217909665-217909687 TTGTTCTCGGAGAAGCATCTGGG - Intronic
946213117 2:218163302-218163324 TTGTCCCTGTGGAAGTATCTTGG - Exonic
946513097 2:220381655-220381677 TTGTTCTTGTAGAATGAGTTTGG + Intergenic
946520770 2:220462104-220462126 TTGTTCTTGTAGCAGCAGATAGG - Intergenic
1169816128 20:9658397-9658419 TTGTTCTTGTGGTGGTATCAGGG + Intronic
1171163759 20:22952537-22952559 GTGTACCTGTAGAAGGATCTGGG + Intergenic
1171511353 20:25687116-25687138 TTGTTGTTATAAAAGTATTTTGG + Intronic
1174214236 20:48903908-48903930 TTGTTCTTCTAGATGACTCTAGG - Intergenic
1174881934 20:54289397-54289419 TAGTTCTAGTAGAAGTAAATGGG + Intergenic
1174894799 20:54436951-54436973 TGGTTTATGTAGAAGTTTCTAGG + Intergenic
1178801239 21:35797732-35797754 TTGTTCTTGCAGAATGAGCTGGG + Intronic
1179773242 21:43641041-43641063 TTTTTCTTTTAAAAGTTTCTTGG + Intronic
1180102982 21:45598574-45598596 CTGGTCTGGTAGGAGTATCTGGG - Intergenic
1181838401 22:25630308-25630330 TTGTTCTTAGAGAAGTCTCTGGG + Intronic
1184611075 22:45603703-45603725 TTGATCTGGTAGAAGAAACTTGG + Intergenic
1185249150 22:49790563-49790585 TTGTTCTTGCAGACTTAACTAGG - Intronic
949841275 3:8322964-8322986 TTTTTCTTGTATAAATACCTAGG + Intergenic
949996981 3:9625804-9625826 TTTCTCTTGTATAAATATCTAGG + Intergenic
950916301 3:16648988-16649010 TTCTTCTTGAAGAAGTTTCATGG + Intronic
950982306 3:17320111-17320133 TTGTTCGTGTAAATATATCTTGG + Intronic
954666751 3:52258064-52258086 TTGTTCTGTTAGTATTATCTAGG + Intronic
954728787 3:52639570-52639592 TTTTTCTTGTAGAATTAGCTGGG + Intronic
955926331 3:64008897-64008919 TTTTTCTTGGAAAAGTATTTAGG + Intergenic
956178665 3:66498798-66498820 TTGTTCATGGAGCAGTGTCTCGG + Intronic
956420660 3:69083296-69083318 TTATTGTTGTGGATGTATCTGGG - Intergenic
956573334 3:70722022-70722044 GTGTTCTGGTGGATGTATCTAGG - Intergenic
957182312 3:76895151-76895173 ATTCTCTTGTTGAAGTATCTGGG + Intronic
957474037 3:80701281-80701303 TTCTTCTTGTAGAAATATTTTGG - Intergenic
957538380 3:81535363-81535385 ATGTACTTGTAGCAGCATCTAGG - Intronic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
957951011 3:87126427-87126449 GTGTTCTTTTAGAAGGATCTCGG - Intergenic
958098992 3:88984580-88984602 TTGTTCTTGTGGAGGTAGCAGGG - Intergenic
959301015 3:104601176-104601198 TTGTTCTTGTGTAACTAGCTAGG - Intergenic
959850370 3:111079327-111079349 TTTTTCATGTAAAAGGATCTGGG + Intronic
959850416 3:111080282-111080304 TTTTTCATGTAAAAGGATCTGGG + Intronic
960277486 3:115744469-115744491 TTGAACTTGTAGTAGTTTCTAGG - Intergenic
962782763 3:138736551-138736573 ATGTTTTTGTTGAAATATCTTGG - Intronic
963677264 3:148327984-148328006 TTGTTGTTGTTGAAGAAACTAGG + Intergenic
964050274 3:152383643-152383665 TTGTTTTTGTAGAATCATCTGGG + Intronic
965208580 3:165754247-165754269 TTCTGCTTGAAGATGTATCTAGG + Intergenic
965960350 3:174422197-174422219 TTCTTCTTGTTGAAGTTTCTTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967795136 3:193591800-193591822 TTGTTGTTGTTAAAGTCTCTTGG + Intronic
968341869 3:197962477-197962499 TTGTTCTTGGATAAATACCTAGG + Intronic
971142523 4:23939795-23939817 TTGTTCTTGTAGATAAACCTAGG - Intergenic
971176643 4:24288689-24288711 TTGTTCTTGTAGAAAAATGCTGG - Intergenic
975355839 4:73402558-73402580 TTTTCCTTGTAGAAGTCCCTGGG - Intronic
975495627 4:75033164-75033186 TTTTGTTTGTAGAAATATCTTGG - Intronic
976932048 4:90578748-90578770 TTCTGCCTGTAAAAGTATCTAGG + Intronic
977067730 4:92340229-92340251 TTGTGATTGTACAAGTATATGGG - Intronic
977245819 4:94630200-94630222 TTGTGCTTGTATAAATAACTGGG - Intronic
977281137 4:95041628-95041650 TTGTTCTAGAAGAAATATCTGGG - Intronic
978690269 4:111500199-111500221 ATTTTCCTGTAGAAATATCTAGG + Intergenic
978701445 4:111651374-111651396 TTGTGTTTGCAGAACTATCTGGG - Intergenic
979416233 4:120442750-120442772 TTGTTTCTGTTGAATTATCTTGG - Intergenic
980250950 4:130313943-130313965 TTTTTATTTTAGAATTATCTTGG - Intergenic
980652971 4:135745045-135745067 TTATTTATTTAGAAGTATCTTGG - Intergenic
980656412 4:135793005-135793027 TGGTTCTTGTAGAGGAATTTGGG - Intergenic
981400808 4:144312165-144312187 CAGTTCTTGTAGTAGTAGCTTGG + Intergenic
981598940 4:146462996-146463018 TGGTGCCTGTAGAAGGATCTGGG - Intronic
982509157 4:156259268-156259290 TTTTTATGGTAGAAGTAACTGGG + Intergenic
983309031 4:166033197-166033219 TTGTTCTAGGATAAATATCTGGG - Intronic
984086908 4:175324984-175325006 TTGTTCTATCAGAAGTATGTAGG + Intergenic
987230499 5:15889009-15889031 GTGTCCCTGTAGAAATATCTGGG + Intronic
987509135 5:18813823-18813845 TTTTTCTTGTAGAAACTTCTGGG + Intergenic
988094042 5:26579882-26579904 GTGTTATTGTGGAAGAATCTTGG + Intergenic
990403448 5:55464167-55464189 TTTTTCTTGAACAAATATCTAGG - Intronic
991028750 5:62059906-62059928 TTGTTCTTTTAAGAATATCTTGG - Intergenic
991176563 5:63695012-63695034 TTTTACTTGTGGAATTATCTAGG - Intergenic
993098460 5:83507306-83507328 TTGTTCAGGTACAAGTATCCAGG + Intronic
993891569 5:93481700-93481722 TTGTTGTTGTAGAAGATACTTGG - Intergenic
995024114 5:107399037-107399059 TCCTTCTTGTAGAATGATCTTGG + Intronic
995812159 5:116119770-116119792 ATGTTCTTTAAAAAGTATCTAGG - Intronic
996377632 5:122830178-122830200 TTTTTCTTCTAGATGTATATAGG + Intergenic
996472237 5:123874442-123874464 TTTTTCTTCTAGATGTATCAGGG + Intergenic
1001592995 5:172879125-172879147 CTGTTCTTGCAGACGAATCTCGG - Intronic
1001797294 5:174513199-174513221 TTGTTCTTGTGGGTGTATATTGG - Intergenic
1002383185 5:178845261-178845283 TTGTTTTAGTTGAAGAATCTAGG + Intergenic
1003499540 6:6693292-6693314 CTGTTCTAGTTGAAGAATCTGGG + Intergenic
1005090218 6:22048577-22048599 TTGTACTTTTAGTAGTAACTGGG + Intergenic
1005485778 6:26298003-26298025 TAGTGTTTGTAGAAGTATCAAGG - Intergenic
1005906757 6:30268039-30268061 TTTTCCTTGTAGAATTATTTGGG - Intergenic
1007675779 6:43593572-43593594 TTTTTCTTGTTGAATTATCTTGG - Intronic
1009484552 6:64203471-64203493 TTGTTCTTGGAGAATTATTTGGG + Intronic
1010084520 6:71901255-71901277 TTTTTCTTATATAAATATCTAGG - Intronic
1011716465 6:90110651-90110673 TTGTTTTTCTTGAAGTATCAGGG + Intronic
1013693479 6:112672880-112672902 TTGTTTCTGTAGAAATATATTGG + Intergenic
1013833321 6:114300647-114300669 TTTTTCTTGGATATGTATCTAGG - Intronic
1015784838 6:136911787-136911809 TTTTTCTTGGACAAATATCTGGG + Intronic
1017093513 6:150782604-150782626 TTGTTTTGGTTGAAGTATATAGG - Intronic
1018270908 6:162076330-162076352 TTGTCCTTGGACAAGTATGTTGG + Intronic
1018462668 6:164013781-164013803 CTGTTCTTGGAAATGTATCTTGG + Intergenic
1021852129 7:24818715-24818737 TTGTGATTGTAGATGTAGCTGGG - Intronic
1023071633 7:36440527-36440549 TTGTGCTTGCAGAGGTATGTAGG + Intronic
1030379306 7:108794329-108794351 TTGTTTTTTTAGGAGTTTCTGGG + Intergenic
1030478993 7:110078205-110078227 TTTTTCCTGTAGAATTATTTGGG + Intergenic
1030495921 7:110300024-110300046 TTGTTCATTTAGAAATATGTTGG - Intergenic
1030748164 7:113194335-113194357 GTGTTCTTGTAGTAGTTTCATGG + Intergenic
1030941342 7:115653811-115653833 TTGTTAGTTTAGAAGTTTCTTGG - Intergenic
1030964263 7:115970219-115970241 TTCTTCTTGAAGAGCTATCTGGG - Intronic
1031784460 7:126011602-126011624 TTGATTTTGTTAAAGTATCTAGG - Intergenic
1037163773 8:15802002-15802024 CTGTTCTTCGAGAAGAATCTTGG + Intergenic
1037514830 8:19620004-19620026 TTCTTCTTATAGAAGTTTCCTGG - Intronic
1038217490 8:25575923-25575945 TTGTTCTGGTAGAACAATATTGG + Intergenic
1038387813 8:27165981-27166003 TGGTTTATGTAGAAATATCTAGG + Intergenic
1043069062 8:75615507-75615529 TTTTTCTTCTGGAAGTTTCTTGG - Intergenic
1043131274 8:76465033-76465055 TTGTTAATGTAGCAGTATATTGG - Intergenic
1043310314 8:78851048-78851070 TTGTTGTGGTAGAAATAACTTGG + Intergenic
1044157406 8:88864601-88864623 TTAATTTTCTAGAAGTATCTGGG + Intergenic
1044963400 8:97553046-97553068 TTGACCTTGAAGAATTATCTAGG + Intergenic
1045641082 8:104251657-104251679 TAGTTCATCTAAAAGTATCTGGG - Exonic
1048920641 8:139226929-139226951 GTACTCTTGTAGTAGTATCTTGG - Intergenic
1050067222 9:1772530-1772552 TTCTGCTTGCACAAGTATCTAGG + Intergenic
1051429905 9:16971317-16971339 TTCTTATTGTTGTAGTATCTTGG - Intergenic
1051800485 9:20927663-20927685 GTGTCTTTGTAGAAGTATTTTGG + Intronic
1053189693 9:36052527-36052549 TTGTTTTTGGAGAAGTCTGTTGG + Intronic
1054990066 9:71314986-71315008 TTGATCTTGTACAAGGTTCTTGG + Intronic
1056216940 9:84414206-84414228 TTGTTCTTGAAAAAGTTACTAGG - Intergenic
1057642880 9:96844235-96844257 TTTCTCTTGTATAAGTACCTAGG - Intronic
1058938068 9:109787250-109787272 TGGTTCTTTTAGAGGTTTCTTGG + Intronic
1060776298 9:126377116-126377138 TTGTTGTTTTAGAAGAATCCTGG + Intronic
1186321696 X:8433965-8433987 TTGTTTATGTAGAACTATATTGG - Intergenic
1186741390 X:12522100-12522122 TTTTTTTTGAAGAAGTAACTAGG - Intronic
1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG + Intronic
1187620516 X:21047906-21047928 TTGTTCAGATAGAAGCATCTGGG - Intergenic
1188180867 X:27053971-27053993 TTTTTCCTGTTGAATTATCTTGG + Intergenic
1188205981 X:27358979-27359001 TTTTTCTTGTATAAATATCAAGG - Intergenic
1192396852 X:70790710-70790732 TTGCTCTTGTAGGAGAATCCAGG - Intronic
1193020673 X:76789371-76789393 TTTTTCTTGGTGAAGTCTCTAGG - Intergenic
1193251130 X:79291603-79291625 TTCTTCTAGCAGAAATATCTAGG - Intergenic
1200176571 X:154121308-154121330 TGTTTCTTGGAGATGTATCTAGG + Intergenic
1202011902 Y:20350454-20350476 TTGTTCCTTCAGAAGTATCCAGG + Intergenic