ID: 1165207652

View in Genome Browser
Species Human (GRCh38)
Location 19:34204594-34204616
Sequence CTGTAGTCCTAGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8713
Summary {0: 3, 1: 30, 2: 170, 3: 1341, 4: 7169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165207652 Original CRISPR CTGTAGTCCTAGCACTCAGG AGG Intronic
Too many off-targets to display for this crispr