ID: 1165211132

View in Genome Browser
Species Human (GRCh38)
Location 19:34236694-34236716
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165211128_1165211132 0 Left 1165211128 19:34236671-34236693 CCTCCTGAAATCCAGATGTCAGG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data
1165211126_1165211132 23 Left 1165211126 19:34236648-34236670 CCAGTTCTGGGAATGGCGGGAAC No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data
1165211127_1165211132 1 Left 1165211127 19:34236670-34236692 CCCTCCTGAAATCCAGATGTCAG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data
1165211123_1165211132 27 Left 1165211123 19:34236644-34236666 CCTACCAGTTCTGGGAATGGCGG No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data
1165211130_1165211132 -3 Left 1165211130 19:34236674-34236696 CCTGAAATCCAGATGTCAGGCGA No data
Right 1165211132 19:34236694-34236716 CGAGAGCCAAACTTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165211132 Original CRISPR CGAGAGCCAAACTTACAAGC AGG Intergenic
No off target data available for this crispr