ID: 1165211128 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:34236671-34236693 |
Sequence | CCTGACATCTGGATTTCAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1165211128_1165211132 | 0 | Left | 1165211128 | 19:34236671-34236693 | CCTCCTGAAATCCAGATGTCAGG | No data | ||
Right | 1165211132 | 19:34236694-34236716 | CGAGAGCCAAACTTACAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1165211128 | Original CRISPR | CCTGACATCTGGATTTCAGG AGG (reversed) | Intergenic | ||