ID: 1165211128

View in Genome Browser
Species Human (GRCh38)
Location 19:34236671-34236693
Sequence CCTGACATCTGGATTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211128_1165211132 0 Left 1165211128 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211128 Original CRISPR CCTGACATCTGGATTTCAGG AGG (reversed) Intergenic