ID: 1165211126

View in Genome Browser
Species Human (GRCh38)
Location 19:34236648-34236670
Sequence GTTCCCGCCATTCCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211126_1165211129 0 Left 1165211126 19:34236648-34236670 CCAGTTCTGGGAATGGCGGGAAC No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
1165211126_1165211132 23 Left 1165211126 19:34236648-34236670 CCAGTTCTGGGAATGGCGGGAAC No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211126 Original CRISPR GTTCCCGCCATTCCCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr