ID: 1165211121

View in Genome Browser
Species Human (GRCh38)
Location 19:34236639-34236661
Sequence ATTCCCAGAACTGGTAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211121_1165211129 9 Left 1165211121 19:34236639-34236661 CCACTCCTACCAGTTCTGGGAAT No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211121 Original CRISPR ATTCCCAGAACTGGTAGGAG TGG (reversed) Intergenic