ID: 1165211123

View in Genome Browser
Species Human (GRCh38)
Location 19:34236644-34236666
Sequence CCGCCATTCCCAGAACTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211123_1165211129 4 Left 1165211123 19:34236644-34236666 CCTACCAGTTCTGGGAATGGCGG No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
1165211123_1165211132 27 Left 1165211123 19:34236644-34236666 CCTACCAGTTCTGGGAATGGCGG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211123 Original CRISPR CCGCCATTCCCAGAACTGGT AGG (reversed) Intergenic