ID: 1165222718

View in Genome Browser
Species Human (GRCh38)
Location 19:34330285-34330307
Sequence CAGGCACCTCGCCATGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165222718_1165222724 9 Left 1165222718 19:34330285-34330307 CCTTCCACATGGCGAGGTGCCTG 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1165222724 19:34330317-34330339 GGTGCAGCTGCTGTTTGGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 279
1165222718_1165222725 13 Left 1165222718 19:34330285-34330307 CCTTCCACATGGCGAGGTGCCTG 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1165222725 19:34330321-34330343 CAGCTGCTGTTTGGCCAGGCTGG 0: 1
1: 0
2: 0
3: 28
4: 327
1165222718_1165222726 18 Left 1165222718 19:34330285-34330307 CCTTCCACATGGCGAGGTGCCTG 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1165222726 19:34330326-34330348 GCTGTTTGGCCAGGCTGGACTGG 0: 1
1: 1
2: 1
3: 35
4: 658
1165222718_1165222723 4 Left 1165222718 19:34330285-34330307 CCTTCCACATGGCGAGGTGCCTG 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1165222723 19:34330312-34330334 ACGGCGGTGCAGCTGCTGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165222718 Original CRISPR CAGGCACCTCGCCATGTGGA AGG (reversed) Exonic
902210646 1:14902057-14902079 CAGGCACCTAGCGAGGTGGGAGG + Intronic
906723047 1:48023220-48023242 CAAGGACCCCTCCATGTGGATGG - Intergenic
911853963 1:102853998-102854020 CAGCCACCCCGCCATGGGGCAGG + Intergenic
913485936 1:119332850-119332872 ACGGCCCCTCCCCATGTGGAGGG - Intergenic
913974658 1:143445650-143445672 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
914069049 1:144271266-144271288 CAGGCAGGTGGCCTTGTGGATGG + Intergenic
914110106 1:144695088-144695110 CAGGCAGGTGGCCTTGTGGATGG - Intergenic
916840872 1:168599299-168599321 AAGGGACCCTGCCATGTGGAAGG - Intergenic
1062969084 10:1632509-1632531 CATGCACCTGCCCATGTGGCTGG + Intronic
1063116591 10:3076177-3076199 AAAGCACATCTCCATGTGGACGG + Intronic
1064034130 10:11901655-11901677 CAGGAACCTGGGCATGTGAAGGG - Intergenic
1066568711 10:36748535-36748557 CAGCCACCTCCCCATGGGGCAGG + Intergenic
1070825905 10:79390611-79390633 CAGGCTCCTCGCCCAGTGGCAGG - Intronic
1071270874 10:84006232-84006254 CAGGCACCTCTCCTTCTGAAAGG - Intergenic
1072984905 10:100130855-100130877 CAGGCACCAAGCCATGAGGTGGG + Intergenic
1075612107 10:123862594-123862616 CAGGTACCTGGCCCTGTGGTTGG - Exonic
1075647338 10:124105057-124105079 CAGGCACTGCACCATGTGTAGGG + Intergenic
1075684254 10:124353094-124353116 CAGGAACCTCCCCATGTAGCTGG - Intergenic
1076119949 10:127927608-127927630 AAGGCTCCTCTCCATGAGGAGGG - Intronic
1076248542 10:128966545-128966567 CAGGCGCCTGGCCCTTTGGAAGG + Intergenic
1076351076 10:129815767-129815789 CAGGGACCCCTCCATGTGGCAGG - Intergenic
1076926818 10:133494922-133494944 CAGGCTCAACACCATGTGGAAGG + Intergenic
1077028675 11:453333-453355 CAGGCACCTCGCCAGGGTAAGGG - Intronic
1077601937 11:3580559-3580581 CAGGCCCCTCGCCAGGTGAGAGG + Intergenic
1085195517 11:74669563-74669585 CAGGTCTCTGGCCATGTGGACGG - Intergenic
1085754816 11:79193630-79193652 CAGGGACCCTGCTATGTGGATGG - Intronic
1085886936 11:80532882-80532904 CAGCCACCTCCCCATGGGGCAGG - Intergenic
1087447083 11:98268891-98268913 CAGGCTCAACACCATGTGGAAGG + Intergenic
1087977244 11:104565085-104565107 CAGCCACCTCCCCATGGGGAAGG - Intergenic
1088046540 11:105458426-105458448 CAGGCAGCTCTCCATGAAGAGGG + Intergenic
1089554422 11:119308221-119308243 CAGGCTCACCGCCATGAGGAAGG - Intergenic
1091140248 11:133228517-133228539 CGGGCACCTCGGCTTGTGGCTGG - Intronic
1091656565 12:2350777-2350799 CAGGCACCTCCCCATGTCGCAGG + Intronic
1092428083 12:8389902-8389924 CAGGCCCCTCGCCAGGTGAGAGG + Intergenic
1103942463 12:124508522-124508544 CAGGCACCACGCCGAGGGGAGGG + Intronic
1105866227 13:24461891-24461913 CAGCCACCTCCCCATGGGGCAGG + Intronic
1106395617 13:29378530-29378552 CAGGCACCTCCCCATTAAGATGG + Intronic
1113088807 13:106595876-106595898 CAGGCACCAGGCCCAGTGGAAGG + Intergenic
1113488952 13:110677059-110677081 CAGTGACTTCGCCCTGTGGAAGG - Exonic
1119731768 14:76955848-76955870 CAGGGACCTCTGCAGGTGGATGG + Intergenic
1119866781 14:77981045-77981067 CAGGCACCTGCCCAGGTGAAAGG - Intergenic
1122609706 14:102973619-102973641 CAGCCACCATGCCCTGTGGACGG + Intronic
1129712246 15:77826289-77826311 CAGCCTCCTCGCCAGGGGGAGGG - Intergenic
1129716630 15:77855876-77855898 CAGGGACCCAGGCATGTGGATGG - Intergenic
1132286210 15:100664707-100664729 GAAGCACCTGGCCATGTGGAAGG - Intergenic
1132303807 15:100794002-100794024 CAGGCCCAACACCATGTGGAAGG + Intergenic
1133789309 16:8997164-8997186 CAGGCATCCCACCATGTGAATGG + Intergenic
1143145365 17:4771910-4771932 CTGACACCTCACCATGTGTACGG + Exonic
1147578921 17:41617773-41617795 AAGGCACCTCGTTGTGTGGATGG - Intergenic
1147615557 17:41825334-41825356 AAGGAACCCCGCCATGTGGCAGG - Intronic
1148186563 17:45648841-45648863 CAGGCACAGCGCCATCTGCAGGG - Intergenic
1148214305 17:45826046-45826068 CAGGCACCCCGCCCTAAGGAGGG - Intronic
1151840626 17:76615050-76615072 CAGCCACCTCCCCATGGGGCAGG - Intergenic
1151842083 17:76626044-76626066 CAGGTACCTGTCCATGTGCAGGG + Exonic
1152071660 17:78137205-78137227 CAGGGACCTTGTCAGGTGGAGGG - Intronic
1152471130 17:80490643-80490665 CTGGCATCTCGCGATGTAGAAGG + Intergenic
1155337855 18:24783713-24783735 GAGGCAGCCTGCCATGTGGAAGG - Intergenic
1156900123 18:42290775-42290797 CAGGCACCTAGCCAAGTGGAAGG - Intergenic
1160178601 18:76615632-76615654 CAGGCACTTGGAAATGTGGAAGG + Intergenic
1160490417 18:79333081-79333103 CAGGCAGCCCTCCATGTGGGAGG - Intronic
1164386367 19:27773929-27773951 CTCGCACCTTGCCATGTCGAAGG + Intergenic
1164521502 19:28983432-28983454 CAGAAACCCCGCCATTTGGAAGG + Intergenic
1165222718 19:34330285-34330307 CAGGCACCTCGCCATGTGGAAGG - Exonic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
927783312 2:25955860-25955882 CAGGCTCTGCCCCATGTGGATGG + Intronic
934179362 2:89606625-89606647 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
934289648 2:91680888-91680910 CAGGCAGGTGGCCTTGTGGACGG + Intergenic
935233344 2:101118111-101118133 CAGTCCCCTCCCCATGTTGAAGG - Intronic
937290464 2:120778700-120778722 CACTTACCTGGCCATGTGGAAGG - Intronic
943134458 2:183892757-183892779 CAGCCACCTCCCCATGGGGCAGG + Intergenic
947012626 2:225582733-225582755 CAGGGACCTCCCCATGCTGACGG - Exonic
1173139396 20:40468926-40468948 CAGGCACCTTGGCATATGCAAGG + Intergenic
1173150746 20:40564888-40564910 CAGGCCCCTGGAGATGTGGATGG - Intergenic
1174425290 20:50427845-50427867 CAGGCACCCCACCATGTGACAGG + Intergenic
1175337271 20:58204870-58204892 CAGGCACCCTGCTCTGTGGATGG - Intergenic
1175764620 20:61583611-61583633 CAGGCACCCAGCCATGTGTGGGG - Intronic
1176524513 21:7855867-7855889 CTGGCAGCTGGCCATGTGGAGGG - Intergenic
1178658533 21:34485880-34485902 CTGGCAGCTGGCCATGTGGAGGG - Intergenic
1180958892 22:19753854-19753876 CAGCCAGCTCCCCATGTGGCTGG + Intergenic
1181977604 22:26742034-26742056 CAGGCAAATTGCCATGAGGAGGG - Intergenic
1183686445 22:39363744-39363766 CAGGCACCTGGACATGGGCAGGG + Intronic
1185280692 22:49968680-49968702 CAGGGACCTGGCCAGGAGGATGG - Intergenic
955067230 3:55543981-55544003 CAGCCACCTCATCATCTGGATGG - Intronic
956438841 3:69260497-69260519 CAGCCACCTCCCCATGGGGCAGG + Intronic
956967426 3:74478335-74478357 CACTCACCTGGCTATGTGGACGG - Intronic
960070071 3:113419644-113419666 CAGGCACATGGCCATGGGAATGG - Intronic
961281294 3:125767161-125767183 CAGGCCCCTCGCCAGGTGAGAGG - Intergenic
962875593 3:139533871-139533893 CAGGCGCCTCCCCCTGTGGCTGG - Intronic
967186771 3:186950557-186950579 CAGGCTCCAGGTCATGTGGATGG + Intronic
968505615 4:970030-970052 GCGGCCCCTCGTCATGTGGACGG - Intronic
969016386 4:4106903-4106925 CAGGCCCCTCGCCAGGTGAGAGG + Intergenic
969737571 4:9001421-9001443 CAAGCCCCTCGCCAGGTGAAAGG - Intergenic
969902577 4:10363364-10363386 CAGGCCCCTCTGCAGGTGGAAGG + Intergenic
972371681 4:38430134-38430156 CAGGCACCTTGGCATGAGCAGGG + Intergenic
974299231 4:60042355-60042377 CAGCCACCTCCCCATGGGGCAGG - Intergenic
974894876 4:67926834-67926856 CAGTCACCTCTCCATCTGCAAGG - Intronic
977641190 4:99359907-99359929 CAGCCACCTCCCCATGGGGCAGG + Intergenic
978514632 4:109557628-109557650 CAGCCACCTCCCCATGGGGCAGG + Intergenic
982120190 4:152135937-152135959 CAGACAACTGGCCAAGTGGAGGG - Intergenic
982758357 4:159251157-159251179 CAGCCACCTCCCCATGGGGCAGG + Intronic
984288892 4:177767342-177767364 CAGGCCCTTCGCCAATTGGATGG + Intronic
985620065 5:949464-949486 CAGCCACCTGTCCATATGGAAGG - Intergenic
987085523 5:14464060-14464082 CAGGCTCCCCACCATGTGTAGGG + Intronic
989012153 5:36885385-36885407 CAGGGGCCTGGCCAAGTGGATGG + Intronic
993703384 5:91143819-91143841 CAGGCACCCCTCCATATGAATGG - Intronic
994236669 5:97370634-97370656 CACCCACCTCGCAATGTGGCAGG - Intergenic
998253370 5:140567278-140567300 CTGGCACTGTGCCATGTGGACGG + Exonic
1004890469 6:20096131-20096153 CAGGCACCTGGCAATCTGGTTGG + Intergenic
1005013415 6:21356974-21356996 CAGGCACCTGGCCATGGTCAGGG - Intergenic
1007726410 6:43918625-43918647 CAGGCCCCTCACCATGAGGTAGG - Intergenic
1008399672 6:51050034-51050056 CTGGCACCTGCCCATGTGGAGGG + Intergenic
1008631107 6:53363592-53363614 CAGCCACCTCCCCATGGGGCAGG - Intergenic
1009418808 6:63443081-63443103 CAGCCACCTCCCCATGGGGCAGG - Intergenic
1010211794 6:73367993-73368015 CAGGCACCTTGGCTCGTGGATGG - Intergenic
1015938233 6:138424148-138424170 CAGGCCCCCGGCCCTGTGGATGG - Exonic
1016876489 6:148870640-148870662 CAGGCACATCTCCATGTAAAGGG - Intronic
1019165248 6:170094203-170094225 CAGGCGCCGCGCCAGGTGGGAGG - Intergenic
1023200354 7:37690432-37690454 CAGGCACGTCGCACTGTGAAAGG - Intronic
1025155352 7:56600548-56600570 AAGGCACATCTCCATGTGGCTGG + Intergenic
1026428936 7:70324793-70324815 ATGGCACCTTGCCATGTGGCGGG + Intronic
1031668904 7:124518999-124519021 CAGGCTCAACACCATGTGGAAGG - Intergenic
1031832619 7:126646076-126646098 GAGGCCCCTGGGCATGTGGAGGG - Intronic
1031982269 7:128135728-128135750 CAGGGACCGAGCCAAGTGGAAGG + Intergenic
1033529365 7:142247142-142247164 CAGGCACCATGCCATGGGGGAGG + Intergenic
1035361416 7:158316125-158316147 CAGGCAGCTTCCCCTGTGGAAGG + Intronic
1036359345 8:8066161-8066183 CAGGCCCCTCGCCAGGTGAGAGG - Intergenic
1036830068 8:12014463-12014485 CAGGCCCCTCGCCAGGTGAGAGG + Intronic
1036891611 8:12600791-12600813 CAGGCCCCTCGCCAGGTGAGAGG + Intergenic
1036899152 8:12658756-12658778 CAGGCCCCTCGCCAGGTGAGAGG + Intergenic
1039879451 8:41615365-41615387 CAGCCAGCTTTCCATGTGGAGGG - Intronic
1041375619 8:57207526-57207548 CAGGCCACTGCCCATGTGGATGG - Intergenic
1041376382 8:57211905-57211927 CAGGCCACTGCCCATGTGGATGG - Intergenic
1041377324 8:57217299-57217321 CAGGCCACTGCCCATGTGGATGG - Intergenic
1049227894 8:141466402-141466424 CAGGCACCTGTCCAAGGGGATGG + Intergenic
1049237096 8:141517914-141517936 CAGCCTCCTCGCCATCGGGAAGG + Intronic
1050294935 9:4195521-4195543 CAGCCACCTCCCCATGGGGCAGG + Intronic
1051949306 9:22611795-22611817 CAGGCACCTGGCTAATTGGATGG - Intergenic
1055486639 9:76762743-76762765 CAGGCCCTTCGCCATGAGCATGG + Intronic
1055827091 9:80339722-80339744 CAGGAACCTCGCCATCCTGAAGG + Intergenic
1058199284 9:102018778-102018800 CAGGCACCTGCCAAAGTGGATGG + Intergenic
1059671278 9:116494852-116494874 CAGGCATCTCGCAGTCTGGAGGG - Intronic
1061068942 9:128296725-128296747 CAGGTTCCACGTCATGTGGATGG + Intergenic
1061992878 9:134169761-134169783 CAGAAACCTGGCCATGTGGTGGG + Intergenic
1186548624 X:10478498-10478520 CAGGCAGCTCGCAATGTGCTGGG + Intronic
1196304702 X:114087437-114087459 GAGGCTCCTCTGCATGTGGAAGG + Intergenic
1199700530 X:150372299-150372321 CAGGCAGCCAGCCCTGTGGAGGG + Intronic
1200024666 X:153247251-153247273 CAGGCCCTTCACCATGTGAAGGG + Intergenic
1200315927 X:155132992-155133014 GAGGCACCTCTGCCTGTGGAAGG + Intronic
1201729005 Y:17185737-17185759 CAGCCACCTCCCCATGGGCAGGG - Intergenic
1202100570 Y:21303705-21303727 CAGCCACCTCCCCATGGGGCAGG - Intergenic