ID: 1165221203

View in Genome Browser
Species Human (GRCh38)
Location 19:34317995-34318017
Sequence GTGGAAGCCCAGGAGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 484}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165221187_1165221203 29 Left 1165221187 19:34317943-34317965 CCTGCCCAGTCTAGCACAGAGCA 0: 1
1: 0
2: 1
3: 17
4: 279
Right 1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 484
1165221190_1165221203 24 Left 1165221190 19:34317948-34317970 CCAGTCTAGCACAGAGCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 484
1165221186_1165221203 30 Left 1165221186 19:34317942-34317964 CCCTGCCCAGTCTAGCACAGAGC No data
Right 1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 484
1165221188_1165221203 25 Left 1165221188 19:34317947-34317969 CCCAGTCTAGCACAGAGCACTGG 0: 1
1: 0
2: 3
3: 15
4: 138
Right 1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165221203 Original CRISPR GTGGAAGCCCAGGAGTTTGG GGG Intronic
901213236 1:7538390-7538412 GTGTAATCCCAGCACTTTGGGGG + Intronic
901258901 1:7856801-7856823 TTGTAAGCCCAGCACTTTGGGGG + Intergenic
901437897 1:9260871-9260893 GCGGAAGCAGAGGGGTTTGGTGG - Intronic
901499707 1:9644254-9644276 CTGGAATCCCAGCACTTTGGGGG + Intergenic
901501880 1:9657565-9657587 CTGGGACCCCAGGAGGTTGGGGG - Intronic
901666470 1:10828915-10828937 GTGAAAACCCCGGAGTTTGCGGG - Intergenic
901685164 1:10939810-10939832 ATGAAAGCCCAGGTGGTTGGAGG + Intergenic
901702065 1:11050495-11050517 CTGGAATCCCAGCACTTTGGTGG + Intergenic
902286846 1:15412623-15412645 GTGGAAGCCCAGGAGAAGGCAGG - Intronic
903153715 1:21430295-21430317 CTGGCAGCCCAGGAGTGGGGAGG + Intergenic
903213978 1:21833113-21833135 GTGGAGGCCCAGAGGTCTGGGGG + Intronic
903453976 1:23474223-23474245 CTGTAATCCCAGCAGTTTGGGGG - Intronic
904713736 1:32450978-32451000 ATGTAATCCCAGGACTTTGGGGG - Intergenic
905191500 1:36238788-36238810 TTTCAAGCCCAGGAGTTTGAGGG - Intronic
905574381 1:39031561-39031583 CTGTAATCCCAGCAGTTTGGGGG - Intronic
905626813 1:39494891-39494913 GTGGAAGCCCAGGCTGTGGGTGG + Intronic
905670129 1:39785928-39785950 GTGGAAGCCCAGGCTGTGGGTGG - Intronic
906164110 1:43672869-43672891 GTTGGAGCCCACGTGTTTGGAGG + Intronic
906454204 1:45979750-45979772 ATTTAAGCCCAGGAGTTTTGAGG + Intronic
906980544 1:50623847-50623869 GTGGGAGCCCAGGAGCCAGGAGG + Intronic
907110696 1:51923775-51923797 CTGGAATCCCAGTACTTTGGGGG + Intronic
907163349 1:52387713-52387735 GTGTAATCCCAGCACTTTGGAGG - Intronic
907254650 1:53169652-53169674 CTGTAATCCCAGCAGTTTGGGGG + Intergenic
907376528 1:54047883-54047905 GTTTGAGCCCAGGAGTTTGAGGG + Intronic
908656528 1:66394680-66394702 GTGGACAGGCAGGAGTTTGGGGG - Intergenic
910551721 1:88482865-88482887 GGGGAAGGTCAGGAGTTTAGAGG - Intergenic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG + Intronic
912716036 1:111984277-111984299 GTGGCAGCTCAGGAGTTTGAGGG - Intronic
912914060 1:113793922-113793944 CTGTAATCCCAGCAGTTTGGAGG - Intronic
915222969 1:154389849-154389871 CTGTAATCCCAGGACTTTGGGGG + Intergenic
915643091 1:157245202-157245224 GATGAATCCCAGGAGTTGGGAGG - Intergenic
916777359 1:167981161-167981183 CTGTAAGCCCAGCACTTTGGAGG - Intronic
917098442 1:171422970-171422992 CTGTAATCCCAGCAGTTTGGAGG + Intergenic
917309661 1:173665749-173665771 CTGTAATCCCAGCAGTTTGGGGG + Intronic
918014492 1:180619874-180619896 GTGGAAGCACTGGAGTCGGGTGG + Intergenic
918503337 1:185223402-185223424 GCTTAAGCCCAGGAGTTTGCAGG - Intronic
920028619 1:203021113-203021135 GCTTAAGCCCAGGAGTTTTGAGG - Intronic
920169119 1:204059178-204059200 CTGTAATCCCAGGACTTTGGGGG + Intergenic
920442507 1:205990355-205990377 GTACAACCCCTGGAGTTTGGTGG + Intronic
921086662 1:211800276-211800298 GTGTAATCCCAGCACTTTGGAGG - Intronic
921132351 1:212230487-212230509 CTGGATGCCCAGGACTCTGGAGG + Intergenic
921383756 1:214550656-214550678 CTCGACGCCCAGGAGTTCGGTGG + Intronic
921546543 1:216481432-216481454 GTGGAATAGCAGGAGTCTGGGGG - Intergenic
924156225 1:241179353-241179375 CTGGAATCCCAGCACTTTGGGGG - Intronic
924673305 1:246150707-246150729 GTGGAAGTCCAGGGGTTGGGGGG + Intronic
1062864818 10:843439-843461 CTGGAATCCCAGCACTTTGGGGG + Intronic
1063371491 10:5525545-5525567 GTGGGCGCCCAGGAGCATGGTGG - Exonic
1064859969 10:19816261-19816283 GCGGAGCCCCAGGAGTTTGGTGG - Exonic
1065395774 10:25235951-25235973 CTGTAATCCCAGGACTTTGGGGG - Intronic
1065808854 10:29422119-29422141 GTGGAAGACCAGCAGATTGGAGG + Intergenic
1066617677 10:37312085-37312107 CTGTAATCCCAGTAGTTTGGGGG - Intronic
1066652744 10:37674194-37674216 CTGGAATCCCAGCACTTTGGGGG + Intergenic
1067564415 10:47326409-47326431 TTGGGAGCCCAGGAGTGTTGAGG + Intergenic
1068119565 10:52771998-52772020 GTGGAAACCCAGGTGTCTGTAGG + Intergenic
1068958323 10:62841567-62841589 CTGGGAGACCAGAAGTTTGGGGG - Intronic
1069489142 10:68846405-68846427 CTGTAATCCCAGGACTTTGGGGG - Intronic
1069496574 10:68909616-68909638 TTGTAATCCCAGCAGTTTGGAGG + Intronic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1070058360 10:72956481-72956503 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1070125403 10:73617570-73617592 GTGTAATCCCAGCACTTTGGAGG + Intronic
1070680250 10:78443999-78444021 GTGGAATCCCTGGAGATTTGTGG + Intergenic
1072497559 10:95977111-95977133 GTGTAATCCCAGCACTTTGGAGG + Intronic
1072652511 10:97306682-97306704 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1073329216 10:102659996-102660018 CTGGAATCCCAGCAGTTTGAAGG + Intergenic
1073606452 10:104900631-104900653 CTGTAATCCCAGGACTTTGGGGG + Intronic
1074193266 10:111156510-111156532 GCTGAAGGCCAGGAGTTGGGAGG - Intergenic
1074718693 10:116245942-116245964 GGGGAAGCCCAGGAGGTTTTAGG + Intronic
1074824621 10:117205790-117205812 CTGTAAGCCCAGCACTTTGGGGG + Intronic
1075365618 10:121885633-121885655 CTGGAATCCCAGCATTTTGGAGG + Intronic
1077380084 11:2229241-2229263 GTGGAAGTCCAGGAGTCCAGTGG + Intergenic
1077552276 11:3206020-3206042 GTGGAAGCCAAGGAGAAAGGAGG - Intergenic
1077816749 11:5693142-5693164 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1078824678 11:14917855-14917877 CTGTAATCCCAGCAGTTTGGAGG + Intronic
1080224804 11:29948751-29948773 CTGCAATCCCAGCAGTTTGGGGG + Intergenic
1080509049 11:32948544-32948566 GGGTGAGCCCAGGAGTTTGAGGG + Intronic
1080946480 11:36980112-36980134 CTGTAACCCCAGGACTTTGGAGG - Intergenic
1081401366 11:42646958-42646980 GTGCCAGCCCAGGTGTTTAGTGG - Intergenic
1081509967 11:43760305-43760327 GTATAAGCCCAGCACTTTGGGGG - Intronic
1081556031 11:44162316-44162338 CTGTAATCCCAGGACTTTGGGGG + Intronic
1082672554 11:56053313-56053335 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1083774896 11:64889682-64889704 CTGTAATCCCAGCAGTTTGGGGG + Intergenic
1083883790 11:65560894-65560916 GAGGAAAACCAGGAGTGTGGTGG + Intergenic
1084451308 11:69240450-69240472 GTGCAAGCCCAGGGGGATGGGGG + Intergenic
1084845443 11:71895582-71895604 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1085096481 11:73764685-73764707 ATTGAAGCCCAGGAGTATGTAGG + Intergenic
1085286193 11:75363320-75363342 GTGTAATCCCAGCACTTTGGAGG - Intergenic
1086253917 11:84851456-84851478 ATTGGAGCCCAGGAGTTTTGTGG + Intronic
1086666200 11:89486374-89486396 GCTTGAGCCCAGGAGTTTGGAGG - Intronic
1086745414 11:90420484-90420506 CTGGAATCCCAGCACTTTGGGGG - Intergenic
1087163086 11:94970108-94970130 GTGAGAGCCCAGAAGATTGGAGG + Intronic
1087383288 11:97436605-97436627 GTGGAAGCCCAGCAAGATGGAGG + Intergenic
1088651483 11:111961112-111961134 GGAGGAGCCCAGGAGTTTGCAGG + Intronic
1089246386 11:117123637-117123659 TTGTAACCCCAGCAGTTTGGGGG + Intergenic
1089417692 11:118306236-118306258 CTGTAAGCCCAGCATTTTGGGGG + Intronic
1091759161 12:3076237-3076259 GTGTAATCCCAGGACTTTGGGGG - Intergenic
1091842477 12:3630889-3630911 GTGGGAGACCAGGAAGTTGGAGG + Intronic
1092299760 12:7235680-7235702 ATGTAAGACCAGGATTTTGGAGG + Intergenic
1093199249 12:16167365-16167387 TTGGTAGCTCAGGAGTTGGGTGG + Intergenic
1093651405 12:21649832-21649854 GTGTAATCCCAGCATTTTGGGGG + Intronic
1094743034 12:33311074-33311096 GTGGAAGCCCAGTAATGAGGAGG + Intergenic
1095088514 12:38083872-38083894 GTGGCATCCCAGGAGCTTGTAGG - Intergenic
1095696396 12:45149007-45149029 GTTTGAGCCCAGGAGTTTGAGGG + Intergenic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1098004914 12:65985975-65985997 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
1098206406 12:68115123-68115145 GTAGAAGCTGAGGAGTTGGGAGG + Intergenic
1100006121 12:89897680-89897702 GTGGAATCCTAGGAGGGTGGAGG + Intergenic
1100243099 12:92729484-92729506 GCTGAAGCCCAGGAGTGGGGTGG - Intronic
1100479941 12:94968264-94968286 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1100541854 12:95564909-95564931 CTGTAAGCCCAGCACTTTGGGGG + Intergenic
1100835819 12:98565895-98565917 CTGTAATCCCAGCAGTTTGGAGG + Intergenic
1101634280 12:106524885-106524907 GTGGGAGCCAATGAGTTTGGGGG + Intronic
1103072731 12:117958088-117958110 CTGTAATCCCAGGACTTTGGGGG - Intronic
1103157619 12:118699930-118699952 GTGGAAGCCCAGTTGCATGGAGG - Intergenic
1103292114 12:119855039-119855061 GCTTAAGCCCAGGAGTTTGAGGG + Intronic
1103560017 12:121788744-121788766 GTGAAAGCCCAGGAGAAGGGAGG + Intronic
1103707079 12:122881519-122881541 GTTTAAGCCCAGGAGTTGGTTGG + Intronic
1104384593 12:128339303-128339325 ATGGGAGCCCAGGGGGTTGGAGG + Intronic
1104558768 12:129825274-129825296 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1104918722 12:132279546-132279568 GAGGCAGCCCCGGAGTCTGGAGG + Intronic
1105251019 13:18698329-18698351 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1105272218 13:18888102-18888124 CTGGAATCCCAGCACTTTGGAGG + Intergenic
1105326115 13:19371886-19371908 CTGTAATCCCAGGACTTTGGAGG + Intergenic
1106001741 13:25730031-25730053 CTGTAATCCCAGGACTTTGGAGG + Intronic
1106132135 13:26949303-26949325 CTGGAATCCCAGCACTTTGGGGG + Intergenic
1106352508 13:28946805-28946827 CTGGAATCCAAGCAGTTTGGGGG - Intronic
1106527230 13:30551949-30551971 CTGGAATCCCAGCACTTTGGAGG - Intronic
1107904431 13:45049215-45049237 GTGTAATCCCAGCACTTTGGGGG + Intergenic
1109492596 13:63122151-63122173 CTGTAATCCCAGGACTTTGGGGG - Intergenic
1110665587 13:78114183-78114205 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
1110858609 13:80323805-80323827 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1114357750 14:21931270-21931292 CTGTAATCCCAGGACTTTGGAGG - Intergenic
1114376453 14:22151850-22151872 CTGTAATCCCAGGACTTTGGGGG - Intergenic
1114854471 14:26421498-26421520 GTAAAAGCCCAGGAGGTTAGAGG + Intergenic
1114886943 14:26864605-26864627 CTGTAATCCCAGCAGTTTGGCGG + Intergenic
1115953642 14:38750630-38750652 GGAGAAGCCCAGGAGTTTCTGGG + Intergenic
1116673246 14:47871302-47871324 CTGTAATCCCAGGACTTTGGGGG - Intergenic
1118598876 14:67457520-67457542 ATTTGAGCCCAGGAGTTTGGAGG + Intronic
1118885703 14:69864279-69864301 CTGGAAGAGCAGGAGTCTGGAGG + Intronic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1119028248 14:71170866-71170888 GTGTAATCCCAGCACTTTGGGGG - Intergenic
1119307168 14:73616905-73616927 TTTGAAGCCAAGGAGATTGGGGG - Exonic
1119411804 14:74436589-74436611 GTGTAATCCCAGCACTTTGGGGG + Intergenic
1119660121 14:76445087-76445109 GCTTGAGCCCAGGAGTTTGGAGG + Intronic
1119982453 14:79097302-79097324 CTGTAACCCTAGGAGTTTGGCGG + Intronic
1120113320 14:80583718-80583740 TTGGAAGTCCAGGAGGTTTGTGG - Intronic
1120827220 14:88966937-88966959 GCTTAAGCCCAGGAGTTTGAGGG - Intergenic
1121224252 14:92309626-92309648 GTGGAAGCCCTAGGCTTTGGGGG - Intergenic
1122240717 14:100365036-100365058 GTGGGAGCCCAGGAGTTTGAGGG + Intronic
1122755052 14:103971896-103971918 CTGTAATCCCAGCAGTTTGGGGG + Intronic
1122987595 14:105219693-105219715 CTGGAAGCCCTGGGGTTTGGGGG + Intronic
1124446846 15:29742168-29742190 GCTGGAGCCCAGGAGTTTTGAGG + Intronic
1125457448 15:39874784-39874806 GTGTAATCCCAGCACTTTGGGGG + Intronic
1125532645 15:40423715-40423737 CTGGAATCCCAGCACTTTGGGGG - Intronic
1126625801 15:50685203-50685225 CTGTAATCCCAGGACTTTGGGGG + Intronic
1127107657 15:55634323-55634345 CTGTAATCCCAGCAGTTTGGAGG - Intronic
1127455846 15:59155418-59155440 GTGAAAGACCAGGAGTTTTCAGG - Intronic
1128516206 15:68343672-68343694 GTGGACTCTCGGGAGTTTGGCGG - Intronic
1129700031 15:77762557-77762579 CTTGAAGCCCAGGAATTTAGGGG - Intronic
1129866900 15:78915765-78915787 GAGGAAGCTCATGAGTTTGTAGG + Intergenic
1130146956 15:81281656-81281678 ATGGAAGCCCAGGATTATGAGGG - Intronic
1130514411 15:84615209-84615231 CTGTAATCCCAGGACTTTGGGGG - Intronic
1132280133 15:100605943-100605965 ATGGAGGCCCAGTAATTTGGAGG + Intronic
1132525801 16:413997-414019 GCTTTAGCCCAGGAGTTTGGAGG - Intergenic
1132709926 16:1261863-1261885 GTGGGACCCCAGGAGGTGGGAGG + Intergenic
1133132694 16:3687483-3687505 GTGGTAGACCTGGTGTTTGGTGG - Intronic
1133399168 16:5472221-5472243 GTGGAAGCTCTGGAGTGAGGAGG - Intergenic
1133854186 16:9534284-9534306 CTGGAATCCCAGCACTTTGGGGG + Intergenic
1134451351 16:14365651-14365673 GCTCAAGCCCAGGAGTTTGAGGG + Intergenic
1134646829 16:15875397-15875419 CTGTAATCCCAGGACTTTGGGGG + Intronic
1136555568 16:31005892-31005914 GTGGAAGACCTGGACTTAGGGGG - Intronic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1138202633 16:55101412-55101434 GTAGAAGCCCCGGAGGTGGGTGG - Intergenic
1138219137 16:55236214-55236236 GTGGAAAGGCAGGAGTTTGGGGG - Intergenic
1138481756 16:57307796-57307818 CTGGGTGCCCAGGAGTTTTGGGG - Intergenic
1138616445 16:58171265-58171287 CTGTAATCCCAGCAGTTTGGGGG + Intronic
1139469344 16:67170046-67170068 GAGGAACCCCAGGAGGGTGGAGG + Intergenic
1139742114 16:69044376-69044398 CTGTAATCCCAGCAGTTTGGTGG + Intronic
1142601784 17:1056594-1056616 CTGTAAGCCCGGGAGTCTGGGGG - Intronic
1142743170 17:1942225-1942247 GTGGGAGGCCAGGAGGTTTGGGG - Intronic
1142887422 17:2921458-2921480 CTGTAATCCCAGGACTTTGGGGG - Intronic
1142964010 17:3569672-3569694 GTGGAAGCCCAGAAGTCTTTGGG + Intronic
1143134030 17:4700665-4700687 CTGTAATCCCAGGATTTTGGGGG + Intronic
1143478832 17:7217428-7217450 CTGGCAGCCCCGGAGTTCGGGGG + Intronic
1143707350 17:8708037-8708059 GTGGAAGACCAGGGGTCTGTGGG + Intergenic
1143802540 17:9396349-9396371 GAGGAAGCATAGGAATTTGGGGG + Intronic
1143894368 17:10124656-10124678 CTGTAATCCCAGCAGTTTGGGGG + Intronic
1145008427 17:19351966-19351988 GTTTGAGCCTAGGAGTTTGGGGG - Intronic
1145263615 17:21368973-21368995 GGGGAAGCCCAGGAGGCTGTGGG + Intergenic
1145867494 17:28250412-28250434 GTGGAGGGCCAGGCGTCTGGAGG + Intergenic
1145947664 17:28789448-28789470 CTGTAACCCCAGGAATTTGGGGG - Intronic
1146455845 17:33009124-33009146 TGGGAAGCCCAGGAGGCTGGAGG - Intergenic
1147272948 17:39289561-39289583 GTGGGAGCCCAGGAGATGGAGGG + Intronic
1147299950 17:39518422-39518444 GTTTAAGCCCAGCAATTTGGGGG - Intronic
1148039744 17:44697339-44697361 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
1148411531 17:47471448-47471470 CTGTAAGCCCAGGAATTTAGGGG - Intergenic
1148808824 17:50277920-50277942 GTGGAAGTCCCCGAGTTTGTTGG - Intronic
1150420437 17:65029334-65029356 GTGGAAGCAGAGGCGTGTGGGGG - Intronic
1151300016 17:73217393-73217415 CTGTAATCCCAGGACTTTGGAGG + Intronic
1151674999 17:75592706-75592728 GAGGATGCCCAGGACTTTGAGGG + Intergenic
1151690961 17:75685079-75685101 GTGGAACCACAGGAGTGAGGTGG - Intronic
1152095311 17:78268845-78268867 GAGGGAGCCCAGGATTCTGGCGG - Intergenic
1152257010 17:79245881-79245903 CTGGAATCCCAGCACTTTGGAGG - Intronic
1152359938 17:79827853-79827875 CTGGAATCCCACGAATTTGGGGG + Intergenic
1153092961 18:1369408-1369430 ATGAAAGCACAGGATTTTGGAGG + Intergenic
1153942059 18:9987141-9987163 GGACAAGCCCATGAGTTTGGGGG - Intergenic
1154437831 18:14360585-14360607 CTGGAAGCCCTGGGATTTGGGGG - Intergenic
1156787359 18:40931743-40931765 GTGTAATCCCAGCACTTTGGGGG + Intergenic
1157380824 18:47214792-47214814 TTGGAAGCTCAGGATTTTAGAGG + Intronic
1157560104 18:48639735-48639757 GTGGTAGCCCAACAGTGTGGGGG + Intronic
1159560636 18:69989263-69989285 TTGTAATCCCAGCAGTTTGGGGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160209388 18:76863682-76863704 GTGTAATCCCAGGACTTTGGAGG - Intronic
1160242566 18:77133571-77133593 GTGGAAGAGGAGGAGGTTGGGGG + Intronic
1160438875 18:78873588-78873610 TTGTAATCCCAGCAGTTTGGGGG - Intergenic
1160954390 19:1683720-1683742 TTGTAATCCCAGCAGTTTGGGGG + Intergenic
1161028357 19:2046898-2046920 GGTGAATCCCAGGAGCTTGGGGG - Intronic
1161437178 19:4270587-4270609 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1161987476 19:7664384-7664406 GTTTGAGCCCAGGAGTTTGAGGG - Intergenic
1162384908 19:10354971-10354993 GTTTGAGCCCAGGAGTTTTGAGG + Intronic
1162407538 19:10484419-10484441 GTTTAAGCTCAGGAGTTGGGAGG - Intergenic
1162474509 19:10891857-10891879 CTTGAAGCCCAGCAGGTTGGAGG - Intronic
1162670604 19:12254474-12254496 GTGCAATCCCAGCACTTTGGAGG + Intronic
1163054243 19:14706375-14706397 GTGGATGGCCAGGAGGTTGAGGG - Intronic
1163658417 19:18561851-18561873 GTGCCACCCCAGGAATTTGGAGG - Intronic
1163684424 19:18702789-18702811 GTGTAATCCCAGCACTTTGGGGG - Intronic
1163797098 19:19343964-19343986 GGGAAGGCCCAGGAGTTTGTTGG + Intronic
1163895817 19:20058054-20058076 CTGGAATCCCAACAGTTTGGTGG - Intergenic
1164441783 19:28284789-28284811 GTGGAAGGGAAGGAGTGTGGAGG + Intergenic
1164716419 19:30393893-30393915 ATGGAAGCCTGGGTGTTTGGTGG + Intronic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1165715487 19:38043080-38043102 CTGTAATCCCAGCAGTTTGGGGG + Intronic
1165910320 19:39222037-39222059 ACTGAAGCCCAGGAGTTTGGAGG - Intergenic
1166326928 19:42056761-42056783 GGAGAAGCCCAGGATGTTGGAGG + Exonic
1166566771 19:43770274-43770296 GTGGAAGCCTGGGAGATTAGAGG - Intronic
1166641539 19:44498708-44498730 GAGGATGCCCAGGTGTGTGGGGG - Intronic
1167241303 19:48344963-48344985 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1167245389 19:48370049-48370071 ACGGAAGCTCAGGAGTTTAGGGG + Intronic
1167290650 19:48623554-48623576 TTGGAAGCCCAGGGGCTGGGAGG - Intronic
1167376009 19:49112399-49112421 CTGGAATCCCAGCACTTTGGGGG - Intergenic
1167521590 19:49958965-49958987 CTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167650049 19:50724113-50724135 GCGGCGGCCTAGGAGTTTGGGGG - Intronic
1167756270 19:51415503-51415525 TTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167843139 19:52138783-52138805 GAGGAAGCCTAGGAAGTTGGGGG - Intronic
1167906325 19:52664138-52664160 CTGTAATCCCAGCAGTTTGGAGG - Intronic
1168052657 19:53841119-53841141 GCTGGAGCCCAGGAGTTTTGAGG - Intergenic
1168283479 19:55319050-55319072 CTGTAATCCCAGGACTTTGGAGG - Intronic
926152160 2:10431335-10431357 AAGGAAGCCCTGGAGTGTGGAGG + Intergenic
926945044 2:18178331-18178353 GGGGAAACCTAAGAGTTTGGAGG - Intronic
927521421 2:23700956-23700978 ATGGAAGCTCAGGAGTGTGCTGG - Intronic
927809631 2:26173895-26173917 GGGGAGGGCCGGGAGTTTGGGGG - Intronic
927974521 2:27327881-27327903 CTGTAATCCCAGCAGTTTGGGGG - Intronic
928468814 2:31552596-31552618 GTGAAAGACCAAGAGGTTGGAGG - Intronic
928499544 2:31875942-31875964 CTGTAATCCCAGCAGTTTGGGGG - Intronic
929535776 2:42783480-42783502 GGGGATGCCCAGGATGTTGGGGG - Intronic
929654777 2:43719693-43719715 CTGTAATCCCAGGACTTTGGAGG - Intronic
929763507 2:44825499-44825521 GTGGAAGCTCAGGAGATTGGGGG + Intergenic
930168555 2:48228630-48228652 TTGTAATCCCAGCAGTTTGGGGG - Intergenic
930937418 2:56970557-56970579 GTGGAAGACAATGAGATTGGAGG + Intergenic
931678637 2:64723763-64723785 GTGTAATCCCAGCACTTTGGGGG - Intronic
932300078 2:70660642-70660664 GTGGAAGCTCAGGGGTTGAGGGG - Exonic
932650829 2:73554446-73554468 CTGAAATCCCAGCAGTTTGGGGG + Intronic
933560214 2:83877974-83877996 ACGGAAGCCAAGGAGTTAGGTGG + Intergenic
934070530 2:88379987-88380009 CTGGAATCCCAGGACTTGGGAGG + Intergenic
934713563 2:96530571-96530593 CTGGAAGCCCAGGCTTTTGGGGG - Intergenic
936664394 2:114577439-114577461 TTGGAAGCCCATGAGTCCGGTGG - Intronic
937290261 2:120777732-120777754 GTGGGAGCACAGAAGCTTGGGGG + Intronic
937382109 2:121387790-121387812 GTGGTTGTGCAGGAGTTTGGTGG + Exonic
937383786 2:121406958-121406980 CTGTAAGCCCAGCACTTTGGGGG + Intronic
937534956 2:122874940-122874962 TTGAAAGGTCAGGAGTTTGGAGG - Intergenic
938063107 2:128267380-128267402 CTGGCAGCCCAGGAGTGGGGAGG - Exonic
938645250 2:133323954-133323976 GTGCCATCCCAGGAGTTTTGGGG - Intronic
940552377 2:155176422-155176444 GTTTGAGCCCATGAGTTTGGAGG - Intergenic
940561301 2:155300785-155300807 GTTTAAGCCCAGGAGTTCGAGGG + Intergenic
940842018 2:158594650-158594672 GTGAAAAACCAGGAATTTGGAGG + Intronic
941952308 2:171168511-171168533 CTGTAATCCCAGGACTTTGGGGG + Intronic
942030317 2:171953085-171953107 CTGTAACCCCAGCAGTTTGGGGG + Intronic
944403463 2:199354787-199354809 ATGGAATCCCAGAAGTTTAGAGG - Intronic
944416432 2:199484116-199484138 CTGGAATCCCAGCACTTTGGGGG - Intergenic
944736392 2:202570606-202570628 GTGAAAGCCCAGGATGTTGTGGG + Intergenic
944886998 2:204073046-204073068 TTGGAAGACCATGAGTTTTGTGG + Intergenic
945084994 2:206122230-206122252 CTGTAAGCCCAGCATTTTGGGGG - Intronic
945628266 2:212238043-212238065 GCGGAAGCCCAGGAGTTAAGTGG - Intronic
945824188 2:214699909-214699931 GTGACAGCCAAGGAGTTTAGGGG - Intergenic
946227862 2:218274029-218274051 GTGAAGGCTCAGGAGTTGGGTGG - Intronic
946270190 2:218585719-218585741 GTGTGATCCCAGGAGTTTGAGGG - Intronic
1169242807 20:3998821-3998843 CTGTAATCCCAGGACTTTGGGGG + Intronic
1169820495 20:9704418-9704440 GTGGAAGGTCAGGTGTTAGGAGG - Intronic
1169827859 20:9789697-9789719 GGGAAAGACCAGGAGTTTGGGGG + Intronic
1170098807 20:12675877-12675899 GCTTGAGCCCAGGAGTTTGGGGG + Intergenic
1170563348 20:17577322-17577344 GTTGAAGCTCAGGAGTTTTGAGG + Intronic
1171005640 20:21462908-21462930 GAAGGAGCCCAGGAGTTTAGAGG - Intergenic
1171331230 20:24340358-24340380 GTGGAAGCCCAGGACTTGGGTGG - Intergenic
1172442792 20:34977783-34977805 GAGGAAGCCCTGGTGTTTGAGGG + Intronic
1172519079 20:35555838-35555860 CTGGAACCCCAGGAGTTTGCAGG + Intronic
1172972671 20:38884812-38884834 CTGTAATCCCAGGATTTTGGGGG + Intronic
1173333761 20:42096975-42096997 GTGGGACCACTGGAGTTTGGAGG - Intronic
1173612911 20:44383809-44383831 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1174194824 20:48765762-48765784 TGGGAAGACCAGGAGTTGGGAGG + Intronic
1174411830 20:50341388-50341410 GGAGAGGCCAAGGAGTTTGGAGG + Intergenic
1174625663 20:51912472-51912494 GAGGTTGACCAGGAGTTTGGTGG - Intergenic
1175352836 20:58337663-58337685 GTAGAAGTCCAGGTGTTTGAAGG + Intronic
1175458789 20:59135327-59135349 CTGGAATCCCAGCACTTTGGAGG + Intergenic
1175536450 20:59718051-59718073 GGGGAAACCCAGAAGTTAGGTGG + Intronic
1175937446 20:62520295-62520317 CTGGAATCCCAGCACTTTGGGGG + Intergenic
1176798947 21:13403430-13403452 CTGTAATCCCAGGACTTTGGAGG + Intergenic
1177146669 21:17413982-17414004 CTGGAAGGCCAGAAGTTTGATGG + Intergenic
1177200167 21:17944951-17944973 CTGGAATCCCAGCACTTTGGAGG + Intronic
1179663970 21:42896936-42896958 CAGGAAGCCCAGGTGTTTCGAGG + Exonic
1179818321 21:43922162-43922184 GTGGAGGCCCAGGCTTGTGGGGG + Intronic
1179949101 21:44699729-44699751 GTTGGAGACCTGGAGTTTGGGGG - Intronic
1179996719 21:44977616-44977638 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1181106857 22:20580780-20580802 GTGAATGCACAGGACTTTGGTGG + Intronic
1181447852 22:22992412-22992434 GTGGAAGCCCAAGGCTGTGGAGG + Intergenic
1181572491 22:23775147-23775169 GGGGAAGCCCTGGAGGTGGGAGG + Intronic
1182530688 22:30954044-30954066 CTGTAAGCCCAGCACTTTGGGGG + Intronic
1182957276 22:34438382-34438404 CTGTAAGCCCAGCACTTTGGGGG + Intergenic
1183261373 22:36797948-36797970 AGGGAAGCACAGGAGTGTGGCGG - Intergenic
1183355863 22:37359043-37359065 TTGGAAGCCCTGGGGCTTGGGGG + Intergenic
1183538249 22:38415524-38415546 CAGGCAGCCCAGGGGTTTGGTGG + Intergenic
1183562635 22:38588359-38588381 CTGTAATCCCAGGACTTTGGGGG + Intronic
1183815859 22:40299631-40299653 CTGTAATCCCAGCAGTTTGGGGG - Intronic
1183971679 22:41482180-41482202 CTGGAAGCCCTGGAGATTTGTGG + Intronic
1184096424 22:42318709-42318731 GTGGAAGCCCAGGGCTTATGAGG + Intronic
1184425090 22:44404505-44404527 GAGGAAGCCCTTGACTTTGGAGG - Intergenic
1184508179 22:44916796-44916818 GTGCAAGCCCAGGAGGAGGGAGG - Intronic
1184701516 22:46176951-46176973 CTGTAATCCCAGGACTTTGGGGG + Intronic
949265606 3:2153039-2153061 TTGTAAGCCAATGAGTTTGGAGG + Intronic
949478064 3:4467423-4467445 GTGGAAGGCCTTGAGTTTTGTGG - Intergenic
950686453 3:14621889-14621911 GTAGGGGCCCAGGAGTTGGGGGG + Intergenic
951022174 3:17793083-17793105 CTGTAAGCCCAGCACTTTGGGGG - Intronic
951528332 3:23675053-23675075 GTTTGAGCCCAGGAGTTTTGAGG - Intergenic
952768283 3:36974597-36974619 GCTTAAGCCCAGGAGTTTGAGGG - Intergenic
953678955 3:45025576-45025598 GTGGGAGCCCAGCAGGGTGGAGG - Intronic
953686126 3:45079686-45079708 GTGGCTGCCGAGGAGTCTGGTGG - Intergenic
954023845 3:47766306-47766328 CTGTAAACCCAGGACTTTGGGGG + Intronic
954311404 3:49771034-49771056 GTTTAAGCCCAGGAGTTAGAGGG + Intronic
954369706 3:50163735-50163757 GAGGAGGCCCAGGAGCTTTGAGG + Intronic
954436554 3:50499309-50499331 GTGGGAGCCCTGGAGACTGGTGG + Intronic
954553875 3:51503482-51503504 GAGGAAGCGCAGGAGTTGTGGGG - Intergenic
954861575 3:53695072-53695094 CTGGCAGCCAAGTAGTTTGGTGG - Intronic
955274996 3:57538934-57538956 GAGGAAGTCCAGGAGGTGGGGGG - Intronic
955919448 3:63940105-63940127 CTGGATTCCCAGGAGTATGGTGG - Intronic
956005185 3:64771145-64771167 CTGCAAGCCCAGGAGTTTGAGGG - Intergenic
956163033 3:66374625-66374647 CTGTAATCCCAGGATTTTGGGGG + Intronic
956759724 3:72429775-72429797 GCGTAAGCCCAGGAGTTCTGAGG + Intronic
957199099 3:77108984-77109006 ATGGGAGCCCAAGAGTGTGGAGG + Intronic
962038166 3:131676314-131676336 ATGTAATCCCAGGACTTTGGGGG - Intronic
962258286 3:133886981-133887003 GTGGAAGCCCAGGATGCAGGAGG + Intronic
962522248 3:136208282-136208304 GTGTAATCCCAGCATTTTGGGGG + Intergenic
963384864 3:144579498-144579520 GTGGAATCCCTGAAGTTTGTTGG - Intergenic
963812569 3:149793261-149793283 GTTTGAGCCCAGAAGTTTGGGGG + Intronic
963813902 3:149808757-149808779 GTGGAAGTCCAGGAGTCCAGTGG - Intronic
964859729 3:161187895-161187917 GCTCAAGCCCAGGAGTTTGGAGG - Intronic
965771619 3:172187875-172187897 CTGTAATCCCAGGACTTTGGGGG - Intronic
967360365 3:188623513-188623535 CTGTAATCCCAGGACTTTGGGGG - Intronic
967552159 3:190809290-190809312 GTGGAAGCGGAGGAATTTGGTGG + Intergenic
968244121 3:197124657-197124679 GTTTGAACCCAGGAGTTTGGGGG - Intronic
968467106 4:758288-758310 GAGAAAGACCTGGAGTTTGGCGG - Intronic
969430481 4:7150930-7150952 CTGCAAGCCAAGGAGTGTGGAGG - Intergenic
969518399 4:7661540-7661562 GTGGAAGCCCAAGACCTCGGTGG + Exonic
969565205 4:7973251-7973273 CTGTAATCCCAGCAGTTTGGGGG + Intronic
970436683 4:16042431-16042453 GTGGAAGACAAGGAGGTGGGAGG + Intronic
970913563 4:21307077-21307099 CTGTAATCCCAGGACTTTGGGGG - Intronic
971098620 4:23436657-23436679 GTAGAATCTCAGGAATTTGGGGG + Intergenic
972335317 4:38102620-38102642 CTGTAATCCCAGGACTTTGGAGG + Intronic
972730366 4:41788650-41788672 GTGGAACCCCAGGAGTGAGGTGG - Intergenic
973143966 4:46802240-46802262 GTAGAAGCCCAGAAGATTGTAGG + Intronic
973627456 4:52787345-52787367 GCTTGAGCCCAGGAGTTTGGAGG - Intergenic
973759985 4:54106863-54106885 TGGGATGCCCAGGATTTTGGAGG - Intronic
974213873 4:58818780-58818802 CTGTAATCCCAGCAGTTTGGGGG + Intergenic
974492473 4:62585029-62585051 CTGTAATCCCAGCAGTTTGGAGG - Intergenic
975341757 4:73250342-73250364 CTGCAAGCCCAGCACTTTGGGGG + Intronic
975585274 4:75942053-75942075 TTGTAATCCCAGCAGTTTGGGGG + Intronic
975950899 4:79769817-79769839 GTGGAAGCTATGGGGTTTGGGGG - Intergenic
976634872 4:87277521-87277543 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
977429387 4:96912295-96912317 CTGTAATCCCAGGACTTTGGGGG + Intergenic
977666293 4:99650144-99650166 GTGGCAGCTGAGGAGTTGGGGGG + Exonic
978323116 4:107520088-107520110 GTGTGAACCCAGGAGATTGGAGG + Intergenic
978827432 4:113042243-113042265 GTGTAAGCCCTGGAGTCTGAAGG - Intronic
979092548 4:116503888-116503910 GTGGAATAAAAGGAGTTTGGAGG + Intergenic
979132638 4:117067378-117067400 CTGTAAGCCCAGCACTTTGGGGG + Intergenic
980524109 4:133967212-133967234 ATGTAATCCCAGCAGTTTGGAGG + Intergenic
981144035 4:141304275-141304297 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
981329707 4:143494608-143494630 GTTTAAGCCCAGGAGTTCAGGGG + Intergenic
981567276 4:146114401-146114423 GTGTAAGTCCTGGAGTTTGAAGG + Intergenic
982751042 4:159162311-159162333 GTTTGAGCCCAGGAGTTTGGGGG + Intronic
983283188 4:165706932-165706954 CTGTAATCCCAGCAGTTTGGGGG + Intergenic
983790084 4:171784809-171784831 CTGTAATCCCAGGACTTTGGGGG - Intergenic
985238896 4:187907813-187907835 CTGGAATCCCAGCACTTTGGAGG - Intergenic
985285935 4:188336516-188336538 CTGGAATCCCAGCACTTTGGGGG - Intergenic
987613913 5:20247507-20247529 CTGGAATCCCAGCACTTTGGAGG + Intronic
987756626 5:22105348-22105370 CTGTAATCCCAGGACTTTGGGGG - Intronic
987759032 5:22134900-22134922 CTGGAAGCTCAGCAGCTTGGTGG - Intronic
988006361 5:25416726-25416748 CTGTAATCCCAGGACTTTGGAGG - Intergenic
988137364 5:27191631-27191653 TTGTAATCCCAGGACTTTGGGGG + Intergenic
991479827 5:67065937-67065959 GTGGCAACCCAGAAGTTTAGAGG + Intronic
991893742 5:71368347-71368369 CTGGAAGCTCAGCAGCTTGGTGG - Intergenic
992226300 5:74622365-74622387 GGGGAATCCCAGGAATTAGGAGG - Intergenic
993957993 5:94261043-94261065 CTGTAATCCCAGGACTTTGGAGG + Intronic
994024833 5:95070439-95070461 GTGGAAGCTGAGAGGTTTGGAGG - Intronic
996437444 5:123450961-123450983 GGTGAGACCCAGGAGTTTGGTGG - Intergenic
997494793 5:134313878-134313900 GTGTAATCCCAGCACTTTGGGGG + Intronic
997613335 5:135230212-135230234 CTGGAAGCCCTGGAGTTCTGAGG - Intronic
998030521 5:138863501-138863523 CTGGAATCCCAGCACTTTGGGGG - Intronic
998162236 5:139820155-139820177 GGGACAGCCCAAGAGTTTGGTGG + Intronic
998353656 5:141516864-141516886 GAGGAAGCCAAGGAGTTGGTTGG - Exonic
998427877 5:142045160-142045182 CTGGAGACCCAGGATTTTGGGGG - Intergenic
998567078 5:143225444-143225466 CTGGAATCCCAGCACTTTGGGGG - Exonic
998767449 5:145503630-145503652 GTGTGACCCCAGGAGTTTGCTGG + Intronic
998928758 5:147157130-147157152 GAGGAAGCCCAGCTGTTTGAGGG + Intergenic
999436525 5:151567660-151567682 GTGGAAGTCCATGAGCTTTGTGG + Exonic
1000344559 5:160303998-160304020 GTGGAGGCCCTGGAGATTGATGG + Intronic
1000618628 5:163458471-163458493 CTGTAATCCCAGGACTTTGGAGG + Intronic
1001407514 5:171486306-171486328 GTGGAAGCTGAGGAGGTGGGGGG + Intergenic
1002112135 5:176924058-176924080 GTGTAATCCCAGCACTTTGGGGG + Intronic
1002179593 5:177424137-177424159 GTGGAGGCCGTGGAGGTTGGGGG - Intronic
1002289550 5:178190374-178190396 CTGTAATCCCAGCAGTTTGGAGG + Intergenic
1002563999 5:180099975-180099997 GCCAAACCCCAGGAGTTTGGGGG - Intergenic
1002772665 6:302917-302939 GTGGAGGAACAGGAGCTTGGTGG + Intronic
1004365194 6:15006866-15006888 GTTTGAGCCCAGGAGTTTGAGGG + Intergenic
1004621483 6:17334448-17334470 CTGTAATCCCAGGATTTTGGAGG + Intergenic
1005289047 6:24360248-24360270 GCGGAAGAACAGGGGTTTGGAGG + Intergenic
1005959306 6:30684677-30684699 GGGGATCCCCAGGAGGTTGGGGG + Exonic
1006031398 6:31179234-31179256 GTGGAACTGCAGGAGTATGGAGG - Intronic
1006295733 6:33169268-33169290 TGGGGAGCCCGGGAGTTTGGGGG - Intronic
1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG + Intronic
1007699763 6:43759687-43759709 TGGGCAGCCCAGGAGTCTGGGGG + Intergenic
1008567344 6:52782567-52782589 GTGAAAGTTCAGGAATTTGGGGG + Intergenic
1008570773 6:52814894-52814916 GTGAAAGTTCAGGAATTTGGGGG + Intergenic
1008573682 6:52838977-52838999 GTGAAAGATCAGGAATTTGGGGG + Intronic
1010210109 6:73355965-73355987 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
1012419618 6:99049683-99049705 GTGCTAGCACAGGATTTTGGGGG + Intergenic
1012445025 6:99298325-99298347 CTGGAATCCCAGCACTTTGGAGG - Intronic
1012560554 6:100575130-100575152 ATGGAAGGCCATGAGGTTGGAGG + Intronic
1013130766 6:107230495-107230517 TTTGAAGCCCCTGAGTTTGGGGG - Intronic
1015396472 6:132740100-132740122 GTGTAATCCCAGCACTTTGGAGG - Intergenic
1015595188 6:134859551-134859573 GTGGAGGGGCAGGAGTGTGGGGG + Intergenic
1019215925 6:170443755-170443777 GTGGAGGCACAGAAGTCTGGAGG - Intergenic
1019939975 7:4282168-4282190 CTGGAATCCCAGCACTTTGGAGG + Intergenic
1019965475 7:4495353-4495375 CTGCAAGCCCAGCAGTTGGGAGG + Intergenic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1020745962 7:12078009-12078031 CTGTAATCCCAGGACTTTGGGGG - Intergenic
1021802845 7:24325181-24325203 GTGGAAGCCCTGGAGTCAGAAGG - Intergenic
1023369338 7:39497451-39497473 CTGTAATCCCAGCAGTTTGGGGG - Intergenic
1025806563 7:64838771-64838793 ATGGAAGCCAAGGAGTTAGGTGG + Intergenic
1026661642 7:72308104-72308126 CTGTAATCCCAGGACTTTGGGGG + Intronic
1026975154 7:74493366-74493388 CTGTAAGCCCAGCACTTTGGGGG - Intronic
1028123851 7:87088689-87088711 GGGGAAGGACAGGAGTTTGGGGG - Intergenic
1028848878 7:95513972-95513994 GTGGAGGTCCAGGAGTTGTGAGG - Intronic
1029550413 7:101234387-101234409 GAGGAAGCCCAGGAGGATGGCGG + Exonic
1029787712 7:102809435-102809457 CTGTAATCCCAGCAGTTTGGAGG + Intergenic
1030072118 7:105706865-105706887 GTTGATGCCCAAGAGTTTAGTGG - Intronic
1030485385 7:110159690-110159712 ATGGAATCCCAGCACTTTGGAGG + Intergenic
1031555750 7:123174056-123174078 GTGGAATACCAGCATTTTGGAGG - Intronic
1032110117 7:129068796-129068818 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1033004985 7:137551834-137551856 GTTGAAGCCCCAGAGTATGGAGG + Intronic
1034115595 7:148580926-148580948 GCTGGAGCCCAGGAGTTTGAAGG + Intergenic
1034240364 7:149606023-149606045 GTGGAGGAGCTGGAGTTTGGGGG - Intergenic
1034432383 7:151047656-151047678 GTGAACTCCCAGGACTTTGGTGG - Intronic
1034627553 7:152505023-152505045 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1034734088 7:153412765-153412787 ATGGAAGCCAAGGAGTTAGCTGG + Intergenic
1034866654 7:154647991-154648013 GTGTAATCCCAGCACTTTGGGGG + Intronic
1035882320 8:3256068-3256090 CTGTAATCCCAGGACTTTGGGGG + Intronic
1036413950 8:8529383-8529405 GCTGGAGCCCAGGAGTTTGAGGG - Intergenic
1036710729 8:11076917-11076939 GTGTAATCCCAGCACTTTGGAGG + Intronic
1037178181 8:15971835-15971857 CTGTAAACCCAGCAGTTTGGGGG - Intergenic
1038965263 8:32564985-32565007 GCTGGAGCCCAGGAGTTTGAGGG + Intronic
1039528248 8:38235462-38235484 CTGTAATCCCAGCAGTTTGGGGG + Intronic
1040895806 8:52366973-52366995 CTGTAATCCCAGGACTTTGGGGG + Intronic
1041791427 8:61700110-61700132 GTGGAGGCCCAGGGGATTGAGGG + Intronic
1043519079 8:81025415-81025437 GTGGAATCTGAGGAGTTTGATGG - Intronic
1044212318 8:89564018-89564040 GGGGAAGGCCTGCAGTTTGGAGG + Intergenic
1047924937 8:129673611-129673633 GTGGAGGGCCAGGTGTGTGGTGG - Intergenic
1049023180 8:139971351-139971373 GTGCCAGGCCAGGAGGTTGGGGG - Intronic
1049306586 8:141907244-141907266 GATGAAGCCCAGGCGTCTGGAGG + Intergenic
1049803761 8:144529899-144529921 GTGACTGCTCAGGAGTTTGGGGG - Exonic
1050708690 9:8434236-8434258 GTGTAATCCCAGCATTTTGGAGG - Intronic
1050943197 9:11485868-11485890 GTTGAAACCCAGGACTCTGGTGG + Intergenic
1052735759 9:32340760-32340782 GTGGAAGCCCAGGAGTTCTGTGG + Intergenic
1053139889 9:35675863-35675885 CTGGAAGCCCAGGAGTTCCAGGG - Exonic
1054982276 9:71220854-71220876 GTGGGAGCCCAGGAGGCTGTTGG - Intronic
1055080169 9:72260991-72261013 GTAGAAGCACAGTATTTTGGGGG + Intergenic
1056142762 9:83699423-83699445 GGTTGAGCCCAGGAGTTTGGAGG - Intronic
1056169223 9:83966509-83966531 GTGTAACCCCAGCATTTTGGGGG - Intergenic
1056552063 9:87660182-87660204 GTGGAGGCCCAGGAGATGGGAGG + Intronic
1056896267 9:90553465-90553487 GAGGAAGCCCACGTGTGTGGGGG - Intergenic
1058494612 9:105542711-105542733 CTGTAATCCCAGGATTTTGGGGG - Intronic
1061057551 9:128232537-128232559 ATGGAGGCCAAGGAGTTTTGAGG - Intronic
1062329576 9:136032068-136032090 GTGGGATCCCAGGAGTCTGGCGG - Intronic
1062389824 9:136329535-136329557 GTGGATGCCCTGGAGGTGGGCGG + Intronic
1062605569 9:137347175-137347197 GTGGAAGTCCAGAAGTCCGGTGG + Intronic
1186015035 X:5181830-5181852 GTGTAATCCCAGCACTTTGGCGG + Intergenic
1187166686 X:16810936-16810958 CTGGAAACCCAGCAATTTGGGGG - Intronic
1187179380 X:16929314-16929336 CTGTAATCCCAGGACTTTGGGGG + Intergenic
1187377053 X:18764475-18764497 GAGGAAGCCCAGGCCTATGGAGG + Intronic
1187473025 X:19586165-19586187 CTGTGAGCCCAGAAGTTTGGTGG + Intronic
1188546259 X:31310810-31310832 GTGTAATCCCAGCACTTTGGGGG - Intronic
1189259905 X:39670859-39670881 GCAGATGCCCAGGAGTTAGGTGG - Intergenic
1189279670 X:39812324-39812346 CTGTAATCCCAGGACTTTGGGGG - Intergenic
1189383214 X:40516614-40516636 GTGTAATCCCAGCACTTTGGGGG - Intergenic
1190060228 X:47206104-47206126 GTGGATGCCCGTGAGTTTGGAGG + Exonic
1190129661 X:47735345-47735367 GTGTAAGCCCTGGAGTCTGAAGG + Intergenic
1192967367 X:76193221-76193243 TTGTAATCCCAGCAGTTTGGGGG + Intergenic
1194043341 X:88970652-88970674 GTGCAAGCCCAAAAGTTAGGTGG - Intergenic
1195589456 X:106607605-106607627 GTAGAATCCCAGGAGTTTACTGG + Intergenic
1196654955 X:118208353-118208375 GTGGAACCCCATGAGGTAGGGGG - Intergenic
1197784525 X:130187010-130187032 GTGGGAGCCCAGCCCTTTGGGGG - Intergenic
1200114549 X:153764476-153764498 GTGGTAGCCCTGGGGTTAGGAGG + Intronic
1200169999 X:154065521-154065543 GTGGTGGCCCAGCACTTTGGGGG + Intronic
1200396570 X:155993212-155993234 CTGGAATCCCAGCACTTTGGGGG + Intergenic
1200445788 Y:3258883-3258905 TTGTAATCCCAGGATTTTGGGGG + Intergenic
1201742418 Y:17337993-17338015 CTGTAATCCCAGCAGTTTGGGGG + Intergenic
1201770125 Y:17611085-17611107 ACGGAAGCCAAGGAGTTAGGTGG - Intergenic
1201831429 Y:18294902-18294924 ACGGAAGCCAAGGAGTTAGGTGG + Intergenic
1201917240 Y:19195512-19195534 TTGGAATCCCAGCACTTTGGAGG + Intergenic