ID: 1165223110

View in Genome Browser
Species Human (GRCh38)
Location 19:34333791-34333813
Sequence GAGGCACGTTACCATGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165223110_1165223112 -10 Left 1165223110 19:34333791-34333813 CCATCCACATGGTAACGTGCCTC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1165223112 19:34333804-34333826 AACGTGCCTCTTACTTTCACCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165223110 Original CRISPR GAGGCACGTTACCATGTGGA TGG (reversed) Exonic
904383492 1:30126762-30126784 GAGGCACAGTACCATGTACAGGG + Intergenic
920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG + Intronic
923129914 1:231066230-231066252 GAGGTATGTTAACATGTGCAGGG - Intergenic
924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG + Intronic
1064582183 10:16805844-16805866 GAGGCACGCTTCCGAGTGGAAGG + Intronic
1069629820 10:69890610-69890632 GAGGCAGGTAATCATGTGGGTGG + Intronic
1073615894 10:104994838-104994860 AATGCCCGTTAACATGTGGATGG - Intronic
1092559267 12:9593208-9593230 AAGGCACATTTCCATGAGGAAGG - Intergenic
1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG + Intergenic
1094844694 12:34356289-34356311 GAGTCACGTTATCCTGTGGTGGG + Intergenic
1094845833 12:34360996-34361018 GAGGCACTTTCTCCTGTGGAGGG + Intergenic
1094872246 12:34604979-34605001 GAGGCACGTTCGCCCGTGGAGGG - Intergenic
1097676119 12:62603648-62603670 GAGGCACGGGACCACGCGGAGGG - Exonic
1106806954 13:33319233-33319255 GATGCATGTTACAATATGGATGG + Intronic
1107204606 13:37768361-37768383 GAGCCATGTTACCATGTAGCAGG + Intronic
1109455981 13:62589958-62589980 AAGGAATGTTACCATGGGGATGG + Intergenic
1111959425 13:94793776-94793798 GATACACGCTACAATGTGGATGG + Intergenic
1121856932 14:97278770-97278792 GAGGCACATTAGCATGTTAAAGG - Intergenic
1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG + Intronic
1123776675 15:23587660-23587682 GAGGAATGTTAGCATGTGCAGGG + Intronic
1124205562 15:27716079-27716101 GAGACATGTTACCATGGAGATGG - Intergenic
1132286210 15:100664707-100664729 GAAGCACCTGGCCATGTGGAAGG - Intergenic
1138083378 16:54112981-54113003 GAGGCACGTTAACATGCCAAAGG - Exonic
1144787010 17:17837505-17837527 GAGGCTAGTGACAATGTGGAGGG + Intergenic
1151205733 17:72505412-72505434 GAGGCACAATTCCATGTGGCTGG + Intergenic
1154252426 18:12755726-12755748 GAGGAACGGTGCCATGTCGAGGG + Intergenic
1155337855 18:24783713-24783735 GAGGCAGCCTGCCATGTGGAAGG - Intergenic
1165222718 19:34330285-34330307 CAGGCACCTCGCCATGTGGAAGG - Exonic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166050812 19:40257832-40257854 GAGACATGCTGCCATGTGGAGGG + Intronic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
926051368 2:9746932-9746954 GGGGCAGGTTAACATGAGGACGG - Intergenic
927056189 2:19367596-19367618 GAGGGGAGTGACCATGTGGAAGG - Intergenic
934013262 2:87849668-87849690 AAGGCAAGTTACCATTTGGTTGG - Intergenic
934972121 2:98772234-98772256 GTGGCACGTTAGCAAATGGAAGG - Intergenic
938292013 2:130155490-130155512 GAGGCCCCTTTCCAAGTGGATGG + Intronic
938464536 2:131517477-131517499 GAGGCCCCTTTCCAAGTGGATGG - Intergenic
939521436 2:143235968-143235990 GAGGCACCTGACCATGTTCATGG + Intronic
941668156 2:168262088-168262110 GAGGAATGGTGCCATGTGGAGGG - Intergenic
942555813 2:177171268-177171290 GAGGGATGTTAGCATGTGCAGGG + Intergenic
943185386 2:184599462-184599484 GAGGCAGGGAACCATGTGGCTGG + Intronic
947855477 2:233320862-233320884 GCAGCACCTTATCATGTGGATGG + Intronic
1170354841 20:15480643-15480665 GAGTCAGGTTACCAGGAGGATGG + Intronic
1173365274 20:42379535-42379557 GAGGCACCTGAGCCTGTGGAGGG + Intronic
949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG + Intronic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
953038403 3:39233502-39233524 GGGTGACATTACCATGTGGATGG + Intergenic
958042404 3:88243150-88243172 GACGCACTTTACCATGTGTTTGG + Intergenic
971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG + Intergenic
977218978 4:94316331-94316353 GATAGACGTTGCCATGTGGAAGG - Intronic
977495611 4:97771571-97771593 TAGGCACGTGAGCATGTAGAAGG + Intronic
978663373 4:111154239-111154261 GAGGTACGTGAACAAGTGGAGGG + Intergenic
980724104 4:136735726-136735748 GATGAACGTTAGCATGGGGAGGG + Intergenic
981257771 4:142683406-142683428 CAGACAGGTTTCCATGTGGAGGG + Intronic
982113965 4:152081791-152081813 GAGGCACAGTTCCATGTGGCTGG - Intergenic
984267096 4:177508257-177508279 GAGGAATGTTAGCATGTGTAAGG - Intergenic
985760558 5:1746595-1746617 GGGGCCCGTTTCCCTGTGGACGG + Intergenic
995150034 5:108832359-108832381 GATGCAGGTTAAGATGTGGATGG + Intronic
996909676 5:128640843-128640865 GATGAACGTTAACATGGGGAAGG + Intronic
997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG + Intronic
998109014 5:139486849-139486871 GGGGCAAGTAAGCATGTGGAGGG + Intergenic
999446416 5:151643731-151643753 GACACATGCTACCATGTGGATGG - Intergenic
1001865643 5:175102806-175102828 GAAGCATGTGAACATGTGGATGG + Intergenic
1002307840 5:178294201-178294223 GAGGCAGATCACCACGTGGAAGG - Intronic
1005845392 6:29772876-29772898 GAGGCAGGTTACCCTGGGAAAGG - Intergenic
1006132790 6:31878905-31878927 GAGGCCCGGGACCCTGTGGAGGG - Intronic
1006439412 6:34043788-34043810 GAGGCAGGTTACCCTGGTGAGGG - Intronic
1007234373 6:40379709-40379731 GAGCCAAGTTTCCATGTTGATGG - Intergenic
1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG + Intergenic
1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG + Intergenic
1013694132 6:112681319-112681341 GAGACACTTTACCATGTCCATGG - Intergenic
1013849837 6:114501142-114501164 CAAGCACATTACCATATGGAGGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1023517403 7:41015621-41015643 GATGCCCGTTACCATTTGAAGGG - Intergenic
1035426719 7:158783026-158783048 GAGGCACGTGTCCATGGGGAAGG - Intronic
1036461398 8:8956504-8956526 GATGCATGGTACAATGTGGATGG - Intergenic
1036915410 8:12799485-12799507 GAGGTACGTGAACAAGTGGAGGG + Intergenic
1043139608 8:76572188-76572210 GAGTCACGGTTCCATGTGGCTGG + Intergenic
1043993126 8:86780639-86780661 CAGGCTCAATACCATGTGGAAGG - Intergenic
1047153779 8:122294634-122294656 CAGGCCCAATACCATGTGGAAGG + Intergenic
1049246092 8:141563328-141563350 CAGGCACGTTTCCCTGTGGGAGG - Intergenic
1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG + Exonic
1058541426 9:106016302-106016324 GAGGCACTTTACAATATGTAAGG + Intergenic
1060891521 9:127192286-127192308 GAGGCAAGTTGCCGTGTGGCAGG + Intronic
1061710551 9:132484540-132484562 GATCCATGTTACAATGTGGATGG - Intronic
1062197107 9:135280411-135280433 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1186500351 X:10045809-10045831 GATGCACGTGACCATGAGGCAGG - Intronic
1190077035 X:47324680-47324702 GAAGCTGGTTACCAGGTGGAAGG + Intergenic
1194604247 X:95960896-95960918 GAGGAACGTTGCCATATTGAGGG + Intergenic
1198100528 X:133418132-133418154 GATACATGTTACCATATGGATGG - Intergenic
1199131209 X:144188801-144188823 AAGGCAAGTTACCATTTGGTTGG + Intergenic
1200151289 X:153952635-153952657 GAGCCCCGTTACCATGAGGGTGG + Exonic