ID: 1165217924

View in Genome Browser
Species Human (GRCh38)
Location 19:34290026-34290048
Sequence CAACTTATGAGAGGTTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 4, 2: 44, 3: 212, 4: 535}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165217924_1165217930 18 Left 1165217924 19:34290026-34290048 CCTGATAAACCTCTCATAAGTTG 0: 1
1: 4
2: 44
3: 212
4: 535
Right 1165217930 19:34290067-34290089 AATGTAAGGACCGGGCGCAGTGG 0: 1
1: 0
2: 13
3: 172
4: 1396
1165217924_1165217928 9 Left 1165217924 19:34290026-34290048 CCTGATAAACCTCTCATAAGTTG 0: 1
1: 4
2: 44
3: 212
4: 535
Right 1165217928 19:34290058-34290080 TAAGTTGAAAATGTAAGGACCGG 0: 1
1: 1
2: 3
3: 27
4: 301
1165217924_1165217926 4 Left 1165217924 19:34290026-34290048 CCTGATAAACCTCTCATAAGTTG 0: 1
1: 4
2: 44
3: 212
4: 535
Right 1165217926 19:34290053-34290075 TATCCTAAGTTGAAAATGTAAGG 0: 1
1: 0
2: 3
3: 28
4: 207
1165217924_1165217929 10 Left 1165217924 19:34290026-34290048 CCTGATAAACCTCTCATAAGTTG 0: 1
1: 4
2: 44
3: 212
4: 535
Right 1165217929 19:34290059-34290081 AAGTTGAAAATGTAAGGACCGGG 0: 1
1: 0
2: 2
3: 27
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165217924 Original CRISPR CAACTTATGAGAGGTTTATC AGG (reversed) Intronic
900700555 1:4046228-4046250 CAACTTACAATGGGTTTATCTGG + Intergenic
901852979 1:12027894-12027916 CAACTTATGTTGGGTGTATCAGG - Intronic
903120249 1:21211872-21211894 CAACTTAAGATGGATTTATCAGG + Intergenic
904785331 1:32978300-32978322 CAACGTATGATGGGTTTATTGGG + Intergenic
905129160 1:35739794-35739816 CAACTTATGATGGATTGATCAGG + Intronic
905991930 1:42345276-42345298 CAACTTCTGATGAGTTTATCAGG + Intergenic
906091470 1:43183107-43183129 CACCTTATGATGGGTTTATCAGG + Intronic
906838219 1:49107379-49107401 CAACTTACAATAGGTTTATGGGG + Intronic
907093812 1:51755771-51755793 CAACTTAAGATGGGTTTATTGGG + Intronic
907104006 1:51863872-51863894 CAACTTAAGATGGGTTTTTCAGG - Intronic
907545443 1:55255765-55255787 CAACTTAGGATGGGTTTATCTGG + Intergenic
907561599 1:55395132-55395154 CAACTTATGATGGGTTTATTGGG + Intergenic
907615739 1:55924418-55924440 CAACTTATGATGGGTTTATTGGG + Intergenic
908155778 1:61351157-61351179 TAACTTATGATGAGTTTATCAGG + Intronic
908387256 1:63654254-63654276 CAAATTATGAGGGGTCTATTTGG - Intronic
908489883 1:64632858-64632880 CAACTTATGATGGATTTATCAGG - Intronic
908619500 1:65961985-65962007 CAACTTATAATGGGTTTATCAGG - Intronic
909169121 1:72271851-72271873 CAACATCTGACGGGTTTATCAGG + Intronic
909299306 1:73991226-73991248 CAACTTACAATGGGTTTATCTGG + Intergenic
909939763 1:81597687-81597709 CAGCTTAAGATGGGTTTATCCGG - Intronic
910057781 1:83052108-83052130 CAAGATATGATGGGTTTATCAGG - Intergenic
910276646 1:85456680-85456702 CAACTTAAGATACGTTTATCCGG + Intronic
910472305 1:87567907-87567929 CAACTTATGACAGGTTTATCAGG + Intergenic
911015487 1:93327546-93327568 CAACTTATGATGGGTTTATTGGG - Intergenic
911507872 1:98775898-98775920 CAACTTATGATGGGCTTATCAGG - Intergenic
911643179 1:100310773-100310795 CAACTTATGATGGGTTTATTGGG + Intergenic
911709380 1:101052552-101052574 CAATTTATGATGGGTTTATTGGG + Intergenic
911880015 1:103225163-103225185 CAACTTATGAGAGCAATATGTGG + Intergenic
912773445 1:112487388-112487410 AAATTTATGATAGGTTTATTAGG - Intronic
914857591 1:151363873-151363895 CAGCTGTTGGGAGGTTTATCAGG - Intergenic
914908334 1:151764821-151764843 CAACATACGATGGGTTTATCAGG + Intronic
914914732 1:151812511-151812533 CAACTTACGATAGGTTTATTGGG + Intronic
915777673 1:158508561-158508583 CAACTTATAACAGATTTATCTGG - Intergenic
915859780 1:159431898-159431920 CAACATATGATGGGTTTATCAGG + Intergenic
916733221 1:167584589-167584611 CAACAAAAAAGAGGTTTATCGGG + Intergenic
916821360 1:168401860-168401882 CAACTTATGACACATTTATCAGG + Intergenic
916826273 1:168444985-168445007 CAACATATGAGGTGTTTGTCAGG + Intergenic
917137036 1:171797895-171797917 CTACTTATGATGGATTTATCAGG - Intronic
917151519 1:171950545-171950567 CAACTTATGATGGATTTATTAGG + Intronic
917231727 1:172844988-172845010 CATTTTATGAGGGGTTTATGCGG + Intergenic
917782607 1:178414170-178414192 TGATTTATGATAGGTTTATCAGG - Intronic
917909899 1:179632806-179632828 CTACTTATGATGGGTTTATTGGG - Intronic
917991651 1:180386254-180386276 CAACTTATGATGGGTTTATCAGG + Intronic
918489393 1:185064620-185064642 CAATTTTTGATAGGTTTATTGGG + Intronic
918507278 1:185269933-185269955 CAATTTACGATGGGTTTATCGGG + Intronic
918600183 1:186349030-186349052 CAAATTATGATGAGTTTATCGGG - Intronic
918681629 1:187362458-187362480 CAATTTATGATGGGTTTATCTGG - Intergenic
918725916 1:187923736-187923758 CAACTTATAATGGGTTTATCTGG + Intergenic
918829285 1:189371647-189371669 AAACTTATAATAGGTATATCAGG + Intergenic
919130803 1:193448110-193448132 CAACATGTGATAGGTTTATTGGG - Intergenic
919224809 1:194683107-194683129 CAACTTCTGATGGGTTTATCAGG - Intergenic
919343245 1:196341125-196341147 CAACTTATGCTGGGTTTATCAGG - Intronic
919562352 1:199137671-199137693 CAACTTATTAGAGGTCAGTCAGG + Intergenic
919875269 1:201861580-201861602 CAACTTACGATGTGTTTATCAGG + Intronic
920833478 1:209486296-209486318 CAACTTATGATACATTTATCAGG + Intergenic
921087134 1:211805286-211805308 CAACTTACGATGGGTTTATCAGG - Intronic
921350186 1:214226723-214226745 CAACCTATGATGGGTTTATCAGG - Intergenic
922128086 1:222749014-222749036 CAACTTCTGAGAAGTCTGTCTGG + Intronic
922189176 1:223302074-223302096 CAACTTGTGAGAACTGTATCAGG - Intronic
922284172 1:224154081-224154103 CTACTTATGATGGGTTTATCAGG - Intronic
923013578 1:230108392-230108414 CAACTTATGATGGGTTTATCGGG - Intronic
923071470 1:230568798-230568820 CAACTTACCACGGGTTTATCAGG - Intergenic
923278942 1:232423272-232423294 CAACTTATGGTGGGTTTATCTGG + Intronic
923363116 1:233232445-233232467 CAACTTATGATGGATTTATAGGG + Intronic
923549504 1:234951699-234951721 CAACTTAGAATGGGTTTATCTGG - Intergenic
923620479 1:235575286-235575308 CAACTTACGATGGGTTTATGCGG - Intronic
924075588 1:240331697-240331719 CAACTTAGGATGGGTTTATCAGG - Intronic
924150204 1:241122319-241122341 CAACTTATGATGAGTTTATCAGG - Intronic
924390276 1:243547560-243547582 CAACTTAAGATGGTTTTATCTGG + Intronic
924862833 1:247943700-247943722 CAACTTATGATGGTTTTTTCAGG + Intronic
924868954 1:248019385-248019407 CAACTCATAATGGGTTTATCAGG + Intronic
1063044269 10:2376148-2376170 CAACTTAGGATGGGTTTATCTGG + Intergenic
1063787397 10:9401344-9401366 CAATTTATGATGGGTTTATCAGG + Intergenic
1063979414 10:11441613-11441635 CAACCCATGACGGGTTTATCAGG - Intergenic
1064503812 10:16007824-16007846 CAACTTAAAATGGGTTTATCAGG + Intergenic
1064530597 10:16305192-16305214 CAACTTATGATGGGTTTATAAGG + Intergenic
1065059445 10:21883534-21883556 CAATATATGATAGGTTTATCAGG - Intronic
1065117132 10:22493980-22494002 CAACTTATGATGGGTTTATTGGG + Intergenic
1065654314 10:27931898-27931920 CAACTTATGATGGGTTTATCGGG - Intronic
1065822488 10:29538787-29538809 CAACTTATGATGGATTTATTGGG + Intronic
1066039461 10:31532204-31532226 AAACTTATGATGGGTTTGTCGGG - Intergenic
1067039091 10:42939557-42939579 CAACATATGATGAGTTTATCAGG + Intergenic
1067111293 10:43402746-43402768 TAACTTATGATGGATTTATCGGG + Intronic
1068354547 10:55894619-55894641 CAAGATCTGATAGGTTTATCAGG + Intergenic
1069519768 10:69109575-69109597 CAATTTATGATGGGTTTATTGGG + Intergenic
1070077282 10:73149706-73149728 CAATTTTTGACAGGTTTATCAGG + Intronic
1070450332 10:76551627-76551649 CAACTTACAATAGGTTTATTGGG + Intronic
1070945414 10:80387245-80387267 CAACTGATGATGGGTTTATTGGG - Intergenic
1070950387 10:80426496-80426518 CAACTTATGATGGGTTTGTAGGG + Intronic
1071322332 10:84475565-84475587 CAACCTATAATGGGTTTATCAGG - Intronic
1071458706 10:85871104-85871126 CAACGTATGATGGGTTTGTCAGG - Intronic
1071827319 10:89338105-89338127 CAATTTATGATGGGTTTATCAGG + Intronic
1071859552 10:89658227-89658249 CAACTTATGATGGGTTTATTGGG + Intergenic
1071878493 10:89868608-89868630 CAACTTATGATAGGTTTATCAGG + Intergenic
1072839014 10:98749839-98749861 CAACTTATGATGAGTTTATTGGG + Intronic
1073813336 10:107175941-107175963 AAACTTACTAGAAGTTTATCAGG + Intergenic
1074131048 10:110576063-110576085 CAGTTTATGATAGGTTTATTAGG - Intronic
1075984506 10:126772598-126772620 TGACTTATTATAGGTTTATCTGG - Intergenic
1076427261 10:130376306-130376328 CAACATCTGATGGGTTTATCAGG - Intergenic
1076476229 10:130754140-130754162 CAACTTACAATTGGTTTATCGGG + Intergenic
1078804258 11:14680981-14681003 CAACTTACGATGGGTTTATCTGG - Intronic
1079373958 11:19875223-19875245 CAACTTATGGTGGGTTTATCAGG - Intronic
1080073145 11:28113992-28114014 CAACTAATGAAGGGTTTGTCAGG + Intronic
1080201267 11:29673366-29673388 CAATTTATGATGGGTTTATTGGG + Intergenic
1080251413 11:30237918-30237940 TCACTTATGAGAGGTTTTTATGG - Intergenic
1080809718 11:35691445-35691467 CAACTTATAATGGGTTTATTGGG - Intronic
1081477931 11:43453769-43453791 CAACTTAACAATGGTTTATCAGG - Intronic
1081520522 11:43877056-43877078 CAACTTACAATGGGTTTATCAGG + Intergenic
1081689492 11:45067840-45067862 CAACTTACGATGGATTTATCAGG + Intergenic
1081746505 11:45476629-45476651 CAACTTAGGGAGGGTTTATCGGG + Intergenic
1081788078 11:45762253-45762275 CCACTTATGATGGGTTTATTGGG - Intergenic
1082896935 11:58201751-58201773 GAACTGTTGAGAGGTTTATTTGG + Intergenic
1083696028 11:64443103-64443125 CAACTTGTTAGAGGGTTTTCTGG + Intergenic
1085147951 11:74220161-74220183 CAGGTTCTTAGAGGTTTATCAGG - Intronic
1085369348 11:75984502-75984524 CAACTTACAATGGGTTTATCAGG + Intronic
1085509818 11:77082570-77082592 CTACTTATGTGAGGTTCTTCTGG - Intronic
1085945364 11:81264427-81264449 CAAATTATGATGGGTTTATTGGG + Intergenic
1086078153 11:82876607-82876629 CAAGATCTGATAGGTTTATCAGG + Intronic
1086803806 11:91213435-91213457 CAATTTATGATAGGTTCTTCAGG + Intergenic
1086954420 11:92920985-92921007 CAACTTACAATAGGTTTATTGGG - Intergenic
1087115634 11:94521535-94521557 CAACTTATGATAGGTTTTTCAGG + Intergenic
1087248471 11:95869294-95869316 CAACTTACAATGGGTTTATCTGG + Intronic
1087479200 11:98678780-98678802 AGACTTATGAGAGGTTCATAAGG - Intergenic
1087844677 11:102959766-102959788 CAATTTATGATGGGTTTATTTGG - Intergenic
1088066169 11:105722226-105722248 CACTTTATGATGGGTTTATCAGG + Intronic
1088275837 11:108084298-108084320 TAACCTCTGAAAGGTTTATCTGG - Intronic
1088350496 11:108881768-108881790 CAATTTGTGATAGGTTTATCAGG + Intronic
1088910777 11:114190294-114190316 CTACTTATGATGGGTTTATCAGG - Intronic
1088961309 11:114668338-114668360 GAACTTAGGAGTGGCTTATCTGG - Intergenic
1089229530 11:116959797-116959819 CAACTTATAATGGGTTTATTGGG + Intronic
1089231377 11:116980120-116980142 CAACTTATGATGGGTTTATAAGG - Intronic
1089832489 11:121340980-121341002 CAAATTATGAAGGGTTTTTCGGG - Intergenic
1089878834 11:121753784-121753806 CAACTTGTGATGAGTTTATCAGG + Intergenic
1090065812 11:123502473-123502495 CAATTTATGATGGGTTTACCAGG - Intergenic
1091261680 11:134239482-134239504 TAACTTAAGAAAGGTTTATTGGG + Intronic
1091520399 12:1234393-1234415 CAACTTATGGTGGGTTTATTGGG + Intronic
1091794593 12:3290738-3290760 CAACTTATGATGAGTTTATTGGG + Intergenic
1092949683 12:13489950-13489972 CAACTTATGATGGGTTTATCAGG + Intergenic
1093133228 12:15417214-15417236 TGACTTATGATGGGTTTATCAGG - Intronic
1093402154 12:18759589-18759611 CAACTTATGATGGGCTTATTAGG - Intergenic
1094100570 12:26757660-26757682 CAATTTGTGATAGGTTTATCAGG + Intronic
1094204147 12:27822890-27822912 CAACTTATGATGGGCTTATTGGG - Intergenic
1094739028 12:33267622-33267644 CAGGTTATGAGATGTTTTTCAGG - Intergenic
1095504778 12:42883682-42883704 CAATTTATGATGGGTTTATTGGG - Intergenic
1095758890 12:45804535-45804557 CAACTTTTATGAAGTTTATCAGG + Intronic
1095790001 12:46156125-46156147 CAACTTACAATAGGTTTATTGGG + Intergenic
1095994187 12:48065295-48065317 TGACTTATGACAGGTTTATTGGG - Intronic
1096343576 12:50824931-50824953 CAACTTACCATGGGTTTATCAGG - Intergenic
1096622238 12:52872136-52872158 CAGATTCTGGGAGGTTTATCAGG - Intergenic
1096825757 12:54276235-54276257 CAACCTATGATGGGTTTATCAGG - Intronic
1096877576 12:54642674-54642696 CAACTTATGATGGGTTTATCAGG + Intergenic
1097357651 12:58620308-58620330 CAAGTTCTGAGGGGTTTATCAGG + Intronic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1098163094 12:67666327-67666349 CAACTTCGGATGGGTTTATCAGG + Intergenic
1098729000 12:74008931-74008953 CAATTTATCACAAGTTTATCTGG - Intergenic
1098771190 12:74555391-74555413 CAACTTATGATGGGTTTATTGGG - Intergenic
1098845428 12:75529632-75529654 TAACTTATGATGGGTTTATCAGG + Intergenic
1098855823 12:75652327-75652349 CAATTTATGAGAGGATGATGTGG + Intergenic
1100078617 12:90821359-90821381 CAAATTACGATAGGTTTATTGGG - Intergenic
1100324383 12:93527388-93527410 CAATTTATGGTAGGTATATCAGG - Intergenic
1100416082 12:94377149-94377171 CAATTTGTGATGGGTTTATCAGG - Intronic
1101973423 12:109333810-109333832 CAGGTTATGATGGGTTTATCAGG + Intergenic
1102366433 12:112340090-112340112 CAATTTATGATGGGTTTTTCAGG + Intronic
1102384347 12:112495027-112495049 CAACTTATGATGAGTTTATTGGG + Intronic
1102384391 12:112495635-112495657 CAATTTATGATGGGCTTATCAGG - Intronic
1102892462 12:116570829-116570851 CAACGTATGATAGGTTTACCAGG + Intergenic
1103056160 12:117822453-117822475 CAACTTATGATTTGTTTTTCTGG - Intronic
1103150016 12:118629433-118629455 CAACTTACGATGAGTTTATCCGG - Intergenic
1103756742 12:123213661-123213683 CAATTTATGGTGGGTTTATCAGG + Intronic
1103843529 12:123885068-123885090 CAACTTACAATGGGTTTATCTGG + Intronic
1104461011 12:128955929-128955951 CAACTTGTGATGGGTTTATTGGG - Intronic
1104701856 12:130910915-130910937 TTACTTATGATGGGTTTATCAGG - Intergenic
1105044688 12:132992586-132992608 CAATTTATGATGAGTTTATCAGG - Intronic
1105393613 13:20006902-20006924 CAACTTAGAATGGGTTTATCAGG + Intronic
1106453605 13:29907543-29907565 CAATTTATGATGGGTTTATTAGG + Intergenic
1106996917 13:35495519-35495541 CAATTTATGATGGGTTTGTCAGG - Intronic
1108060216 13:46525661-46525683 CAACTTACAATGGGTTTATCAGG + Intergenic
1108121982 13:47198108-47198130 CAACTTAAGATGGGTTTATCAGG + Intergenic
1108267735 13:48729382-48729404 CAACTTACAATAGGTTTATTGGG - Intergenic
1108323149 13:49305821-49305843 CTACTCATGAGAGGTTTGTGTGG - Intergenic
1109234108 13:59794216-59794238 CAAATTATGATGGGTTTATCTGG + Intronic
1109274978 13:60293802-60293824 CAACTTATGATGGGTTTAGTGGG + Intergenic
1109296119 13:60532931-60532953 CAACTTATGATGGGTTTATTGGG - Intronic
1109383351 13:61595335-61595357 CAACTTACGATGGGTTGATCAGG + Intergenic
1109494996 13:63158056-63158078 CATCTTATGAGAACGTTATCAGG - Intergenic
1109519030 13:63484886-63484908 CAACTCATGAGAGGTAGTTCAGG - Intergenic
1110800678 13:79690693-79690715 CATCTATTGAGAGGTTTATGTGG + Intergenic
1110967452 13:81717782-81717804 CAACTTCTGCTAGGTTTATCTGG - Intergenic
1111304738 13:86393783-86393805 CAACTTGTGATGAGTTTATCTGG + Intergenic
1111558593 13:89913519-89913541 AAACTTATGCCAGTTTTATCTGG + Intergenic
1111666334 13:91273361-91273383 CAACTTATGATAGATTTATCAGG - Intergenic
1113141629 13:107158577-107158599 CAACTTATTATGGGTTTATCAGG + Intergenic
1113236990 13:108288365-108288387 CAGCTTAGGATGGGTTTATCAGG - Intronic
1113404092 13:110022158-110022180 CAGCTTATGATGGGTTTATCAGG + Intergenic
1113465396 13:110508983-110509005 CAATTTATGATGGGTTTATCTGG + Intronic
1113699070 13:112369964-112369986 CAACTTATGATGGGTTTTTCAGG + Intergenic
1114882402 14:26802748-26802770 CAATTTATGATGGGTTTCTCAGG + Intergenic
1115058539 14:29162103-29162125 CTGTTTATGATAGGTTTATCAGG - Intergenic
1115126068 14:29995417-29995439 CAACTTACCATAGGTTTGTCAGG - Intronic
1115573779 14:34691587-34691609 CAATTTATGATGGATTTATCTGG + Intergenic
1116921101 14:50576299-50576321 CAACGTATGATGGTTTTATCAGG + Intronic
1117371513 14:55082707-55082729 CAATTTATGATGGGTTTATTGGG - Intergenic
1117513883 14:56481074-56481096 CAAATTATGATGGGTTTATCAGG - Intergenic
1118034816 14:61855338-61855360 CAACTTACGATGGGTTGATCAGG - Intergenic
1118046307 14:61975120-61975142 CAATTTATGATGGGTTTATCTGG - Intergenic
1118500058 14:66353322-66353344 CAACTTATGATGGATTTATTGGG + Intergenic
1118618669 14:67594717-67594739 CATCTTATAATGGGTTTATCAGG - Intronic
1118914288 14:70088921-70088943 CAATATATGAGAGTTTTAGCAGG - Intronic
1119193248 14:72698774-72698796 CAACTTATGATGGGTTTGCCAGG + Intronic
1120293903 14:82614207-82614229 CAACTTACAATAGGTTTTTCAGG + Intergenic
1120783097 14:88503751-88503773 CAACTTACTATGGGTTTATCAGG + Intronic
1121278485 14:92683921-92683943 CAATTTATGATGGGTTTATTAGG - Intronic
1121344439 14:93125053-93125075 CAACATTTGATGGGTTTATCAGG - Intergenic
1123844710 15:24287184-24287206 CAACTTCTGAGATGATTATGTGG + Intergenic
1123888750 15:24753859-24753881 CAACTTACGATGGGTTTATCAGG + Intergenic
1123899334 15:24860524-24860546 TAACTTGTGATGGGTTTATCTGG - Intronic
1123901570 15:24882507-24882529 CAATTTATGATGGGTTTATTGGG - Intronic
1125117444 15:36111739-36111761 CAACTTAGGATGGGTTTATTAGG + Intergenic
1125250776 15:37700494-37700516 CAACATAAGGTAGGTTTATCAGG - Intergenic
1125439642 15:39688249-39688271 CAACTTACAATGGGTTTATCAGG - Intronic
1126365669 15:47891809-47891831 CAACTTCTGATGGGTTTATTGGG - Intergenic
1127095345 15:55507254-55507276 CAACTTATGATGGGTTTATCAGG - Intronic
1127183510 15:56451739-56451761 CAATTTACGACAGGTTTATTGGG - Intronic
1127367892 15:58308836-58308858 CAACTTACAATGGGTTTATCAGG + Intronic
1127722606 15:61717793-61717815 CAACTTACAATGGGTTTATCAGG + Intergenic
1127764368 15:62170520-62170542 CAACTTAGGATGGGTTTATTGGG + Intergenic
1127787553 15:62369391-62369413 CAACTTTTGATGGGTTTATGGGG - Intergenic
1128734199 15:70043313-70043335 CAACTTACGATGGGTTTATTGGG - Intergenic
1128970845 15:72104340-72104362 CAACTTACAATGGGTTTATCAGG + Intronic
1129061048 15:72860547-72860569 CAACCTTAGATAGGTTTATCAGG - Intergenic
1129304774 15:74651808-74651830 CAATTTATGATGGGTTTATTGGG - Intronic
1130338969 15:82982993-82983015 CAACTTGTGATGGGTTTATCTGG - Intronic
1130359894 15:83173453-83173475 CAACTTAAGATGGGTTTATCCGG + Intronic
1130783022 15:87065112-87065134 AAAATTATGGGATGTTTATCAGG - Intergenic
1130870069 15:87963718-87963740 CAACTTATCATGGGTTTATCAGG + Intronic
1130941185 15:88510677-88510699 CAACTTACAATGGGTTTATCTGG + Intergenic
1132289829 15:100692039-100692061 CAACTTATGAAGGGTGTATTGGG + Intergenic
1132496115 16:264266-264288 CAACTTATGTGAGGTTGCCCAGG - Intronic
1132507899 16:321549-321571 CCAGCTATGAGAGGTTTATCAGG - Intronic
1133687202 16:8177430-8177452 CAACTTATGATGGGTTTATTGGG + Intergenic
1133927937 16:10208838-10208860 CAATTTATGATGGGTTCATCAGG + Intergenic
1134841105 16:17402539-17402561 AAACCTATGAGGGGTTTATTTGG + Intronic
1135255024 16:20934344-20934366 CAACTTATGATGGGTTTATCAGG - Intronic
1135392911 16:22108839-22108861 CCACTTATGATGGGTTTATCAGG + Intronic
1135534474 16:23282532-23282554 CAACTCATGATGGGTTTATCAGG - Intronic
1136006771 16:27336087-27336109 CAACTTATGATGAGTTTATGGGG - Intronic
1136042085 16:27587547-27587569 CAACTTAGGATGGGTTTATTGGG - Intronic
1137299711 16:47137106-47137128 CAACTTTTTGGAGGTTAATCTGG + Intronic
1137909813 16:52365726-52365748 CAACTTATAATGGGTTTATCAGG - Intergenic
1137987895 16:53125854-53125876 CAACTTAAAATGGGTTTATCAGG + Intronic
1138395733 16:56703196-56703218 CAACTTATGATGGGCTTATCAGG - Intronic
1139083647 16:63558396-63558418 CAACTTATGATAAATTTATCAGG - Intergenic
1139830770 16:69796291-69796313 CAACTTATGATGGGTTTTTCAGG - Intronic
1140432986 16:74920720-74920742 CAACTTACAATGGGTTTATCGGG + Intronic
1140598668 16:76447842-76447864 TAACTTAAGATGGGTTTATCAGG + Intronic
1140900553 16:79363297-79363319 CAACTTAGGTTGGGTTTATCAGG - Intergenic
1141377404 16:83544387-83544409 CAACTTACGATGGGTTTATCGGG - Intronic
1142840465 17:2624562-2624584 CAAGATCTGACAGGTTTATCAGG - Intronic
1143195287 17:5071662-5071684 CACCTTACGATAGGTTGATCAGG - Intergenic
1143438866 17:6952359-6952381 CAACTTACAATGGGTTTATCAGG + Intronic
1143557792 17:7673215-7673237 CAACTTACGACGAGTTTATCAGG + Intronic
1144000828 17:11053305-11053327 CAACTTATGATAGGTTTATTGGG + Intergenic
1144374639 17:14627158-14627180 CAAATTATCAGAGGATTCTCTGG - Intergenic
1145106826 17:20124649-20124671 CAGCTTATGATGAGTTTATCTGG - Intronic
1146292859 17:31623561-31623583 CAACTTATGATGGGTGTATCAGG - Intergenic
1146358580 17:32155867-32155889 CAACTTATGATGGGTTTATGGGG + Intronic
1146435361 17:32841146-32841168 CAACTTATGATGGGTTTATCAGG + Intronic
1146662047 17:34671234-34671256 CCACAGATGAGAGGTTTAACTGG - Intergenic
1146990726 17:37269340-37269362 CAACTTATGTTGGGTTTATTGGG - Intronic
1147284162 17:39387907-39387929 CAATTTATCATAGGTTTATCAGG + Intronic
1147335049 17:39722655-39722677 CAACTTAGAATTGGTTTATCAGG + Intronic
1147396386 17:40146331-40146353 GAACTTATGATGGGTTTACCAGG - Intronic
1147739383 17:42661971-42661993 CAACTTACAATGGGTTTATCAGG + Intronic
1147936839 17:44016598-44016620 CAACCTATGATGGGTTTATCAGG - Intronic
1148119602 17:45200495-45200517 CACCTTATTTGAGGTTTGTCTGG + Intergenic
1148254905 17:46121796-46121818 CAAATTATGATGGGTTTATTGGG - Intronic
1149663473 17:58349486-58349508 CAACTTATGATGGGCTTATTAGG + Intronic
1149813715 17:59703343-59703365 CAATTTATGATGGGTTTATCAGG + Intronic
1149882087 17:60302531-60302553 CAACTTACAATGGGTTTATCGGG + Intronic
1149890712 17:60387686-60387708 CAACTTATGATGGGTTTATTGGG - Intronic
1150096926 17:62385048-62385070 CAACTTATGATGGGTTTATAAGG + Intronic
1150634164 17:66901260-66901282 CAACTTACAACAGGTTTATTGGG + Intergenic
1151041882 17:70872330-70872352 CAACTTAAGAGAATTTTAACAGG + Intergenic
1151487909 17:74413331-74413353 CAACTTATGATGGCTTTATTGGG + Intergenic
1152255195 17:79235063-79235085 CACCTTATGATGGGTTTATCAGG + Intronic
1152463561 17:80453827-80453849 CAATTTACGGTAGGTTTATCCGG - Intergenic
1153213100 18:2789719-2789741 CAAGTTATGATGGGTTTATTGGG + Intronic
1153270302 18:3314220-3314242 CAACTTATGATGGGTTTATCAGG - Intergenic
1154938752 18:21089571-21089593 CAACTTACAAGTGGTTTATCAGG - Intronic
1155510441 18:26570773-26570795 CAACTTACAATGGGTTTATCAGG - Intronic
1156807338 18:41201356-41201378 CAACTTATGTTGGGTTTATAAGG - Intergenic
1157084710 18:44567851-44567873 CAACTTATGATGGGTTTATTGGG + Intergenic
1157525689 18:48379022-48379044 TAACTTATGAGGGGTTTATTAGG + Intronic
1158021837 18:52851897-52851919 CAACTTATAAGATGATTATCTGG - Intronic
1158892771 18:61888662-61888684 TAACTTATGAGGGGTTTATGAGG + Intronic
1158915758 18:62127206-62127228 CAACTTATGGTGGGTTTATTGGG - Intronic
1159230352 18:65599772-65599794 TAACTTATGATTGGTGTATCAGG + Intergenic
1159314612 18:66755771-66755793 CAACTTATGGTATGTTTATTAGG + Intergenic
1159762385 18:72444378-72444400 CAACATTTGAGATGTTTAGCTGG + Intergenic
1160071169 18:75629204-75629226 CAACTTATGGTGGGTTTATCAGG + Intergenic
1160183428 18:76655702-76655724 CAACTCATGAGAGGATCATGGGG - Intergenic
1160482944 18:79259783-79259805 AAACTTTTAAGAGCTTTATCAGG + Intronic
1161259660 19:3330493-3330515 TAACTTATGAAGAGTTTATCAGG - Intergenic
1161654482 19:5505665-5505687 CAACTTTTGATGGGTTTATTGGG + Intergenic
1162240197 19:9346004-9346026 CAACTTACAATAGGTTTGTCAGG + Intronic
1163013196 19:14438279-14438301 CAACTTATGATGAGCTTATCAGG + Intronic
1163088390 19:15000207-15000229 CAACTTATGATGGGTTTATCAGG + Intronic
1163292709 19:16390914-16390936 CAACTTACAATGGGTTTATCAGG - Intronic
1164946818 19:32302313-32302335 CAACTTTTGATGGTTTTATCAGG + Intergenic
1165018164 19:32899489-32899511 CAATTTATGATGGGTTTATCAGG - Intronic
1165217924 19:34290026-34290048 CAACTTATGAGAGGTTTATCAGG - Intronic
1165602635 19:37069447-37069469 CAACTTGTGATGGGTTTATTAGG - Intronic
1165641113 19:37387754-37387776 CAACTTCTAAGATTTTTATCAGG - Intronic
1166021051 19:40029960-40029982 CAATTTATGATGGGTTTATTTGG - Exonic
1166466339 19:43035055-43035077 GAACGTATGAGAGGGTCATCAGG + Intronic
1166847526 19:45738294-45738316 CAGTTTATGATGGGTTTATCAGG - Intronic
1167745514 19:51349254-51349276 CAATTTATGATGGATTTATCAGG + Intronic
1167790119 19:51670872-51670894 CAATTTATGACAGATTTATCAGG - Intergenic
1168398698 19:56070268-56070290 CAACTTATAGTGGGTTTATCAGG + Intergenic
1168578832 19:57536222-57536244 CAACTTACAATGGGTTTATCAGG - Intronic
925691395 2:6527045-6527067 CAATTTATGATGGGGTTATCTGG + Intergenic
926586099 2:14687338-14687360 CCACTTATGTATGGTTTATCAGG + Intergenic
927521599 2:23702202-23702224 CAACTTATAATGAGTTTATCAGG - Intronic
928236813 2:29549335-29549357 CAACTAATGAGAGGTGGCTCAGG - Intronic
928259330 2:29752663-29752685 CAACTTACGATGGGTTCATCAGG + Intronic
928578574 2:32681792-32681814 CAACTCATGATGGATTTATCAGG + Intronic
929663827 2:43817576-43817598 CAACTTATGATGGGTTTATCTGG - Intronic
929983968 2:46707794-46707816 CAACTTAGGATGGGTTTATCAGG - Intronic
930191995 2:48469076-48469098 CAAGATCTGACAGGTTTATCAGG - Intronic
930229098 2:48825860-48825882 CAAATTATGATGGGTTCATCTGG - Intergenic
930360921 2:50378327-50378349 CAACTTACGATGAGTTTATCAGG - Intronic
930558141 2:52925444-52925466 CAACTTATGATGGGTTTATCAGG + Intergenic
930865045 2:56114358-56114380 CATCTACTCAGAGGTTTATCAGG + Intergenic
931080131 2:58759800-58759822 CAACTTATGATGGGTTTATTGGG + Intergenic
931377505 2:61720639-61720661 CAACATATGATGGGTTCATCAGG - Intergenic
931954847 2:67411366-67411388 CAACTCATGATGGGTTTATTGGG - Intergenic
932035314 2:68240092-68240114 CAACTTACAATGGGTTTATCGGG + Intronic
932123201 2:69120012-69120034 CAACTTACGATGGATTTATCAGG - Intronic
932263650 2:70347616-70347638 CAACTTATGGTGGGTTTATCAGG + Intergenic
932584381 2:73016813-73016835 CAATTTATGATGGGTTTATCAGG - Intronic
932844148 2:75117627-75117649 CAATTTATGATGGGTTTATCTGG - Intronic
933431149 2:82181344-82181366 CAACTTATGATGAGTTTATCTGG + Intergenic
933494235 2:83028382-83028404 AGAATTATAAGAGGTTTATCTGG + Intergenic
933526879 2:83452718-83452740 CAACTTATGATGAGTTTATCAGG - Intergenic
934048234 2:88189394-88189416 CAACTTACGAAGGGTTTATTGGG + Intergenic
934755502 2:96821646-96821668 CAACTTACAATGGGTTTATCAGG - Intronic
934983097 2:98863751-98863773 CAATTTATGATGGGTATATCAGG + Intronic
935685908 2:105682348-105682370 CAATTTATGATGGGTTCATCAGG - Intergenic
936054600 2:109252600-109252622 CAACTATTGATGGGTTTATCAGG - Intronic
936707803 2:115096607-115096629 CAAATTATGAGGGGTTTATTGGG - Intronic
937486129 2:122316613-122316635 CAAATTATGAAATGTTCATCTGG + Intergenic
937699843 2:124851864-124851886 CTACTTTTGAATGGTTTATCTGG - Intronic
937860285 2:126702782-126702804 CACCTTATGAGAGATCTTTCAGG + Intergenic
938085017 2:128393926-128393948 CAACTTATGATGGGCTTACCAGG - Intergenic
938232471 2:129673271-129673293 CAACTTACGACAGGTTTATTAGG + Intergenic
938420615 2:131143213-131143235 CAACTTATGATGGGTTTATTGGG + Intronic
938944147 2:136195763-136195785 TCACTTATGATGGGTTTATCAGG - Intergenic
938978525 2:136503527-136503549 TGACTTATGATGGGTTTATCAGG - Intergenic
939084719 2:137705973-137705995 CAATTTATGAGAGATTTATCAGG + Intergenic
939387085 2:141514630-141514652 CAACTTATGATGGTTTTATTGGG - Intronic
939435644 2:142173907-142173929 TGACTTATGATAGGTTTATTGGG - Intergenic
939446328 2:142314251-142314273 CAACTTATGATGGGTTTATCAGG + Intergenic
939504657 2:143030766-143030788 CAGCTTATGATGGGCTTATCAGG - Intronic
939670304 2:145002643-145002665 CAACTTAGGATGGGTTTATTGGG - Intergenic
939904007 2:147887934-147887956 CACCATATGAGAGGTTTTTCTGG + Intronic
940324241 2:152408592-152408614 CAACTTACAATGGGTTTATCAGG - Intronic
941228279 2:162876465-162876487 CCACTGATTAGAGGTTTATATGG - Intergenic
941326380 2:164120606-164120628 CAACTTATGATGGGTTTATCAGG - Intergenic
943056131 2:182982729-182982751 CAACTTACAATAGGTCTATCAGG + Intronic
943141355 2:183986504-183986526 CAATTAATGAGGGTTTTATCGGG - Intergenic
943583196 2:189708688-189708710 CAACTTACAATGGGTTTATCAGG + Intronic
943713414 2:191123538-191123560 CAACTGATGATGGGTTTATTGGG - Intronic
943725623 2:191248352-191248374 CAACTTATGATGGGTTTATCAGG - Intronic
944225889 2:197348384-197348406 GAAATTATTAGAGGTTTACCTGG + Intergenic
944280879 2:197895139-197895161 TAACTTATGACAATTTTATCTGG - Intronic
944942702 2:204646800-204646822 CAACTTACCATTGGTTTATCAGG - Intronic
945487945 2:210420891-210420913 CAACTTATGATGGGTTTATTGGG + Intergenic
945570027 2:211455554-211455576 CAAATTATGAGAGATTTATGTGG - Intronic
945665930 2:212742215-212742237 CAACTTATAACGTGTTTATCAGG - Intergenic
946344431 2:219097213-219097235 AAACTTACGATGGGTTTATCAGG + Intronic
946666660 2:222057508-222057530 CAAATTGAGAAAGGTTTATCTGG + Intergenic
948018657 2:234712004-234712026 CAGCTTACGATGGGTTTATCAGG - Intergenic
948034299 2:234845624-234845646 CAACTTACGACGGGTTTATTGGG - Intergenic
948988067 2:241537926-241537948 CAACTTATGATGTGTTTATTGGG + Intergenic
1169299009 20:4425900-4425922 CAACTTCTGATGGGTTTGTCCGG - Intergenic
1169322642 20:4646143-4646165 CAACTTCTGATGGATTTATCAGG - Intergenic
1169470454 20:5880875-5880897 CAATTTATGATGGATTTATCGGG + Intergenic
1169530247 20:6477333-6477355 CAATTTATGATGAGTTTATCAGG - Intergenic
1169859540 20:10136798-10136820 CAACTTATGAAGGGTTTCTCGGG + Intergenic
1170025587 20:11885932-11885954 CAACTTACGATGGGTTTATTGGG - Intergenic
1170037967 20:12010114-12010136 CAATTTATGATGGCTTTATCAGG + Intergenic
1170333784 20:15245821-15245843 CAACTTACCATGGGTTTATCGGG + Intronic
1170638449 20:18129789-18129811 CAACTTATGATGGATTTATCTGG + Intergenic
1171328332 20:24315761-24315783 CAATTTATGATGGGTTTATTGGG - Intergenic
1171849577 20:30298640-30298662 CAACTTACTACAGCTTTATCGGG - Intergenic
1172120333 20:32594706-32594728 CAACTTACAATGGGTTTATCAGG - Intronic
1172833762 20:37859042-37859064 CAATTTATGGTGGGTTTATCAGG - Intronic
1173756010 20:45516851-45516873 CAACTTAGGCTAGGTTTATTAGG + Intergenic
1174076100 20:47938146-47938168 CTACTTATGATGGGTTTATCAGG - Intergenic
1175008346 20:55709805-55709827 CAAGATCTGAGGGGTTTATCAGG + Intergenic
1175442922 20:59003524-59003546 CAACTTACGAGGGGGTTGTCGGG + Intronic
1175535887 20:59711521-59711543 CAACTTAAGATGAGTTTATCAGG - Intronic
1176228032 20:64014321-64014343 CAACTTACAATGGGTTTATCAGG - Intronic
1176524608 21:7856669-7856691 CAACTTATGAGAAGTTAACCAGG - Intergenic
1176975047 21:15311330-15311352 CAACTTACAATGGGTTTATCAGG + Intergenic
1177698554 21:24606485-24606507 CAACTGAGCAGAGGTTTTTCTGG - Intergenic
1178658628 21:34486682-34486704 CAACTTATGAGAAGTTAACCAGG - Intergenic
1178869748 21:36363108-36363130 CAACTTATAATGGGCTTATCAGG - Intronic
1178870591 21:36371352-36371374 CAACCTATGATGGGTTTTTCAGG - Intronic
1180671832 22:17559648-17559670 CAACTCATGATGGGTTTATCCGG + Intergenic
1181318169 22:21984611-21984633 CAACTTAAGATGGGTTTATGTGG - Intergenic
1181460718 22:23084455-23084477 CAACTTAGGATGGGTTTATCAGG + Intronic
1181752404 22:24998072-24998094 TGACTTATGATGGGTTTATCAGG - Intronic
1182286741 22:29253109-29253131 CAACTTACGATGGGTTTATTTGG - Intronic
1182893693 22:33841163-33841185 CAACTTACGATGGGTTTAGCAGG + Intronic
1183137971 22:35908300-35908322 CAACTTATGATGAGTTTATAGGG - Intronic
1183993318 22:41613843-41613865 CAACTTTTGAGTTGTTTTTCAGG - Intronic
949303484 3:2612180-2612202 TAACTTATGATGGGTTTATCGGG - Intronic
949418139 3:3835157-3835179 CAACTTAAGATGGGTGTATCAGG - Intronic
949469343 3:4378085-4378107 CAACTTATGATGGATTTATCAGG - Intronic
949739055 3:7208971-7208993 CAACTTATGATGGTTTTATCAGG - Intronic
949877704 3:8637212-8637234 CAACTTATGATGGGTGTATTGGG + Intronic
949914919 3:8952913-8952935 CAATTTATGATGGGTTTATCGGG - Intronic
949934414 3:9105794-9105816 CAACTTGTGAGGGGTTTATTGGG - Intronic
950039061 3:9908086-9908108 CAACCTTTGAGAGACTTATCAGG + Intronic
950101866 3:10362172-10362194 CTCCTTGTGAGAGGTTCATCTGG - Intronic
950233869 3:11300953-11300975 CAATTTATGATGAGTTTATCAGG + Intronic
951083687 3:18484190-18484212 TAACTTATGATGGGTTTATCAGG + Intergenic
951118955 3:18900640-18900662 CAACGTATGATGGGTTTATTGGG + Intergenic
951431159 3:22608609-22608631 CAACTTATGGTAAGTTCATCAGG + Intergenic
951445978 3:22781273-22781295 CAATTTATGATAGGTCTATTGGG - Intergenic
952317240 3:32241664-32241686 CCACTTAGGATGGGTTTATCAGG + Intronic
952768241 3:36974100-36974122 CAACTTATGATGGGTTTATTAGG - Intergenic
953029484 3:39169006-39169028 CAATTTATGATGGGTTTATCAGG - Intergenic
953121054 3:40042781-40042803 CAACTTATGATGGGTTTACTAGG - Intronic
954091094 3:48284858-48284880 CAATTTAAGATGGGTTTATCCGG + Intronic
954551502 3:51485455-51485477 CCACATATGAGAGGCTTATAAGG + Intronic
954902080 3:54028378-54028400 CAACTTATGATGGGCTTATCCGG - Intergenic
955146394 3:56324376-56324398 CAACTTACGATGGGTTTATCAGG - Intronic
956151711 3:66250646-66250668 CAACTTATGATGGGTTTATTGGG + Intronic
956169930 3:66425014-66425036 CAACTTAGGATGGGTTTATCTGG + Intronic
956592373 3:70928236-70928258 CAACTTGTGATGGGTTTAACAGG + Intergenic
958267342 3:91454115-91454137 CAACTTATGATGGGTTTATCAGG - Intergenic
958507868 3:95004336-95004358 CAACTCATGATGAGTTTATCCGG + Intergenic
959457109 3:106576374-106576396 TAACTTATGATAAGTTTATCAGG + Intergenic
959654971 3:108793398-108793420 CAACTTATGATGGGTTTATCAGG + Intergenic
959738094 3:109684434-109684456 CAACTTACAACAGGTTTATCAGG - Intergenic
959740753 3:109716463-109716485 CAACTTATGACAGGGTGGTCAGG - Intergenic
960060512 3:113315938-113315960 CAATTTAAGATAGGTTTATCAGG + Intronic
960675245 3:120187228-120187250 CAACTTATGATGGGTTTATCCGG - Intronic
960878384 3:122319378-122319400 TGACTTATGATGGGTTTATCAGG + Intergenic
961616217 3:128183263-128183285 TAACTCATTAGAGGTTTATCAGG - Intronic
962139944 3:132779421-132779443 CAACTTATGAAGGATTTATCAGG + Intergenic
963926096 3:150952504-150952526 CAACTTATGACGGGTTTATCGGG + Intronic
964057404 3:152478002-152478024 CACTTTATGAGAGTTTTATCTGG + Intergenic
964169687 3:153754956-153754978 CAACATATAATGGGTTTATCAGG - Intergenic
964194932 3:154052660-154052682 TAATTTATGATAGGTTTATTGGG - Intergenic
964420931 3:156501934-156501956 CAAGATATGGTAGGTTTATCAGG - Intronic
964468381 3:157023891-157023913 CAATTTATGATGGGTTTATCAGG - Intronic
964562895 3:158018116-158018138 CAACTTATGATGGGTTTATTTGG - Intergenic
964789090 3:160434491-160434513 AACTTTATGATAGGTTTATCCGG + Exonic
964789094 3:160434543-160434565 CAACTTATGATAGGTTTACCAGG + Exonic
964831977 3:160894094-160894116 CAATGTATGATGGGTTTATCAGG + Intronic
965045625 3:163573257-163573279 CAAGATATGATGGGTTTATCAGG + Intergenic
965329569 3:167353975-167353997 CAATTTATGATGGGTTTATTGGG - Intronic
965611080 3:170544554-170544576 AAACTTATGATGGGTTTATCAGG - Intronic
966045285 3:175541305-175541327 CAACTTTTGATGGGTTTATTAGG - Intronic
966208939 3:177433100-177433122 CGACTTAGGATGGGTTTATCAGG + Intergenic
966345612 3:178976309-178976331 TGACTTATCATAGGTTTATCAGG - Intergenic
966368740 3:179222514-179222536 CAACTTATGATGTGTTTATCAGG - Intronic
966468834 3:180264007-180264029 CAACTTGTGATGGGTTTATCAGG + Intergenic
966805757 3:183806194-183806216 CAACTTACGATGGGTTTTTCAGG + Intronic
967313155 3:188125516-188125538 CAACTTATGATGGGTTTATCAGG - Intergenic
968239331 3:197062118-197062140 CAACTTGTGATGGGTTTATTGGG - Intronic
970290524 4:14566272-14566294 CAACTTACGATGGGTTTCTCAGG - Intergenic
970293116 4:14598720-14598742 CAAGTTATGATGGGTTTATCTGG - Intergenic
971380168 4:26089419-26089441 CAGTTTATGATGGGTTTATCAGG + Intergenic
972226678 4:37021353-37021375 AAAAGTATCAGAGGTTTATCAGG - Intergenic
972238822 4:37166328-37166350 CAACTTACAATGGGTTTATCAGG + Intergenic
972254747 4:37341338-37341360 CAACTGACAACAGGTTTATCAGG + Intronic
972345165 4:38186800-38186822 CAACCTATGATGGGATTATCAGG + Intergenic
972393802 4:38639556-38639578 CTACTTACGATGGGTTTATCAGG + Intergenic
972622125 4:40757430-40757452 TAACTTATGATGGGTTTATCAGG + Intronic
973190474 4:47379557-47379579 CAATTTATGATTGGTTTATTGGG + Intronic
973244628 4:47997880-47997902 CAATTTATGATAGGTTTATTGGG - Intronic
973667156 4:53173189-53173211 CAACTTATGATGGATTTATCAGG - Intronic
973718285 4:53699544-53699566 CAAGATCTGACAGGTTTATCAGG - Intronic
974166216 4:58207284-58207306 CAACCTATAATGGGTTTATCAGG - Intergenic
974818998 4:67042574-67042596 CAAATTATGATGGGTTTATGAGG - Intergenic
975167291 4:71191203-71191225 CAATTTATGATGGGCTTATCAGG + Intronic
975535798 4:75448590-75448612 CAATTTATGATGAGTTTATCAGG + Intergenic
975608739 4:76182800-76182822 CAACTTATGATGGGTTTACTGGG - Intronic
975834153 4:78403723-78403745 CAACTTATGATGAGTTTAACAGG - Intronic
975926330 4:79458801-79458823 CAACTTACAATGGGTTTATCAGG + Intergenic
975937753 4:79601811-79601833 TAACTTAAAAGAGGTTTATTTGG - Intergenic
976419957 4:84830512-84830534 CAAATTATGATGGGTTTATTGGG + Intronic
977036104 4:91955317-91955339 CAACTTACAAATGGTTTATCAGG - Intergenic
977454626 4:97242912-97242934 CAACTTATGATGGATGTATCAGG + Intronic
978540349 4:109810014-109810036 CAACTCATGATGGGTTTATTGGG + Intergenic
979044522 4:115845000-115845022 AATCTTATGTGTGGTTTATCAGG - Intergenic
979116940 4:116836504-116836526 CAACTTATGTGATTTTTTTCTGG - Intergenic
979264684 4:118687625-118687647 CAACTTACAATGGGTTTATCAGG + Intronic
979401044 4:120250149-120250171 CAACTTATGATGGGTTTATCAGG + Intergenic
979538421 4:121851135-121851157 CACTTTCTGAGTGGTTTATCAGG + Intronic
979661197 4:123257441-123257463 CAACTGATGATGGGTTTACCAGG + Intronic
980335693 4:131469862-131469884 CAAGATCTGATAGGTTTATCAGG + Intergenic
981101734 4:140836494-140836516 CAACTTACGATGGGTTTATCGGG - Intergenic
981393131 4:144216201-144216223 CAAGATGTGACAGGTTTATCAGG - Intergenic
981824052 4:148918913-148918935 CAAATTATGATAGGTTTATCAGG - Intergenic
981991213 4:150923097-150923119 CAACTTAAGATGGGTTTAGCCGG + Intronic
982162946 4:152588107-152588129 CAATTTAGGATGGGTTTATCAGG + Intergenic
982174807 4:152695526-152695548 CAACTTATGATGGGCTTATTGGG + Intronic
982193093 4:152877800-152877822 CAAGATCTGATAGGTTTATCAGG + Intronic
982463974 4:155707267-155707289 CAAGTTACGATGGGTTTATCTGG - Intronic
982566022 4:156987746-156987768 CAACTTATCATAGGTTTTTTGGG - Intergenic
983425001 4:167572415-167572437 CAGCTTATGATGGGTTTATTAGG + Intergenic
983539672 4:168895875-168895897 CAACTTATAATGAGTTTATCAGG - Intronic
983740460 4:171125044-171125066 TAACTTATGATGGGTTTATCGGG + Intergenic
983806286 4:171997391-171997413 CAACTTACGATGGGTTTATCAGG - Intronic
984346556 4:178535448-178535470 CAACTTACAATGGGTTTATCAGG - Intergenic
985323387 4:188739713-188739735 TAACTTATGACGGGTTTATTGGG - Intergenic
985344929 4:188994248-188994270 CTACTTATGAGAGAATAATCAGG + Intergenic
986963498 5:13243840-13243862 AAATTTATGATAGGTTTATCAGG + Intergenic
987291338 5:16511469-16511491 CAACTTAGGATGGGTTTCTCAGG + Intronic
987442904 5:17979419-17979441 CAACTTATGATGGGTTTATCAGG + Intergenic
987894476 5:23926625-23926647 CAAGATCTGATAGGTTTATCAGG - Intergenic
988393144 5:30661679-30661701 CAACTTACAATGGGTTTATCAGG - Intergenic
988462986 5:31458160-31458182 CAGTTTATGATAGGTTTATTGGG - Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988700400 5:33668082-33668104 GAATTGATGACAGGTTTATCAGG - Intronic
988832453 5:35001138-35001160 CAATTTAGGAGGGGTTTATCAGG + Intronic
988972820 5:36486954-36486976 CAATTTATGATGGGTTTATATGG - Intergenic
990349131 5:54898340-54898362 CAACTTATGATAGGCTTATGAGG + Intergenic
990679627 5:58227294-58227316 CAATTTATGATGGATTTATCAGG + Intergenic
990874827 5:60472971-60472993 CAACTTATGATTAGTTTATTGGG + Intronic
990931596 5:61097234-61097256 CAACATATGATAGGCTTATTGGG - Intronic
990975118 5:61553192-61553214 CAACTTACAATAGGTTTATCAGG - Intergenic
991207209 5:64063043-64063065 CAAACTACGATAGGTTTATCAGG - Intergenic
991307477 5:65194528-65194550 CAACTTTGTATAGGTTTATCAGG + Intronic
991402699 5:66271051-66271073 CAAATTACAATAGGTTTATCTGG + Intergenic
991687628 5:69196299-69196321 CAACTTACAATGGGTTTATCAGG - Intronic
991903975 5:71489041-71489063 CAACTTATGATGGGTTTATTGGG + Intronic
992316182 5:75557598-75557620 AACTTTATGAGGGGTTTATCTGG - Intronic
992319223 5:75594229-75594251 CAATTTATGATGGGTTTATCGGG - Intronic
992853070 5:80831041-80831063 TGACTTATGATGGGTTTATCAGG - Intronic
992981504 5:82178915-82178937 CAACTTACGATGGGTTTATCAGG - Intronic
993599252 5:89900698-89900720 CAACTTTTAAAAGGTTTATGAGG + Intergenic
994074170 5:95632524-95632546 CAACTTCTGAGATCTTTTTCAGG - Intergenic
994840507 5:104919121-104919143 CAACTTTTGACAAGTTTGTCCGG - Intergenic
995068659 5:107891914-107891936 CAACTTACGATGGGTTTATTGGG - Intronic
995315023 5:110759948-110759970 GAATTTATGACAGGTTTATTGGG - Intronic
995741121 5:115356786-115356808 CAACTTACAATGGGTTTATCAGG + Intergenic
995809805 5:116092851-116092873 CAATTTGTGACAGGTCTATCAGG - Intronic
995928240 5:117402152-117402174 CAACTTATGATGGGTTTATTAGG - Intergenic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996240349 5:121191719-121191741 CAACTTGTGATGGATTTATCAGG + Intergenic
996340531 5:122434014-122434036 CAACTTAGGATGGGTTTATTGGG + Intronic
996445794 5:123548808-123548830 CAACTTAAGATGGGCTTATCAGG - Intronic
996646013 5:125817723-125817745 CAACTTAACAAGGGTTTATCAGG - Intergenic
996670745 5:126114115-126114137 CAAGATCTGATAGGTTTATCAGG + Intergenic
996862077 5:128079190-128079212 AAACTTATGAAAAATTTATCAGG - Intergenic
997483549 5:134208633-134208655 CAAGTTATGATATATTTATCTGG + Intronic
997556962 5:134808250-134808272 CAACTTACGATGGGTTTATCGGG - Intronic
997936960 5:138120843-138120865 CAACTTATGATGGGTTTATTGGG - Intronic
999170700 5:149591930-149591952 CAACTTATAATGGGTTTATCAGG + Intronic
999552366 5:152703312-152703334 CCACTTATGATGGGTTTATCAGG + Intergenic
999851900 5:155549625-155549647 CAACTATTGAGATGTTTATATGG + Intergenic
1000167196 5:158663315-158663337 CAACTTACGACAGTCTTATCAGG - Intergenic
1000693919 5:164356764-164356786 CAACTTACAATAGGTTTATCAGG - Intergenic
1001359712 5:171069761-171069783 CAACTCATGATGGGTTTGTCAGG + Intronic
1001957395 5:175857427-175857449 CAACTTACGATGGGTTTATTGGG - Intronic
1002144444 5:177167822-177167844 CGACTTATGATGGGTTAATCAGG + Intronic
1002396342 5:178958457-178958479 CAAATAATGACAGGTTTATATGG - Intronic
1003138451 6:3452170-3452192 CAACTGATGAGGGGTTTATCTGG + Intronic
1003202145 6:3971161-3971183 CACTTTATGATGGGTTTATCGGG + Intergenic
1003609363 6:7595555-7595577 CAGTTTATGATGGGTTTATCGGG + Intronic
1003695132 6:8398110-8398132 CAACTTATGATGGGTTTATAAGG - Intergenic
1004586555 6:17007270-17007292 CAATTTATGATGGGTTTATCAGG + Intergenic
1005194745 6:23270040-23270062 CAATTTATGATGGGTTTATTGGG - Intergenic
1005369457 6:25115715-25115737 CAACTTATGATGAGTTTATCAGG + Intergenic
1005943548 6:30579427-30579449 CAACTTATGATGGGTTTATCTGG - Intronic
1006943707 6:37770063-37770085 CAGCTTATGATACGTTTGTCTGG - Intergenic
1007028391 6:38602089-38602111 CAACTTACCATGGGTTTATCAGG + Intronic
1008344791 6:50413102-50413124 CAATTTATAATAGGTTTATCTGG + Intergenic
1008883104 6:56401905-56401927 CAACTTACAATGGGTTTATCAGG - Intergenic
1008987871 6:57567498-57567520 CAACTTGTGATGGGTTTATCAGG + Intronic
1009176479 6:60466091-60466113 CAACTTATGATGGGTTTATCAGG + Intergenic
1009663367 6:66644336-66644358 CAACTTATGATGGGCTTACCAGG - Intergenic
1010322818 6:74532824-74532846 CAACTTATAATGGATTTATCAGG - Intergenic
1010399974 6:75437133-75437155 CAAATGATGCCAGGTTTATCTGG - Intronic
1010841821 6:80655311-80655333 CAACTTATGATGGGTTTATCGGG - Intergenic
1011140747 6:84153211-84153233 CAACTAATGAAACGTTTAACAGG - Intronic
1011972035 6:93237179-93237201 CAACTTACAATAGGTTTATGGGG + Intergenic
1012941646 6:105422013-105422035 TGACTTATGACAGGTTTATCAGG + Intergenic
1013441200 6:110171498-110171520 CAACTTAAAATAGGTTTATTGGG - Intronic
1013758718 6:113491016-113491038 CAACTTACAATGGGTTTATCAGG - Intergenic
1013801182 6:113945908-113945930 CAACTTATGATGGGTTTATCAGG + Intronic
1014135582 6:117884964-117884986 CAAGTTATAAGAGGCTTTTCCGG - Intergenic
1014140202 6:117932911-117932933 CAACTTCCGAGAAGTCTATCAGG - Intronic
1014168961 6:118256772-118256794 CAACTTATGATGGGTTTATAGGG - Intronic
1014191416 6:118500872-118500894 CAGCTTGTGAGAGGCTTCTCAGG + Intronic
1014689167 6:124540958-124540980 CAACTTATCATGGGCTTATCAGG + Intronic
1014974969 6:127869200-127869222 TAACTTATGATGGGTTTATTTGG - Intronic
1015017300 6:128429024-128429046 TCATTTATGATAGGTTTATCGGG + Intronic
1015705072 6:136079096-136079118 CAACTTACAATGGGTTTATCTGG + Intronic
1015931274 6:138362468-138362490 CAACTTACGACGGGTTTATTGGG - Intergenic
1016154587 6:140788883-140788905 CAACTTATGATAAGTTTATCAGG - Intergenic
1016746401 6:147585109-147585131 TTACTTATGAGAGGTGTGTCGGG + Intronic
1016972476 6:149777098-149777120 CAACTTATGATGGGTTTACCAGG - Intronic
1017312470 6:152989653-152989675 TAACTTATGATGGGTTTATTGGG + Exonic
1017419270 6:154257049-154257071 CAATTTATTACAGATTTATCAGG + Intronic
1017500920 6:155022123-155022145 CAAGTTGTGAGAGCTATATCAGG - Intronic
1017652711 6:156597860-156597882 CAATTTGTGGCAGGTTTATCGGG + Intergenic
1017827690 6:158094266-158094288 CAACTTACGATGGGTTTATTGGG - Intronic
1019792298 7:3023913-3023935 CAACTTATGATGGGTTCATCGGG + Intronic
1020196655 7:6045002-6045024 CAATTTATGATGGGTTTATCAGG + Intronic
1020452050 7:8331270-8331292 AAACTTAGGAGTGGTTTTTCTGG + Intergenic
1020474349 7:8578225-8578247 CAACTTACAATGGGTTTATCAGG - Intronic
1021198176 7:17695692-17695714 CAACTTATGATGGGTTCGTCAGG + Intergenic
1021661413 7:22922337-22922359 CAGCTTATGATGAGTTTATCAGG - Intergenic
1021707790 7:23384968-23384990 CAACTTATAATGGGATTATCAGG + Intronic
1021806750 7:24364858-24364880 CAACTTAGGATGGGTTTATTAGG + Intergenic
1022139463 7:27480766-27480788 AAACTTACGATAGGTTTATGGGG - Intergenic
1022170157 7:27819619-27819641 TAACTTATGATGGGTTTATCAGG - Intronic
1022183696 7:27946176-27946198 TAACTTATGATGGGTTTATCAGG + Intronic
1022326036 7:29332844-29332866 CAACTTATGATGGGGTTATGTGG + Intronic
1022578757 7:31526292-31526314 CAACTTATGATGGGTTTATTGGG + Intronic
1022909005 7:34882322-34882344 CAAGATATGACGGGTTTATCAGG - Intergenic
1023114586 7:36849729-36849751 CAACTTACAAAAGGTTTATTGGG + Intergenic
1023270965 7:38462299-38462321 CTACTTACGATGGGTTTATCAGG + Intronic
1023407504 7:39850158-39850180 CAACTTAAGATCAGTTTATCAGG - Intergenic
1024018478 7:45342146-45342168 CAACTTATGATGGGTTTATCAGG - Intergenic
1024467225 7:49723999-49724021 CAATTTATGATGGGTTTATCAGG - Intergenic
1024584337 7:50828091-50828113 CAACTTATGATGGATTTATTGGG - Intergenic
1025950794 7:66143877-66143899 TATCTTATGAGAGGATTAACAGG - Intronic
1026335634 7:69392228-69392250 CAACTTATGATGGGTGTATTGGG - Intergenic
1026465629 7:70651411-70651433 CCACGTATGAAGGGTTTATCGGG - Intronic
1026669283 7:72373690-72373712 CAACTTAAGGTTGGTTTATCAGG + Intronic
1028214486 7:88114808-88114830 TAACTTATGATAGGTTTATCAGG - Intronic
1028324900 7:89510882-89510904 CAACTTATAATGGGTTTATTGGG - Intergenic
1028414087 7:90561430-90561452 CAACTTTTGATGGGTTTATTGGG - Intronic
1030149234 7:106386270-106386292 AAACTTATGATGGGTTTATTGGG - Intergenic
1030955650 7:115848685-115848707 GATCTTATGAGACCTTTATCTGG + Intergenic
1031274388 7:119700291-119700313 AAACTTCTGAGAGTTTCATCGGG + Intergenic
1031512281 7:122665473-122665495 TAACTTATGACAGGCTTATTAGG - Intronic
1031583685 7:123507450-123507472 CAATTTATGACAGGTTTACTGGG + Intronic
1031603305 7:123739698-123739720 CAACTTACGACAGGTTTATCAGG + Intronic
1031933265 7:127708486-127708508 CAGCTTATGATGGGTTTATCAGG + Intronic
1032350303 7:131156740-131156762 CAACCTACGATGGGTTTATCAGG + Intronic
1032670378 7:134076924-134076946 CAACTTATGATGGGTTTATCAGG - Intergenic
1032747531 7:134802555-134802577 CAACTTACAATAGCTTTATCAGG - Intronic
1033050988 7:138003915-138003937 CAATTTATGATGGGTTTATGTGG - Intronic
1033419104 7:141190122-141190144 CAACTTATGATGGGTTGATCAGG - Intronic
1033762274 7:144448458-144448480 CAACTTATGATGGGTTTATTGGG - Intergenic
1033845498 7:145426937-145426959 CAAAATATCAGAGTTTTATCAGG + Intergenic
1034995537 7:155574902-155574924 CAACTTATGACGGGCTTATTGGG + Intergenic
1035187493 7:157138221-157138243 CATCTTACGATGGGTTTATCAGG + Intergenic
1035194350 7:157203834-157203856 CAACTTACAATGGGTTTATCAGG - Intronic
1035610588 8:960733-960755 CAACTTACAATAGGTTTATCGGG - Intergenic
1036058662 8:5289952-5289974 CAACTTACAGCAGGTTTATCAGG + Intergenic
1036934406 8:12987358-12987380 CAACTTATAATGGGTTTATTGGG - Intronic
1037006775 8:13791089-13791111 CACCTTATGAAGGGTTTATTGGG + Intergenic
1037406739 8:18550493-18550515 CAACTTAGAATGGGTTTATCTGG - Intronic
1037489322 8:19382644-19382666 CAACTTATGCTGGGTTTATCAGG + Intronic
1038322495 8:26540573-26540595 CAACTTACAATGGGTTTATCAGG - Intronic
1038368038 8:26956887-26956909 CAACTTATAATGGTTTTATCAGG + Intergenic
1038402468 8:27295456-27295478 CAACTTATGATGGGTTTATTGGG - Intronic
1038598415 8:28912198-28912220 CAACTTACTATGGGTTTATCAGG + Intronic
1039198195 8:35056222-35056244 CAACTTATAGGAGGTTTAAAGGG - Intergenic
1039356434 8:36821977-36821999 CAACTTATGATGGGTTTATAGGG + Intronic
1039829906 8:41204912-41204934 CAATTTATGATGAGTTTATCAGG - Intergenic
1040039226 8:42898770-42898792 CAACTTATGATGGGTTTACCGGG - Intronic
1041517097 8:58712623-58712645 CAATTTATGATAGGTTTATCAGG - Intergenic
1041611283 8:59852604-59852626 CAACTTATGATGGGATTATCAGG + Intergenic
1041941730 8:63395762-63395784 CAACTTAAGATGGGTTTATTGGG + Intergenic
1042443635 8:68858141-68858163 CAACATCTGATGGGTTTATCAGG - Intergenic
1042462497 8:69086841-69086863 CAACTTATGTGAGGCTTTGCAGG + Intergenic
1042508312 8:69584539-69584561 CAACTTATGATGGGTTTATTGGG - Intronic
1042650847 8:71039254-71039276 CAGCTTTTGATAGGTTTATTGGG - Intergenic
1042735915 8:71988346-71988368 CAAGTTATCATGGGTTTATCAGG - Intronic
1042964083 8:74332387-74332409 CAATTTATGATGGGTTTATCAGG - Intronic
1043062472 8:75522017-75522039 CAACTTATGATGAGTTTATTGGG + Intronic
1043347133 8:79311482-79311504 CAACTTGTGATGGGTTTATCAGG - Intergenic
1044236777 8:89840194-89840216 CAACTCAGGATGGGTTTATCAGG + Intergenic
1044334559 8:90964141-90964163 CAACTTATGATGGGTTTATTGGG + Intronic
1044813176 8:96084583-96084605 CAACTTATGATGGGATTATCAGG - Intergenic
1045930536 8:107620587-107620609 TAATTTATAAGAGGTTTAACTGG - Intergenic
1046726791 8:117684386-117684408 CAACTTACAATGGGTTTATCAGG + Intergenic
1046780152 8:118205992-118206014 CAGTTTCTGAGAGGTTTTTCAGG - Intronic
1047010960 8:120672230-120672252 CAACTTATGATGGGCTTATCAGG + Intronic
1047652007 8:126932962-126932984 CAATTTATGACAGATTTGTCTGG - Intergenic
1048019951 8:130528895-130528917 CAGCTTACGACAGGTTTATTGGG - Intergenic
1048387474 8:133925908-133925930 CTGCTTATGATGGGTTTATCGGG - Intergenic
1048929502 8:139300979-139301001 CAACTTTTGGTGGGTTTATCAGG - Intergenic
1049329121 8:142040573-142040595 CAATGTATGAGGGGTTTATCAGG + Intergenic
1050100761 9:2117045-2117067 CAATTTATGATGGGTTTGTCGGG - Intronic
1051461062 9:17316453-17316475 CAACTTACAATAGGTTTATCAGG - Intronic
1051461065 9:17316518-17316540 CAGCTTATAATTGGTTTATCTGG + Intronic
1051463165 9:17347340-17347362 CAACTTATGATGGATTTATCCGG - Intronic
1051495285 9:17715725-17715747 CAACTTATGATAGGTTTATCTGG - Intronic
1051579218 9:18652741-18652763 CAACTTAAGATGGGTTTATCAGG + Intronic
1051715941 9:19984021-19984043 CAACTTATTACAGATTTCTCTGG - Intergenic
1051989356 9:23132738-23132760 CAACTTATAATCGGTATATCAGG - Intergenic
1052200894 9:25778609-25778631 CAAGTTATGATGTGTTTATCAGG - Intergenic
1052288607 9:26817283-26817305 CAACTTACAATGGGTTTATCAGG - Intergenic
1052838628 9:33271724-33271746 GAACTTAAGATGGGTTTATCAGG + Intronic
1054710184 9:68503234-68503256 CAACTTATGATGGGTTTATTGGG - Intronic
1054801156 9:69349669-69349691 CAATTTATGATGAGTTTATCTGG - Intronic
1055093442 9:72386155-72386177 CAACTTATGATGAGTTTTTCAGG - Intergenic
1055307639 9:74946369-74946391 CAACTTACGATGGGTTTATCAGG - Intergenic
1055553027 9:77448557-77448579 TAATTTATGATGGGTTTATCAGG + Intronic
1055982698 9:82020745-82020767 CAGCCTATGATAGGTTTATCAGG - Intergenic
1056239544 9:84630684-84630706 CAAATTATGATGGGTTTATTGGG - Intergenic
1056297934 9:85211564-85211586 CAGCATACGAGAGGATTATCAGG + Intergenic
1056334496 9:85553540-85553562 CAGCTTATGATGGGTTTATCGGG + Intronic
1056362551 9:85873617-85873639 CAACTTATGATAGGTTGATCAGG + Intergenic
1056433201 9:86549020-86549042 CAATTTATGCTGGGTTTATCGGG + Intergenic
1056700260 9:88898643-88898665 CAACTTATGATGGGTTTATTGGG - Intergenic
1056714411 9:89016334-89016356 CAACATATGATAGGTTTATTGGG + Intronic
1056847994 9:90057025-90057047 CAACTTATGATGGGTTTATCAGG - Intergenic
1057112638 9:92488117-92488139 CAACTTACGGTGGGTTTATCAGG + Intronic
1058103794 9:100946920-100946942 CAATTTATGATGGATTTATCAGG - Intergenic
1058177694 9:101756330-101756352 CAACTTATGATGAGTTTATGAGG - Intergenic
1058189453 9:101894896-101894918 CAGCTTACGATGGGTTTATCAGG + Intergenic
1058794027 9:108479941-108479963 CAACTTATGATGGGTTTATGAGG - Intergenic
1059310595 9:113386522-113386544 CAACTTATGATGGGTTTATCAGG + Exonic
1059538105 9:115102528-115102550 CTACTATTGAAAGGTTTATCAGG + Intronic
1059542682 9:115145646-115145668 TAACTTATGATGGGTTTATTGGG - Intronic
1059641621 9:116222426-116222448 CAACTTAAGATAGGTTTATTGGG + Intronic
1059780657 9:117522753-117522775 CAAATTATGATAGATTTATCAGG + Intergenic
1060888103 9:127169940-127169962 CAACTTATGATGGGTTTATTGGG + Intronic
1061341412 9:129984784-129984806 CAAGATCTGACAGGTTTATCAGG + Intronic
1185653269 X:1664602-1664624 CAACTTACAATGGGTTTATCAGG + Intergenic
1185822225 X:3216528-3216550 CAACTTATAACAGGTTTATTGGG + Intergenic
1185957015 X:4502410-4502432 CAACTTATGATGGGTTTATTTGG + Intergenic
1186366484 X:8899922-8899944 CAACTCACAATAGGTTTATCGGG + Intergenic
1187038964 X:15573177-15573199 CAACTTATGATGAGTTTATTGGG + Intronic
1187092479 X:16111375-16111397 CAACTTAAGATGGGTTTATCAGG - Intergenic
1187485255 X:19697190-19697212 CAACTTATGATGGGTTTATTGGG + Intronic
1187732205 X:22266919-22266941 CAACTTATGATAGGTTTATCAGG + Intergenic
1187823138 X:23309347-23309369 CCACTTAGGATGGGTTTATCAGG + Intergenic
1187946264 X:24428804-24428826 CAACTTGCAATAGGTTTATCAGG - Intergenic
1188093508 X:25992572-25992594 CAACTTAAAATGGGTTTATCAGG - Intergenic
1188587340 X:31793436-31793458 CAACGTATGATGGGTTTATCAGG - Intronic
1188599777 X:31947670-31947692 CAATTTATGATGGGTTTATCAGG + Intronic
1188627387 X:32302362-32302384 CAACTTACAATGGGTTTATCTGG + Intronic
1188681432 X:33012838-33012860 CAACTTATGATGGGTTTATAGGG + Intronic
1189458262 X:41213523-41213545 CAATTTATGATGGGTTTATTGGG + Intronic
1189681519 X:43521188-43521210 CAATTTATGATGGGTTTATCAGG - Intergenic
1189681524 X:43521255-43521277 CAACTTACAATGGGTTTATCTGG + Intergenic
1189841648 X:45085382-45085404 CAACTTACTATGGGTTTATCAGG + Intronic
1190003875 X:46715934-46715956 AAACTTATGATGGCTTTATCAGG + Intronic
1190124803 X:47694594-47694616 CAACTTATGACGGGTTTATAGGG - Intergenic
1190135574 X:47794022-47794044 CAACTTAGGATGGATTTATCAGG - Intergenic
1190149683 X:47934347-47934369 CAACTTATAGTGGGTTTATCAGG - Intronic
1190768966 X:53499380-53499402 CAATTTATGATGGGTTTATCAGG - Intergenic
1191684612 X:63877407-63877429 TAACTTATAAATGGTTTATCAGG + Intergenic
1192137383 X:68616490-68616512 TAATTTATAAGAGGTTTATTTGG + Intergenic
1192488213 X:71549383-71549405 CAACTTATGATGGGTGTATCGGG + Intronic
1192986432 X:76404722-76404744 CAGCTTATGATGGGTTTATCAGG - Intergenic
1193475192 X:81955501-81955523 TAATTTATGAGAGGTTTAATTGG + Intergenic
1193579273 X:83243418-83243440 CAACCTATGATGGGTTTATCTGG + Intergenic
1193652959 X:84161165-84161187 CAACTTACAATAGGTTTATGGGG - Intronic
1193782453 X:85720213-85720235 CAATTTATGATTGGTTTATCAGG - Intergenic
1194087650 X:89549106-89549128 CAACTTATAATGGATTTATCAGG + Intergenic
1194174282 X:90627953-90627975 CATTTTATGATGGGTTTATCAGG + Intergenic
1194231222 X:91326173-91326195 CAACCTATTATGGGTTTATCAGG - Intergenic
1194829897 X:98609854-98609876 CAATTTATGATGAGTTTATCAGG - Intergenic
1195231200 X:102850283-102850305 CAACTTAGGATAGGTTTATTGGG - Intergenic
1195433817 X:104819178-104819200 CAATTTACGATTGGTTTATCTGG - Intronic
1196151269 X:112377257-112377279 CAACTTATGATGGGTTTATTGGG - Intergenic
1196226561 X:113174927-113174949 CAACTTACAATGGGTTTATCAGG + Intergenic
1196420735 X:115518402-115518424 TAACTTATGACAGGTTTATCAGG + Intergenic
1196624660 X:117864557-117864579 CAACTTACCATAGGTTTATTGGG + Intergenic
1196995252 X:121375437-121375459 CAACTTACAACGGGTTTATCAGG - Intergenic
1197095500 X:122589789-122589811 CAACTTATGATCGGCTTATCAGG + Intergenic
1197532112 X:127642168-127642190 AAACTTATGAGATATTTATGAGG + Intergenic
1197539254 X:127735239-127735261 CAATTTATGATGGGTTTATTGGG - Intergenic
1197828722 X:130618772-130618794 CAACTTACGATAGTTTTATTGGG + Intergenic
1197963122 X:132027460-132027482 CAACTTATGATAGGTTTATTGGG + Intergenic
1198208345 X:134491403-134491425 CAACTTCAGATGGGTTTATCAGG - Intronic
1198924605 X:141774326-141774348 CAACTTATGATTGCTTTATCAGG - Intergenic
1199299583 X:146197263-146197285 CAACTTATGCTGGGTTTATTGGG + Intergenic
1199557635 X:149126338-149126360 GAATTTATGATGGGTTTATCAGG + Intergenic
1199588688 X:149444059-149444081 CAATGTATGATGGGTTTATCAGG + Intergenic
1199802023 X:151261152-151261174 CAACTTCTGAGAGGTAGATTGGG - Intergenic
1199916311 X:152345226-152345248 CAACTTATGATGGGTTTATTGGG - Intronic
1200156552 X:153979553-153979575 CGACTTATGATGGGTTTATCTGG - Intronic
1200156560 X:153979597-153979619 CAACTTAAGAGGGGTTTAGCTGG + Intronic
1200276961 X:154742322-154742344 CAACTTATGATGGGTTTCTTGGG - Intronic
1200440294 Y:3204974-3204996 CAACTTATAATGGATTTATCAGG + Intergenic
1200520500 Y:4205646-4205668 CATTTTATGATGGGTTTATCAGG + Intergenic
1200755553 Y:6986825-6986847 CAAATTATGATGGGTTTATCAGG - Intronic
1201256729 Y:12115002-12115024 CAACTTATAATGGGTTTATGGGG - Intergenic
1201734980 Y:17249583-17249605 CAACTTATGATGGGTTTGTTAGG - Intergenic
1201745472 Y:17367745-17367767 CAACTTATGATGGGTTTATTTGG + Intergenic