ID: 1165211127

View in Genome Browser
Species Human (GRCh38)
Location 19:34236670-34236692
Sequence CTGACATCTGGATTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211127_1165211132 1 Left 1165211127 19:34236670-34236692 CCCTCCTGAAATCCAGATGTCAG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211127 Original CRISPR CTGACATCTGGATTTCAGGA GGG (reversed) Intergenic