ID: 1165221423

View in Genome Browser
Species Human (GRCh38)
Location 19:34319858-34319880
Sequence TTTAGGTTGTGGGTTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165221423_1165221433 12 Left 1165221423 19:34319858-34319880 CCAACAGCAACCCACAACCTAAA 0: 1
1: 0
2: 1
3: 20
4: 171
Right 1165221433 19:34319893-34319915 TCTTGTTTTCACAGGTGTTGGGG 0: 1
1: 0
2: 1
3: 50
4: 1073
1165221423_1165221431 10 Left 1165221423 19:34319858-34319880 CCAACAGCAACCCACAACCTAAA 0: 1
1: 0
2: 1
3: 20
4: 171
Right 1165221431 19:34319891-34319913 TGTCTTGTTTTCACAGGTGTTGG 0: 1
1: 0
2: 2
3: 31
4: 325
1165221423_1165221432 11 Left 1165221423 19:34319858-34319880 CCAACAGCAACCCACAACCTAAA 0: 1
1: 0
2: 1
3: 20
4: 171
Right 1165221432 19:34319892-34319914 GTCTTGTTTTCACAGGTGTTGGG 0: 1
1: 0
2: 0
3: 23
4: 220
1165221423_1165221430 4 Left 1165221423 19:34319858-34319880 CCAACAGCAACCCACAACCTAAA 0: 1
1: 0
2: 1
3: 20
4: 171
Right 1165221430 19:34319885-34319907 CCTGGCTGTCTTGTTTTCACAGG 0: 1
1: 0
2: 0
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165221423 Original CRISPR TTTAGGTTGTGGGTTGCTGT TGG (reversed) Intronic
903841300 1:26243312-26243334 TCTTGGTTGAGGGTTGCTGCTGG + Intronic
906690231 1:47787701-47787723 TTTAGGCTGGGTTTTGCTGTGGG + Intronic
908525871 1:64986869-64986891 TTTGGGTGGGGGGTGGCTGTTGG - Intergenic
908578442 1:65487406-65487428 CTTAGATTCTGGGTTGTTGTAGG + Intronic
911178098 1:94837472-94837494 TTTAGGTTTTTGGTTTCTGTGGG + Intronic
911374973 1:97041427-97041449 TTTATGTTGTGTGTTTTTGTGGG + Intergenic
917992277 1:180393739-180393761 TTTAGTTAATGGGTTGCTTTTGG - Intronic
920144817 1:203850648-203850670 TTTTGGCTGGGGGTTCCTGTAGG - Exonic
921820361 1:219609968-219609990 TTTTGGCTGGGGGTTCCTGTAGG + Intergenic
924137666 1:240987106-240987128 TTTAGTTTGTGGATAGCTGTAGG - Intronic
1063729575 10:8680632-8680654 TTTAGGTGGTGGGTAGTTGGAGG - Intergenic
1064711379 10:18129765-18129787 TTTATGTTGTGAGTTGCAGAGGG - Intergenic
1065498800 10:26357604-26357626 TTTGCGTTGTGCATTGCTGTGGG - Intergenic
1066143771 10:32535168-32535190 TTTATGTTCTGGGTTGTTGCTGG + Intronic
1067186559 10:44033543-44033565 TTTAGGGTGGTGGTTGCTGAAGG + Intergenic
1067676864 10:48388477-48388499 TCTAGGCTGGTGGTTGCTGTGGG + Intronic
1069282315 10:66670200-66670222 TTTATGTTGTGGTAGGCTGTTGG - Intronic
1069360152 10:67632904-67632926 CTTAACTTGTGGGGTGCTGTGGG - Intronic
1070000181 10:72370475-72370497 TTTGGGTTTTGTCTTGCTGTGGG - Intronic
1071461331 10:85899708-85899730 TTTAGGTTTCTGCTTGCTGTGGG - Intronic
1072832472 10:98673572-98673594 TTGAGTTTGTGTGTGGCTGTGGG - Intronic
1073610985 10:104942818-104942840 TTTAGTTTGAGGTTTGCTGTAGG - Intronic
1074398745 10:113123548-113123570 TGTAGGTTATGGGATGATGTGGG + Intronic
1076992342 11:282040-282062 CATAGGTTGTGGGTGGCTGACGG - Intronic
1078566747 11:12421311-12421333 TTTAGGTTGTGGGGCTCTGGTGG + Intronic
1079752096 11:24212623-24212645 TTTAGCTTGTGGAGTTCTGTGGG - Intergenic
1080220888 11:29902073-29902095 CTGAGGTTGAGAGTTGCTGTTGG - Intergenic
1080866672 11:36201440-36201462 TTTTTGTTGTGGGTTTTTGTGGG + Intronic
1082105834 11:48220505-48220527 TTTAGGTTGCAGGTTGTGGTAGG + Intergenic
1086959395 11:92967319-92967341 TATGGGTAGTGGGTTGCTGGTGG - Intergenic
1087509512 11:99073144-99073166 TTTAGGTTGTTGATAGCTTTTGG + Intronic
1091536226 12:1412573-1412595 TTTAGGATGGAGGTTGTTGTGGG + Intronic
1091755682 12:3049953-3049975 TTTAGGAAGTGAGTTTCTGTAGG + Intergenic
1098156884 12:67608625-67608647 TTTGGGCTGTGGGTTGGTTTTGG + Intergenic
1098725182 12:73955793-73955815 TTTAGGTTGAGGTTAGCTGATGG - Intergenic
1101063393 12:100994989-100995011 TTTTTGTTGTGGGGAGCTGTTGG - Intronic
1107323656 13:39216251-39216273 ATTAGGATGTGGGTGCCTGTGGG + Intergenic
1109751397 13:66697855-66697877 TTTAGGTTGTTTGTAGCTTTTGG - Intronic
1109968721 13:69737402-69737424 TTTAGCTTGTGGGGTTCCGTGGG - Intronic
1112523838 13:100123782-100123804 TTTAGGCAGTGGGATGATGTGGG + Intronic
1114829283 14:26119981-26120003 TTTAGGTTTTGGGATTCTGTGGG + Intergenic
1117600676 14:57371271-57371293 TTTTGGTTGTGGTTTTCTGTAGG - Intergenic
1117682432 14:58218189-58218211 TTGAAGTTGTGGAATGCTGTAGG + Intronic
1118350264 14:64968660-64968682 TCTAGGTTATGGGCTTCTGTGGG + Intronic
1119499537 14:75112493-75112515 TTTAGGTGGTAGGTTGGAGTTGG - Intronic
1119631844 14:76238899-76238921 TCTAGGTGGTGTGCTGCTGTTGG + Intronic
1119666701 14:76490018-76490040 TTTCTGATGTGGGGTGCTGTGGG - Intronic
1120774581 14:88419904-88419926 TTAAGGGTGTGGGTCACTGTGGG - Intronic
1125543642 15:40487263-40487285 TTTTAGTTTTGGGTTGTTGTTGG - Intergenic
1126784193 15:52163398-52163420 CTTAGCTTGTGAGGTGCTGTGGG - Intronic
1127988259 15:64092187-64092209 TCTAGGTAGTGGGATGCAGTTGG - Intronic
1128330091 15:66750082-66750104 CTTACCTTGTGGGCTGCTGTGGG + Intronic
1129881677 15:79010818-79010840 TTTCAGTTTTGGGTTGCTGGTGG + Intronic
1133816878 16:9204232-9204254 TTTAGGCTGTTGGTTTATGTAGG + Intergenic
1134745532 16:16585266-16585288 TTCAAGTTGTGGGCTGCTGTGGG + Intergenic
1134999940 16:18768478-18768500 TTTAAGTTGTGGGCTGCTGTGGG - Intergenic
1138550643 16:57746253-57746275 TTTAGGTTCTAGGTTGCTATTGG + Intronic
1138596893 16:58033949-58033971 CTTCGGGTGTGGGCTGCTGTGGG - Intronic
1138782299 16:59803662-59803684 TATTGGTTGTGGGTTGCCCTTGG + Intergenic
1140337734 16:74125349-74125371 TTTATATTATGGGTTGCTTTTGG - Intergenic
1142113201 16:88342884-88342906 TTTGGGTGGTGGGTCCCTGTGGG + Intergenic
1143271528 17:5679030-5679052 TTTAGGTTTTGAATTGATGTTGG + Intergenic
1149445331 17:56708780-56708802 ATTAGGATGTGGATTGCTTTGGG - Intergenic
1151951058 17:77354402-77354424 CTTTGGTTGTGTTTTGCTGTGGG + Intronic
1151951814 17:77358685-77358707 TTTATTTTGTGGGTTGGTTTTGG - Intronic
1152817108 17:82414569-82414591 TTTCTGTTGTGTGTTGTTGTGGG - Intronic
1152904432 17:82962561-82962583 TTTAGGGTGGAGGTTCCTGTGGG + Intronic
1156077539 18:33299041-33299063 TTTAAATTGTAGGTTGCTTTGGG - Intronic
1157974287 18:52308717-52308739 TTTTGGTTATGGATTACTGTTGG + Intergenic
1162838843 19:13340751-13340773 GTTCTGTTGTGGGTTGCAGTGGG + Intronic
1163298203 19:16426109-16426131 TCAAGGTTGTGGGTTCCTGTGGG - Intronic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
1165559413 19:36666549-36666571 TTTGGGCTGTGTGTTACTGTTGG - Intronic
927040358 2:19223879-19223901 TTTTTGTTATGGGTTGTTGTAGG + Intergenic
928128262 2:28630754-28630776 TTTAGGGAGTGGCTTGCTCTTGG - Intronic
930764914 2:55075514-55075536 TTTAGTTTGTAGATTGCTTTTGG - Intronic
931542121 2:63340755-63340777 TTTGAGTTCTGGGTTGTTGTTGG + Intronic
935408215 2:102731980-102732002 ATTAGGTTAAGGGTTCCTGTAGG + Intronic
937751787 2:125484295-125484317 TTGAGTTTGTAGGTTGCTTTTGG + Intergenic
937798575 2:126054547-126054569 TTTAATTTGTGGATTGCTTTTGG + Intergenic
938216162 2:129518143-129518165 TTGAGTTTGTAGGTTGCTTTTGG + Intergenic
939581284 2:143949865-143949887 TTTAGTTTGTGTGTTGTTATAGG - Intronic
943381551 2:187156060-187156082 ATTAGGTGGTGGGTTTGTGTTGG - Intergenic
947964364 2:234267155-234267177 ATGAGCTTGTGGGTTGCTGGAGG + Intergenic
947996874 2:234535200-234535222 TTTAGGCTGTAGGTTGGTGCTGG - Intergenic
1170538749 20:17367535-17367557 TTTAGGCTGTGGGGTGAAGTTGG - Intronic
1171209367 20:23304879-23304901 TTGAGAATGTGGGATGCTGTTGG - Intergenic
1171329600 20:24325908-24325930 CATTGGTTGTGGGTTGCTATAGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172382148 20:34503821-34503843 TTTTGTTTGTTGGTTGCTTTTGG + Intronic
1172515144 20:35528183-35528205 ATGTGGCTGTGGGTTGCTGTGGG - Intronic
1176407311 21:6428164-6428186 GTGAGAGTGTGGGTTGCTGTGGG + Intergenic
1179682655 21:43035230-43035252 ATGAGAGTGTGGGTTGCTGTGGG - Intergenic
1179682819 21:43036567-43036589 GTGAGAGTGTGGGTTGCTGTGGG + Intergenic
1184743383 22:46442237-46442259 TCTGGGGTGTGGGTTGCTGATGG + Intronic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
951400748 3:22229355-22229377 CTTAGGTTGTGGTTCACTGTTGG + Intronic
952410289 3:33042863-33042885 TTTAGGTGCTTGGTGGCTGTAGG - Intronic
958264182 3:91418396-91418418 TGTTGGTTGTGGGTTTCTCTTGG - Intergenic
959409616 3:106004405-106004427 TTTAGGTGGTGGGTTGTTTTTGG - Intergenic
959615939 3:108347427-108347449 TGTATTTTGTGGGCTGCTGTGGG + Intronic
959873645 3:111357182-111357204 ATTAGGTTGGTGGTTGCTGAAGG - Intronic
963664144 3:148160932-148160954 ATTAGGTTGTTGGTTGCTGAAGG - Intergenic
964106508 3:153046276-153046298 TATAGGCTTTGGGTCGCTGTTGG - Intergenic
965635889 3:170780080-170780102 GATATGTTCTGGGTTGCTGTAGG + Intronic
969062946 4:4453342-4453364 TTGAGGGTGGGGGTTGCTGAAGG - Intronic
969451310 4:7275164-7275186 TCTAGTTTGTGGGTTGTTGGAGG + Intronic
969840046 4:9874648-9874670 TTTTGCTTGTGAGTTGATGTAGG + Intronic
970982644 4:22118989-22119011 TTTAGTTTATGTGTTGCTGAAGG - Intergenic
971280245 4:25237357-25237379 TTTTGGCAGTGGGTGGCTGTAGG + Intronic
971892723 4:32545077-32545099 TTAAGGTTTTGGGTGACTGTTGG + Intergenic
972677954 4:41278261-41278283 CTGAGGTTGTGTGTTGCTGAGGG - Intergenic
973537987 4:51904072-51904094 TTTAGGTATTTGGTTGCTGTGGG + Intronic
974388805 4:61237322-61237344 TTTTGGTCCTGGGTTTCTGTTGG + Intronic
976078087 4:81321698-81321720 TTTAGCTTGTGGGGTTCTTTGGG - Intergenic
976242928 4:82977319-82977341 TTTAGGAAGTGGGCTGCAGTTGG - Intronic
978635438 4:110799242-110799264 TTGAGGGTGTGGGCTGCTGAAGG - Intergenic
979687349 4:123525508-123525530 TTTAGCTTGTAAGTTGCTTTGGG - Intergenic
979847169 4:125530152-125530174 GTAAGGTGGTGGGATGCTGTCGG - Intergenic
985471551 5:50269-50291 GTTAGGTTTTGGGTTGGGGTTGG - Intergenic
985616361 5:924474-924496 TTTGGGTTTTGGGTGGCAGTGGG + Intergenic
987077610 5:14398534-14398556 TTTCGGTGGTGGGATGCTGCAGG + Intronic
988051677 5:26039212-26039234 ATTAAGTTCTGGATTGCTGTAGG + Intergenic
989170554 5:38467724-38467746 TCTGGGGTGGGGGTTGCTGTCGG - Intergenic
991051053 5:62273171-62273193 TTCAGGTTATGGGGTGCTGTGGG - Intergenic
992767726 5:80016761-80016783 TTGAGGTTTTGGGTAGCTGCGGG - Intronic
993020461 5:82584939-82584961 TTTAGCTTGTGGGGTTCCGTGGG + Intergenic
994298759 5:98121544-98121566 TTTAGCTTGTGGGGGTCTGTGGG - Intergenic
995920773 5:117308417-117308439 TTTAGCTTATGGGTTGCAGTTGG + Intergenic
997183405 5:131857423-131857445 TTTAGCTTTTGGGTAACTGTAGG + Intronic
997377052 5:133404818-133404840 TCTTGGTTGTGGCTGGCTGTGGG - Intronic
998386793 5:141761879-141761901 TTTGGGTGCTGGGTTCCTGTAGG - Intergenic
998535398 5:142925737-142925759 TTGAGATTGTGTGTTCCTGTGGG + Intronic
1000590030 5:163146949-163146971 CTTAGCTTGTTGGTTTCTGTTGG - Intergenic
1001204258 5:169747184-169747206 GTTAGTTGGTGGGTTTCTGTTGG + Intronic
1004426698 6:15511626-15511648 TTTGTGTTGTGGGCTGCTGTGGG + Intronic
1004858104 6:19771954-19771976 GTTAGGTTGGTGGTTGCTGAAGG - Intergenic
1005302767 6:24486986-24487008 TTCAGGCTGTGGGTGGGTGTGGG - Intronic
1007303297 6:40884868-40884890 TTCAGGTTGTGGGTTTCTCCAGG - Intergenic
1008540591 6:52543570-52543592 TTTAGGTTGTGAGTTATTTTTGG + Intronic
1009565277 6:65304594-65304616 TTTTGGCTGGGGGTTCCTGTAGG - Intronic
1009584107 6:65574225-65574247 TGTAGCTAGTGGGTTGCTCTTGG - Intronic
1009589424 6:65647088-65647110 TTTAATTTGTAGGTTGCTTTTGG - Intronic
1009692347 6:67052081-67052103 TTTTGTTTGTTGTTTGCTGTTGG + Intergenic
1010292860 6:74159696-74159718 TTGAATTTGTGGGTTGCTTTGGG - Intergenic
1010386615 6:75287700-75287722 TTTATGTTGGGTGCTGCTGTAGG + Intergenic
1014470972 6:121814405-121814427 TTTAGCTTGTGGGCTGTAGTTGG + Intergenic
1015223681 6:130832363-130832385 TTTAGGATGTGCGTTGCTGAAGG - Intronic
1017756049 6:157530464-157530486 TTTGGATATTGGGTTGCTGTTGG - Intronic
1018304291 6:162438744-162438766 ATTACGTTGTGTGTTGGTGTGGG + Intronic
1022261180 7:28706390-28706412 TTTAGGATGTAGGTATCTGTGGG + Intronic
1022600455 7:31753595-31753617 TTTAGGTTGTGGCATGTCGTGGG - Intronic
1026325252 7:69303627-69303649 TTTAGGTAATGTGTTCCTGTGGG - Intergenic
1028057883 7:86270985-86271007 TGTAGGGTGTGGGTAGGTGTTGG - Intergenic
1030491165 7:110236392-110236414 TTTAGGTCCTGGATTTCTGTTGG - Intergenic
1033274068 7:139957874-139957896 TGTAAGTGGTGGGTTGCTGAAGG - Intronic
1033519165 7:142142896-142142918 TCTAGGTTGAATGTTGCTGTAGG + Intronic
1036190446 8:6665185-6665207 TTTAGGATGTGGCTGGGTGTAGG - Intergenic
1036279691 8:7390071-7390093 TGTTGGTTTTGGGTTGCTGGAGG + Intergenic
1036713836 8:11101790-11101812 TTTAGTTTGTGGGTTTATCTCGG + Intronic
1038276711 8:26127408-26127430 TTTAGGTTGAGGGGAGCTGGAGG + Intergenic
1038670210 8:29577056-29577078 TTTAGCTTCTGATTTGCTGTTGG + Intergenic
1039382242 8:37096980-37097002 TTTAGGGTGGTGGTTGCTGAAGG - Intergenic
1039702133 8:39972753-39972775 TTCAGGATGTTGGTTGCTGAAGG - Intronic
1043092527 8:75924041-75924063 TTTAGCTTGTGAGTTTCTGTGGG - Intergenic
1043586423 8:81775171-81775193 TTTTGGTTGAGGTTTGCTTTCGG - Intergenic
1050206263 9:3199544-3199566 TTTAGGTTTTGTCTTGCTTTGGG + Intergenic
1050395271 9:5188675-5188697 TTTAGCTTGTGGGGTTCCGTGGG + Intergenic
1053000126 9:34573389-34573411 TTCAGGGTTTGGGTTGCTGTGGG + Intronic
1053575383 9:39354338-39354360 CTTAGCTTGTGGGGTTCTGTGGG - Intergenic
1053839890 9:42182272-42182294 CTTAGCTTGTGGGGTTCTGTGGG - Intergenic
1053883279 9:42617073-42617095 TTTGGGGTGTGGGTTTCTTTTGG + Intergenic
1053889390 9:42677226-42677248 TTTGGGGTGTGGGTTTCTTTTGG - Intergenic
1054096944 9:60913021-60913043 CTTAGCTTGTGGGGTTCTGTGGG - Intergenic
1054118349 9:61188647-61188669 CTTAGCTTGTGGGGTTCTGTGGG - Intergenic
1054589406 9:66993917-66993939 CTTAGCTTGTGGGGTTCTGTGGG + Intergenic
1056316145 9:85392281-85392303 TCTAGCTGGTTGGTTGCTGTGGG + Intergenic
1057720651 9:97529159-97529181 TTGTGGTTGGGGGTCGCTGTAGG + Intronic
1058883207 9:109303329-109303351 TATAAGTTGTGGGTTTCTTTTGG + Intronic
1185546762 X:952233-952255 TCAAGGGTGTGGGTTGCTGTTGG - Intergenic
1186217740 X:7317899-7317921 TTGAGGCTGTGAGTTTCTGTAGG + Intronic
1187655910 X:21473718-21473740 TTTAGGTTTTTTGTTGTTGTTGG + Intronic
1189019976 X:37325286-37325308 TTAAAGTTGTAGGTTGCTTTGGG - Intergenic
1194437109 X:93880488-93880510 GTTAGTTTAAGGGTTGCTGTAGG - Intergenic
1194991066 X:100547685-100547707 TTTTGGTTTTGGTTTGCTCTTGG - Intergenic
1201754232 Y:17469038-17469060 TTTAGGTTTTGGGTAGGTGTAGG + Intergenic
1201847320 Y:18436947-18436969 TTTAGGTTTTGGGTAGGTGTAGG - Intergenic
1202172582 Y:22066744-22066766 TTAGGGTTATGGGTTGCGGTAGG - Intergenic
1202218780 Y:22519627-22519649 TTAGGGTTATGGGTTGCGGTAGG + Intergenic
1202324406 Y:23676428-23676450 TTAGGGTTATGGGTTGCGGTAGG - Intergenic
1202336148 Y:23812978-23813000 TTTAGGTTTGGGGTAGATGTAGG + Intergenic
1202534618 Y:25857089-25857111 TTTAGGTTTGGGGTAGATGTAGG - Intergenic
1202546365 Y:25993626-25993648 TTAGGGTTATGGGTTGCGGTAGG + Intergenic