ID: 1165211129

View in Genome Browser
Species Human (GRCh38)
Location 19:34236671-34236693
Sequence CCTCCTGAAATCCAGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211126_1165211129 0 Left 1165211126 19:34236648-34236670 CCAGTTCTGGGAATGGCGGGAAC No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
1165211121_1165211129 9 Left 1165211121 19:34236639-34236661 CCACTCCTACCAGTTCTGGGAAT No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
1165211123_1165211129 4 Left 1165211123 19:34236644-34236666 CCTACCAGTTCTGGGAATGGCGG No data
Right 1165211129 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211129 Original CRISPR CCTCCTGAAATCCAGATGTC AGG Intergenic
No off target data available for this crispr