ID: 1165209821

View in Genome Browser
Species Human (GRCh38)
Location 19:34225312-34225334
Sequence TTTATGATTTAGGAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165209821_1165209825 -9 Left 1165209821 19:34225312-34225334 CCCTACACCTCCTAAATCATAAA 0: 1
1: 0
2: 0
3: 48
4: 319
Right 1165209825 19:34225326-34225348 AATCATAAAATCATTTCACCTGG 0: 1
1: 0
2: 3
3: 37
4: 335
1165209821_1165209828 13 Left 1165209821 19:34225312-34225334 CCCTACACCTCCTAAATCATAAA 0: 1
1: 0
2: 0
3: 48
4: 319
Right 1165209828 19:34225348-34225370 GCACCTTTAAAGGTAGAAAATGG 0: 1
1: 0
2: 0
3: 20
4: 216
1165209821_1165209826 3 Left 1165209821 19:34225312-34225334 CCCTACACCTCCTAAATCATAAA 0: 1
1: 0
2: 0
3: 48
4: 319
Right 1165209826 19:34225338-34225360 ATTTCACCTGGCACCTTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165209821 Original CRISPR TTTATGATTTAGGAGGTGTA GGG (reversed) Intronic
901357605 1:8664750-8664772 TTTGTGATGTTGGAGGTGTTTGG - Intronic
902068387 1:13709774-13709796 TTCATGATTCAGGAAGTTTATGG - Intronic
902212550 1:14914144-14914166 TTTCTGATTCAGGAGGTCTGGGG + Intronic
902976615 1:20093123-20093145 CTGATGAGGTAGGAGGTGTATGG + Intergenic
903496406 1:23770742-23770764 TTTATGATTTACGATGTGCCAGG - Intergenic
903573519 1:24323310-24323332 TTTCTGATTCAGTAGGTCTAGGG - Intronic
903831845 1:26180167-26180189 TTTCTGATTCAGCAGGTGTGGGG + Intronic
904912085 1:33942642-33942664 GTTATGATTCAGCAGGTTTAGGG - Intronic
905380510 1:37558397-37558419 CTTATGACTTAGGGGCTGTATGG - Intronic
905688045 1:39922806-39922828 TCCATGATTTAGCAGGAGTATGG - Intergenic
907895791 1:58689761-58689783 TTTATGACTTTGGAAGTTTATGG - Intronic
907923900 1:58938240-58938262 TTTATTTTTTAAGAGGTGTGGGG + Intergenic
908331148 1:63072455-63072477 TTTTAGATTAAGGAGGTGTGGGG - Intergenic
909587912 1:77311998-77312020 TTTTTGCTTCAGGAGCTGTAGGG - Intronic
910020869 1:82587825-82587847 ATTATGATTTAGGAATTGAAAGG - Intergenic
910043333 1:82881451-82881473 TTTATGCTTTTGGAGGTGAGAGG - Intergenic
910315579 1:85879185-85879207 TTTATATTTTAGGAGTTTTATGG + Intronic
910806585 1:91194428-91194450 TTTCTGATTCAGTAGGTCTAGGG - Intergenic
910965276 1:92802184-92802206 TTTCTGATTTAGTAGGTGTTAGG + Intergenic
911971538 1:104444211-104444233 TTTCTGATTTAGGAGATGGAGGG - Intergenic
912010223 1:104950437-104950459 TTTATGAATTTGGATGTATATGG - Intergenic
916230329 1:162535178-162535200 TTTAAGATTTAGGATGGGAAAGG - Intergenic
916982220 1:170150642-170150664 TTTATGATTTAACAGGAATAGGG + Intronic
917385501 1:174469472-174469494 ATTCTGATTTAGGAGGACTAAGG - Intronic
919911763 1:202115448-202115470 TTTCTGATCTAGCAGGTCTACGG + Intergenic
923113329 1:230910530-230910552 TTTAGGATTGAAGAGATGTAGGG + Intronic
923121293 1:230994197-230994219 TTTAGGATTTACGAGATTTATGG - Intronic
1063279807 10:4615535-4615557 TATAAAATTTAGGAAGTGTATGG + Intergenic
1063685599 10:8234725-8234747 TTTATGTTTTTGCAGCTGTATGG + Intergenic
1063837793 10:10035408-10035430 TTTCTGATTTAGTAGGTTTGCGG + Intergenic
1064578461 10:16769585-16769607 TTTCTGATTTAGCAGGTTTAGGG + Intronic
1064818517 10:19295853-19295875 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1065165046 10:22967371-22967393 ATTATGATTTAAGAGGTATATGG - Intronic
1065308837 10:24394958-24394980 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1065334025 10:24636375-24636397 TTTCTGATTCAGGAGATCTAGGG - Intronic
1065616406 10:27529833-27529855 GTTATAATTTAGGGGGTGGAGGG - Intronic
1065946307 10:30608242-30608264 TTTTTGATTTAAAAGGTTTAAGG - Intergenic
1070161478 10:73869193-73869215 ATTCTGCTTTAGGAGGTCTAGGG - Intronic
1070514260 10:77189093-77189115 TTTCTGATTTAGTAGGTTTGGGG + Intronic
1070707945 10:78655264-78655286 TTTATGATTTAGGGGATCTGGGG + Intergenic
1071041534 10:81315008-81315030 TTGATGATTTATGGGGCGTAAGG + Intergenic
1073668292 10:105558233-105558255 TTTATAAATAAGGAGCTGTAGGG + Intergenic
1074605533 10:114960810-114960832 TTTAAGATTAAGGAGGCATAGGG + Intronic
1078971248 11:16414130-16414152 GTTATGATTTTGGAGGAGTGGGG - Intronic
1078973358 11:16441787-16441809 TTTATGATTTAGAATTTGTAGGG - Intronic
1080546666 11:33326272-33326294 TTTCTGATTTAATTGGTGTAGGG + Intronic
1083452945 11:62758277-62758299 TTAGAGATTTAGGAGTTGTATGG + Intergenic
1084418469 11:69048606-69048628 TTGCTGATTTAGTAGGTTTAAGG + Intergenic
1085961411 11:81466955-81466977 TTTTTGATTTTGGAAGTTTATGG - Intergenic
1086204664 11:84243601-84243623 TTTCTGATTTAGTAGGTCTTTGG + Intronic
1086843650 11:91720542-91720564 CATAGGATTTTGGAGGTGTAGGG + Intergenic
1086889801 11:92244700-92244722 TTTCTGATTTAGTAGGCTTACGG + Intergenic
1087425248 11:97977137-97977159 TTTATAATTTATGAGTTGCAGGG + Intergenic
1087530677 11:99377143-99377165 TTTTTGGTCTAGGAGGTGTGAGG + Intronic
1088227613 11:107638811-107638833 TTTAGGCTTTATGAGCTGTACGG - Intronic
1088278188 11:108111264-108111286 TTTCTGATTGAGTAGGTCTAGGG - Intergenic
1089187547 11:116629900-116629922 TTTATGATTTGGGAGGTTCTTGG - Intergenic
1089996019 11:122908261-122908283 TTTCTGATTCAGCAGGTGTAGGG + Intronic
1090843667 11:130513763-130513785 TTTCTGATTTAGTAGGTCTAGGG + Intergenic
1091415103 12:275988-276010 TTTCTGTTTCAGGAGGTCTAGGG + Intergenic
1091650827 12:2307945-2307967 ATTATGATTTAGGAGGTCTGGGG + Intronic
1091836058 12:3586620-3586642 TTTCTGATTCAGGAGGTCCAGGG - Intronic
1093098360 12:14997829-14997851 TATATAATTGATGAGGTGTAAGG - Intergenic
1094284433 12:28776883-28776905 TTTATGTTGGAGGAGGGGTAGGG + Intergenic
1095120326 12:38410069-38410091 TTTCTTATTTGGGAGGTGTAAGG - Intergenic
1095181099 12:39147152-39147174 TTTAAGATTTACGAGGTATATGG + Intergenic
1095716800 12:45355201-45355223 TTTAAGAGTTGGGAGGTGTTTGG + Intronic
1096018887 12:48305750-48305772 TTTCTGATTTAGTAGGTTCAGGG - Intergenic
1096382633 12:51172258-51172280 TTTGTTATTCAGAAGGTGTAGGG + Intronic
1096657610 12:53101454-53101476 TTCCTGATTCAGGAGGTGTGGGG + Intronic
1097283015 12:57857004-57857026 TTTCTGATTCAGTAGGTGTGAGG - Intergenic
1097450878 12:59735092-59735114 TTTGTGATTTAGGTGCTGAACGG + Intronic
1097887179 12:64740906-64740928 TTTATGGTTTGGGAGGTGCTGGG - Intronic
1100064791 12:90629066-90629088 TTTATGATTAAGTAGGTATGAGG - Intergenic
1101068365 12:101046693-101046715 TATATGAATGAGGAGGGGTAAGG - Intronic
1104314806 12:127687881-127687903 TTCATGTATGAGGAGGTGTATGG - Intergenic
1104465865 12:128989945-128989967 TTTTTAATTTAGGAGCTGCAGGG - Intergenic
1106135838 13:26972873-26972895 TTTGTGAATGAGGAGGTGTTGGG + Intergenic
1106314553 13:28581852-28581874 TTTCTGATTTAGCAGGTCTGAGG - Intergenic
1106740149 13:32631900-32631922 ATTTTGATTCAGGAGGTGTGGGG - Intronic
1107440957 13:40426779-40426801 TTCATGATTTAATTGGTGTAGGG + Intergenic
1107705048 13:43094372-43094394 TTTCTGATTAAGTAGGTCTAGGG - Intronic
1110323266 13:74184091-74184113 ATTCTGATTCAGGAGGTCTAAGG - Intergenic
1110758788 13:79207320-79207342 TTTATGATGTAGAAAGTGTTAGG - Intergenic
1111191637 13:84815561-84815583 TTTATTTTTTAGGAGGGGAATGG + Intergenic
1111279902 13:86008559-86008581 TTTATTATTTAGGCTGAGTAAGG + Intergenic
1111419167 13:87987681-87987703 TTTAAGATTTAGCAGGAGTTGGG - Intergenic
1111623829 13:90757629-90757651 TTTCTGATTTAGGAGGTCTGGGG + Intergenic
1111958041 13:94779678-94779700 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1112384573 13:98926978-98927000 TTCATGAGTTTGGAGGTGGAGGG - Intronic
1113345683 13:109476231-109476253 TTTATGCTTCAGAAGGTGTGAGG + Intergenic
1115434021 14:33353385-33353407 TTTGTGATCCAGGAGTTGTAGGG + Intronic
1116267855 14:42718875-42718897 GTTTTGATTTAGTAGGTGTAGGG + Intergenic
1117665913 14:58055674-58055696 ATTCTGATTCAGGAGGTGTAGGG - Intronic
1117759934 14:59015846-59015868 TTTAGGATTCAGGAGGTGTGTGG + Intergenic
1119790112 14:77342358-77342380 TCTATCATTTAGTAGGTGAAAGG + Intronic
1119963941 14:78892102-78892124 TTTCTCATTTAGCAGGTGTATGG - Intronic
1120453561 14:84702441-84702463 TTTCTGATTCAGTAGGTGTCAGG + Intergenic
1120895910 14:89532066-89532088 TTTCTGATTCAGGAGGTCTGGGG - Intronic
1121399332 14:93658332-93658354 TTTCTGATTCAGCAGGGGTAGGG + Intronic
1121862620 14:97332614-97332636 TTTATGATTTAAGACATGTTAGG - Intergenic
1123217189 14:106822101-106822123 TTTATGATTTGGAATGTGGAAGG + Intergenic
1123470255 15:20545779-20545801 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1123647800 15:22454921-22454943 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1123727706 15:23121106-23121128 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1123730554 15:23140756-23140778 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1123748692 15:23338182-23338204 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1124281066 15:28362065-28362087 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1124301636 15:28549556-28549578 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1124531652 15:30513480-30513502 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1124767006 15:32494214-32494236 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1125562703 15:40649253-40649275 GTTAGAATTTAAGAGGTGTATGG - Intronic
1126168348 15:45672953-45672975 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1126464681 15:48951039-48951061 TTTAGGATTTAGGTGTTCTATGG - Intronic
1127349361 15:58135010-58135032 ATTTAGAATTAGGAGGTGTAGGG + Intronic
1127494654 15:59498625-59498647 TTCATTATTTAGTAGGTGTTAGG + Intronic
1129448375 15:75634730-75634752 TTTCTGATTCAGGAGGTCTGGGG - Intergenic
1129561291 15:76572710-76572732 TTTCTGATTAAGTAGGTTTAGGG - Intronic
1129761830 15:78133358-78133380 TTTCTGATTTAGAAGGTCTGGGG + Intronic
1130556361 15:84925328-84925350 TTTCTGATTCAGCAGGTCTAGGG - Intronic
1131860349 15:96646568-96646590 ATTCTGATTTAATAGGTGTAGGG + Intergenic
1133178377 16:4033587-4033609 TTTATGATTTAGTAGAGATAGGG + Intronic
1133606918 16:7396475-7396497 CTTATGAATCAGGACGTGTAGGG - Intronic
1134119739 16:11575297-11575319 TTTTTGTTTTGGGAGGGGTACGG + Intronic
1134769852 16:16798755-16798777 TTTCTGATTTAGAATGTGTCTGG + Intergenic
1135142454 16:19933272-19933294 TTTTTGTTTTAGGAGCTGTTTGG - Intergenic
1135490071 16:22901420-22901442 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1137875868 16:51996007-51996029 TTTGTGATTTAAGATGTGTGTGG + Intergenic
1138009571 16:53365148-53365170 TTTCTGATTCAGGAAGTGTGGGG - Intergenic
1138145013 16:54601075-54601097 TTTATGCCTTAAGTGGTGTAAGG + Intergenic
1138326982 16:56182236-56182258 TTTATAAATTAGGAGATGTTCGG + Intergenic
1140171748 16:72611886-72611908 CTTTTGATTTGGGAGGTTTAAGG - Intergenic
1141382787 16:83590830-83590852 TTTATGATTCAGAAGGTTCAGGG - Intronic
1141904048 16:87011272-87011294 TTTTTGATTTGGGGGGTGTGAGG - Intergenic
1141916962 16:87104984-87105006 TTTATTTTTTATGTGGTGTAGGG + Intronic
1143877102 17:10000211-10000233 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1144651332 17:17009092-17009114 TTTCTGAATCAGGAGGTCTAGGG - Intergenic
1144699080 17:17325050-17325072 TGTCTGATTCAGAAGGTGTAGGG - Intronic
1145141070 17:20449247-20449269 TTTTTTAATTAGGAGGTGTGAGG + Intergenic
1149462101 17:56837243-56837265 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1149462701 17:56844519-56844541 TATTTGATTTAGTAGGTATAGGG + Intronic
1150743515 17:67798387-67798409 TTGATGATTTAGAAGGTACAAGG + Intergenic
1151692272 17:75693936-75693958 TTTGTGATTTGGGAGGAGCAGGG + Intronic
1152272676 17:79334167-79334189 ATTGTGATTTAGGAGGTGTGGGG - Intronic
1152825747 17:82463678-82463700 TTTATGTTTTAGCAGATGTCGGG + Intronic
1154429065 18:14294429-14294451 TTCATGATTTTGGAGCTGTAAGG + Intergenic
1155469445 18:26175634-26175656 TTTTTGTTTCTGGAGGTGTATGG + Intronic
1158644245 18:59230255-59230277 TTTCTGATTTAGTAGGTGTTAGG + Intronic
1158940687 18:62403957-62403979 TTTATGATTTTGGAGGGTGAAGG + Intergenic
1159262514 18:66033471-66033493 TTTCTGATTTAATAGGTCTATGG - Intergenic
1161840060 19:6674692-6674714 TTTGTCATTTAGGAGCTGGATGG + Intergenic
1165209821 19:34225312-34225334 TTTATGATTTAGGAGGTGTAGGG - Intronic
1165931272 19:39360845-39360867 ATTCTGATTTAGTAGGTCTATGG - Intronic
1166164290 19:40976317-40976339 TTTCTGATTTAGTAGGTCTGGGG + Intergenic
1166433340 19:42745114-42745136 TTAATTTTTTAGAAGGTGTAAGG + Intronic
1167719871 19:51172021-51172043 TTTGTGGTTTAGCAGGTGAATGG + Intergenic
925152733 2:1626463-1626485 CTTATGATTCAGGGTGTGTAGGG - Intergenic
925560534 2:5188530-5188552 TTTCTGCCTTAGGAAGTGTAAGG + Intergenic
929963493 2:46514340-46514362 ATTCTGATTCAGTAGGTGTAGGG - Intronic
930431282 2:51279553-51279575 TTAATGTTTTATAAGGTGTAAGG - Intergenic
930527951 2:52554814-52554836 TTTTTGATTTAGTAGGTCTGAGG - Intergenic
930992396 2:57673128-57673150 TTTCTGATTTAGAAGGTATTAGG - Intergenic
931251770 2:60537526-60537548 TTTTTGTTTGAGGAGGTGCAGGG + Intronic
931999670 2:67873154-67873176 ATTCTGATTCAGGAGGTCTAGGG - Intergenic
932528944 2:72505156-72505178 TTTATGATTCAGGATATGGAAGG - Intronic
933200009 2:79437533-79437555 TTTATGATTTGATAGTTGTAGGG - Intronic
933788355 2:85862755-85862777 TTACTGACTTAGGAAGTGTAGGG - Intronic
934745337 2:96756117-96756139 TTTGTGTTTTTGGAGGTGGAAGG + Intergenic
935645961 2:105334848-105334870 TTTCTGATTTAGGAGGTTGATGG - Intergenic
935914836 2:107938069-107938091 TTTCTGATTTAGGAGGTTGGTGG + Intergenic
936003753 2:108863201-108863223 TTTATTATTTAGGAGATTAAAGG + Intronic
936897197 2:117441789-117441811 TTTATATTTTAGGAGGCGTTAGG + Intergenic
937101650 2:119275826-119275848 TTTATGTTTTAGGGTTTGTAGGG - Intergenic
937756171 2:125541638-125541660 TTTGTGATTGAGGGGGTTTAAGG - Intergenic
938600183 2:132829717-132829739 GTTCTGAATCAGGAGGTGTAGGG + Intronic
940541727 2:155028871-155028893 GTTATGACTTAGGAGGAGAATGG - Intergenic
940761797 2:157746643-157746665 TTTCTGATTTAGTAGTTCTAGGG - Intronic
940995464 2:160144747-160144769 GTTATGTTTTAGGAAGTGGATGG - Intronic
941016921 2:160368297-160368319 TTTATGATTTAGAAAATGTGAGG - Intronic
941208348 2:162603113-162603135 TCTTTGATTTTTGAGGTGTAGGG + Intronic
941336196 2:164246550-164246572 TGTATGATTCAGAAGGTGTATGG + Intergenic
941432198 2:165426566-165426588 TTTCTGATTTAGTAGGTCTGAGG - Intergenic
944845505 2:203664113-203664135 TTTTTGATTTAGTAGGTCTGAGG + Intergenic
945297418 2:208184197-208184219 GTTTTGATTCAGGAGGTGAAGGG - Intronic
945550698 2:211218466-211218488 TTTCTGATTCAGCAGGTGTGAGG - Intergenic
945824357 2:214701923-214701945 TTTATGTCTTAAGAGGTGAAGGG - Intergenic
945997260 2:216448195-216448217 TATATGATTAAAGAAGTGTACGG - Intronic
1169024406 20:2356864-2356886 TCTATGATTTAGTGGGTGTTGGG + Intergenic
1169924582 20:10769525-10769547 TTTTTTATTGAGGAGGTGTGGGG - Intergenic
1170468662 20:16646433-16646455 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1170812871 20:19688159-19688181 GTTCTGATTCAGGAGGTCTAGGG + Intronic
1171385258 20:24765550-24765572 ATTCTGATTTTGCAGGTGTAGGG + Intergenic
1172185848 20:33030626-33030648 TTTAGGATTTAGGAGGAGCAGGG + Intergenic
1173436847 20:43041023-43041045 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1174598404 20:51703433-51703455 TTAATGATTTAGGATGTGGCAGG - Intronic
1175141411 20:56862855-56862877 TTTATGCTTGAGGGGATGTAGGG - Intergenic
1182625995 22:31646511-31646533 TTTATGATTTTGGAAGTGGCAGG + Intronic
950899428 3:16483876-16483898 TTTCTGATTTAGTAAGTCTAGGG - Intronic
950956907 3:17063510-17063532 GTTCTGATTTAGGAGGTCTGTGG - Intronic
951941274 3:28081509-28081531 TTTCTGATTAAGTAGGTATAGGG + Intergenic
952002301 3:28800113-28800135 TTTCTTATTTAGGAGGTCTTGGG + Intergenic
952025822 3:29080674-29080696 TATATTATTAAGGAGTTGTATGG + Intergenic
952210965 3:31228882-31228904 ACTATGATTTAGGTAGTGTATGG - Intergenic
952743937 3:36760695-36760717 ATTCTGATTCAGGAGGTCTAGGG - Intergenic
953370132 3:42380579-42380601 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
953588148 3:44223742-44223764 TTTCTGATTCAGGAGGTCTAGGG + Intergenic
953619820 3:44523536-44523558 TTTATGATTGAGTAGGTCTATGG + Intergenic
955639600 3:61068041-61068063 TTTCTGATTAAGTAAGTGTAGGG + Intronic
955940508 3:64142932-64142954 TTCATCATTTAGGAGTTGTGTGG - Intronic
956210291 3:66795499-66795521 TTTAGGATTCAGGATGTTTATGG + Intergenic
957172252 3:76752534-76752556 TTCAAGATTGAGGAGGTGTTAGG + Intronic
957718199 3:83960637-83960659 TTTATGTTTTAGGAGCTTTTTGG + Intergenic
959302049 3:104615295-104615317 TTTCTGATTTTGTAGGTCTAGGG + Intergenic
959475367 3:106804902-106804924 TTTATGATAGAGAAGGTTTAAGG - Intergenic
959825911 3:110795498-110795520 TTTCTGATTTAGTAGGTCTAGGG + Intergenic
960072944 3:113452300-113452322 TTTCTGATTGAGTAGGTCTAGGG - Intronic
960160523 3:114345682-114345704 TTTCTGATTTAGGATGTCTGGGG + Intronic
961133458 3:124489778-124489800 ATTCTGATTTAGTAGGTGTGGGG - Intronic
961207211 3:125094112-125094134 GTCATGATTTAGGAAGTGTAAGG - Intronic
962140355 3:132783898-132783920 TTTCTGATTTAGTAGGTATAGGG + Intergenic
962633104 3:137299830-137299852 TTTATGATTCAGTAGATCTAAGG - Intergenic
962748101 3:138412467-138412489 TTTATGATTTAGCAGGTCTGGGG + Intergenic
962864458 3:139435804-139435826 TTTCTGATTTAGGAGATCCAAGG - Intergenic
963067719 3:141277033-141277055 TTAATGATTTTTCAGGTGTAGGG + Intronic
963935579 3:151048869-151048891 TTCATGCCTTAGGAAGTGTAGGG + Intergenic
965368284 3:167826890-167826912 TTTATCATTCAGTAGGTCTAGGG + Intergenic
965679100 3:171231903-171231925 TTTGTGATTTAGGAGCTGGATGG - Intronic
966709160 3:182952413-182952435 TTTCAGATTTAGGAGCTGTTAGG - Intronic
966960509 3:184933045-184933067 TTTCTGATTCAGGAGGTCTGAGG - Intronic
967276379 3:187779397-187779419 TTTCTGATTTCTGAGGTGGAGGG + Intergenic
970024914 4:11613370-11613392 TTTATCAGTTAGGAGATGTATGG + Intergenic
970973002 4:22006557-22006579 TTTTTAATTTAGCAGGTGTAGGG - Intergenic
971384370 4:26129602-26129624 TCTATAATTTAAGAGTTGTAAGG - Intergenic
972093475 4:35318314-35318336 TGTATGATTTAAAATGTGTATGG + Intergenic
972765119 4:42145759-42145781 TTCAGGATTTGGGAGATGTAAGG - Intronic
973662658 4:53123837-53123859 TTTCTGATTCAGTAGGTCTAGGG + Intronic
974960451 4:68693045-68693067 TTTATGATGTAGCATATGTAAGG + Intergenic
975230043 4:71922446-71922468 TTTATGATTTAACAGGTTTGAGG + Intergenic
975372771 4:73607675-73607697 TTTCTGATTCAGGAGTTCTAGGG - Intronic
975952235 4:79788164-79788186 TTTTGGATTTTGGAGTTGTATGG - Intergenic
979632213 4:122916179-122916201 TTTCTGATTCAGTAGGTCTATGG - Intronic
979752737 4:124299645-124299667 TTTAAGATTTCCCAGGTGTATGG - Intergenic
980233574 4:130074863-130074885 TTTCTGCTTTAGGAGGAGTAGGG + Intergenic
980795908 4:137682435-137682457 TTTGTGAGTTAAGAGGTGCAGGG + Intergenic
981244816 4:142523202-142523224 TTTCTGATTTAGTAGGTCTGGGG - Intronic
982123593 4:152164979-152165001 ATTCTGATTCAGTAGGTGTAGGG + Intergenic
982736184 4:159009317-159009339 TTTCTGTTTTAGGAGATATAAGG - Intronic
983003127 4:162445388-162445410 TTAATGATTTGGGGTGTGTATGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984258824 4:177419735-177419757 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
986217766 5:5736778-5736800 TTAATCATTTAGGAGGTACATGG + Intergenic
986854776 5:11855776-11855798 TTTCTGATTTATTAGGTCTATGG - Intronic
987287977 5:16478380-16478402 TTTCTGATTCAGTAGGTCTAGGG - Intronic
987543532 5:19284661-19284683 TTGATGATTTAGGGGGTGGAAGG - Intergenic
988132951 5:27129530-27129552 TTTCAGATTTAGGTGCTGTAAGG - Intergenic
988368626 5:30337056-30337078 TTGCTGATTTAGTAGGTGCAAGG + Intergenic
988917146 5:35905866-35905888 ATTCTGATTTAGCAGGTGTGGGG - Intronic
988993567 5:36693578-36693600 TTTATGATTCAGTAGGTCTAGGG - Intergenic
990173269 5:53079058-53079080 TTTCTGATTCAGTAGGTCTAGGG + Intronic
991008796 5:61859856-61859878 TTTCTGATTAAGTAGGTCTAGGG + Intergenic
991053471 5:62297126-62297148 TTTATGGTTTTGAAGTTGTAGGG - Intergenic
991411515 5:66350634-66350656 TTTATTATTTTGTAGGTGTTAGG + Intergenic
992253111 5:74895346-74895368 TGGATGATTTAGGAAATGTATGG - Intergenic
993693362 5:91030466-91030488 TTATTGATTTTAGAGGTGTAGGG + Intronic
994606848 5:101978692-101978714 TTTAAGATTTAAGAGATTTAAGG - Intergenic
995717625 5:115095539-115095561 GTTCTGATTCAGGAGGTTTAGGG - Intergenic
995728199 5:115204292-115204314 TTTCTAATTCAGGAGGTCTAAGG + Intergenic
995912800 5:117207904-117207926 ATTCTGATTTAGTAGGTCTAGGG - Intergenic
996951607 5:129133373-129133395 ATTGTGATTTAGGAGGTCTGTGG + Intergenic
997547672 5:134722799-134722821 ATAATGATTTAGGAGGTCTGGGG - Intronic
998893282 5:146769312-146769334 TTTCTGATTCAGCAGGTCTAGGG - Intronic
999132974 5:149298856-149298878 ATTCTGATTCAGGAGGTGTGCGG - Intronic
999609328 5:153352155-153352177 TTTCTGATTTGGTAGGTCTATGG - Intergenic
1000340192 5:160271035-160271057 ATTAAGATTTAGGAGGTGGAGGG + Intronic
1000875677 5:166635020-166635042 TTTATGTTTTCGTTGGTGTAAGG - Intergenic
1001716574 5:173821245-173821267 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1005488038 6:26319888-26319910 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1005576380 6:27193472-27193494 TTTATAATTTGGGATGTTTAGGG - Intergenic
1006963313 6:37956280-37956302 TTTCTGATTTAGGAGGCATGAGG + Intronic
1007285661 6:40745574-40745596 TCTTTGATTAAGGAGGTTTAAGG - Intergenic
1007797987 6:44366449-44366471 ATTATGATATAGGTGGTCTAAGG - Intronic
1007949559 6:45859341-45859363 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1008331968 6:50256319-50256341 TTTATTTTTTAGATGGTGTAAGG + Intergenic
1008748659 6:54705500-54705522 TTTATGATCTATCATGTGTAAGG - Intergenic
1009593530 6:65706425-65706447 CTTATTATTTAGGAGATTTATGG - Intronic
1010087350 6:71936453-71936475 GTTTTGCTTTAGGTGGTGTAGGG - Intronic
1010308948 6:74359993-74360015 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
1010828730 6:80504649-80504671 TTTCTGATTCAGTAGGTCTAAGG + Intergenic
1010877730 6:81128466-81128488 TTTTTGATTCAGCAGGTCTAGGG - Intergenic
1011010416 6:82696931-82696953 TTTCTGATTGAGTAGGTCTAGGG + Intergenic
1012646513 6:101690389-101690411 TTAATGATTTTTGAGGTGAAAGG - Intronic
1013280445 6:108631468-108631490 TTTATTTTCTAGGAGGTGGAGGG + Intronic
1014598022 6:123369614-123369636 TTTATGTTGTAGGATGTTTAAGG - Intronic
1015416187 6:132951299-132951321 ATTCTGATTCAGGAGGTGTGAGG + Intergenic
1017648960 6:156563694-156563716 TTTCTGATTCAGGAAGTCTAGGG + Intergenic
1017795067 6:157836544-157836566 TTTCTGATTCAGGAGGTCTGGGG + Intronic
1018288407 6:162265194-162265216 TGTATCATATAGGAGGGGTAAGG - Intronic
1018688522 6:166323076-166323098 CTTGTGATTTAGGAGGTTTAAGG - Intronic
1019641241 7:2104943-2104965 TTTAACATTTAGGAGGTGAGCGG - Intronic
1020346071 7:7164942-7164964 TGTATTATTTAAGATGTGTAGGG + Intronic
1021061771 7:16121391-16121413 TTTATTTTTTGGGAGGTGGAGGG - Intronic
1021149230 7:17129065-17129087 TTAATGGTTTAGGAGGTTAACGG + Intergenic
1021837060 7:24688178-24688200 TTCATTATTTCGGAGATGTATGG + Exonic
1022137813 7:27465970-27465992 TTTATAAATGAGGAAGTGTAGGG + Intergenic
1022205148 7:28156659-28156681 TTTCTGATTTCGTAGGTGTGGGG + Intronic
1022985541 7:35650465-35650487 CTTAGGAATTAGGAGGTGTGTGG - Intronic
1023132478 7:37016562-37016584 TTTATGTTGAAGGAGGAGTACGG - Intronic
1023729442 7:43176649-43176671 TTTATGATTTAGTAGATTAATGG - Intronic
1024307790 7:47942798-47942820 TTTCTGCTTTAGGAGGTCTGGGG - Intronic
1026375591 7:69747130-69747152 TTTCTGATTCAGGAGGTTTAGGG + Intronic
1026773728 7:73218267-73218289 TTTATTATCCAAGAGGTGTAGGG - Intergenic
1027014587 7:74771661-74771683 TTTATTATCCAAGAGGTGTAGGG - Intergenic
1027073446 7:75174296-75174318 TTTATTATCCAAGAGGTGTAGGG + Intergenic
1027571468 7:79873279-79873301 TTTCTGATTTAGCAGGTCTCAGG + Intergenic
1027584103 7:80035326-80035348 ATTATGATTCAGTAGGTCTAGGG - Intergenic
1028294896 7:89116298-89116320 TTTATGATTTAAGACAGGTATGG + Intronic
1028658643 7:93240066-93240088 TTTATTGTATAGTAGGTGTAGGG + Intronic
1029899120 7:104021659-104021681 TTTGGGATTTAAGAGGTGCATGG + Intergenic
1029977813 7:104850702-104850724 TTTCTGATTTAGCAGGTCTGGGG - Intronic
1030526841 7:110664546-110664568 TTTAAGATTTAAGATGTTTAAGG - Intronic
1030851962 7:114499038-114499060 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1031162285 7:118182785-118182807 TTAATGATTAACGAGGTGTTAGG - Intergenic
1031613997 7:123859428-123859450 TTAATGGTTTAGGAGGTGTTCGG - Intronic
1032023626 7:128424083-128424105 TTGATGATTTAGAAGATGCAGGG + Intergenic
1032742442 7:134752436-134752458 TTTATAATTTAGATGGTTTAGGG - Intronic
1032984056 7:137317369-137317391 ATTATGATTTTGGAGGTGGTTGG - Intronic
1033620779 7:143060501-143060523 ATTCTGATTTAGGAGGTCTCAGG + Intergenic
1036499784 8:9303166-9303188 GTTCTGATTTAGCAGGTCTAGGG + Intergenic
1042403331 8:68374591-68374613 TTAATGTTTTAGGAGCTATATGG - Intronic
1042438376 8:68794826-68794848 TTTTAGATTTAGGATGTTTATGG - Intronic
1042470268 8:69179381-69179403 TTGATAGTTTAGGGGGTGTAGGG + Intergenic
1044568684 8:93693947-93693969 TTTCTCATTTAGGAGGTCTGAGG - Intergenic
1044894056 8:96869731-96869753 TTTCTGATTTAGTAGGTCCAGGG - Intronic
1045508733 8:102796975-102796997 ATTCTGATTTAGTAGGTCTAGGG + Intergenic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1050003348 9:1101620-1101642 TTTCTGATTTAAGAGGTTTTGGG + Intergenic
1050710273 9:8453758-8453780 TTTCTGATTTAGTAGGTCTGAGG + Intronic
1052375924 9:27717426-27717448 TTTATGAATGAGGAGGTTGAAGG - Intergenic
1053385330 9:37682656-37682678 TTTCTGGTTCAGGAGGTCTAGGG - Intronic
1056091011 9:83206054-83206076 TATAAGATTTATGAGGTGGAGGG - Intergenic
1056274378 9:84979141-84979163 CTTATGATTTAAGAATTGTAAGG + Intronic
1057535647 9:95901607-95901629 TTTTTGCTTTCAGAGGTGTAGGG + Intronic
1058858626 9:109091830-109091852 TTTATGATTTCTGATGTGTATGG - Intronic
1059901827 9:118936049-118936071 TTTAAGATTTGTGAGGTGTTTGG + Intergenic
1060346069 9:122816832-122816854 TTCCTGATTCAGGAGGTCTAGGG + Intronic
1185486598 X:485912-485934 TTTATGAGCTAGAAGGTTTAGGG - Intergenic
1186232206 X:7467573-7467595 TTTAGGTGTTTGGAGGTGTAGGG - Intergenic
1186336055 X:8589871-8589893 TTTATTCTTTAGGATGTCTAAGG + Intronic
1186422409 X:9436787-9436809 CTTCTGATTTAGCAGGTGTGAGG - Intergenic
1186806963 X:13149655-13149677 TTTCTGATTCAGTAGGTCTAAGG - Intergenic
1186940185 X:14498286-14498308 TTTATTGTTAATGAGGTGTATGG - Intergenic
1186970394 X:14835545-14835567 TTTCTGATTTAGCAGGTTTCGGG + Intergenic
1187510527 X:19913581-19913603 TTTCTGATTCAGGAGGTCTGGGG + Exonic
1187657795 X:21498351-21498373 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1188331371 X:28875890-28875912 TTCCTAATTTAGGAGGTTTAGGG + Intronic
1188331493 X:28877123-28877145 TTTCTAATTTAGGAGGTTTAGGG + Intronic
1188354375 X:29173137-29173159 ATTGTGATTTAGGAGGTCCAAGG + Intronic
1188398440 X:29715317-29715339 TTTCTGATTTAGTAAGTCTAGGG + Intronic
1188778083 X:34246919-34246941 TTTATGATTCATGAGGTTCAAGG + Intergenic
1189156936 X:38767520-38767542 TTTAGCATTTAGCAGGAGTAAGG + Intergenic
1189236859 X:39493882-39493904 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1191626823 X:63278949-63278971 TTTCTGATTTTGGGGGTATAAGG - Intergenic
1193459465 X:81773464-81773486 TCTGTAAGTTAGGAGGTGTAAGG + Intergenic
1195179409 X:102342355-102342377 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1195997569 X:110746345-110746367 TTTATGATTTAGGAGGGAGGAGG + Intronic
1198071492 X:133152692-133152714 GTTCTGATTCAGGAGGTCTAGGG + Intergenic
1198254167 X:134910897-134910919 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1200864448 Y:8027734-8027756 TTAATTTTTTATGAGGTGTAAGG + Intergenic