ID: 1165223112

View in Genome Browser
Species Human (GRCh38)
Location 19:34333804-34333826
Sequence AACGTGCCTCTTACTTTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165223109_1165223112 -9 Left 1165223109 19:34333790-34333812 CCCATCCACATGGTAACGTGCCT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1165223112 19:34333804-34333826 AACGTGCCTCTTACTTTCACCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1165223110_1165223112 -10 Left 1165223110 19:34333791-34333813 CCATCCACATGGTAACGTGCCTC 0: 1
1: 0
2: 0
3: 1
4: 91
Right 1165223112 19:34333804-34333826 AACGTGCCTCTTACTTTCACCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1165223106_1165223112 30 Left 1165223106 19:34333751-34333773 CCAGATCAGTTTAGAAGGCTCTA 0: 1
1: 0
2: 2
3: 7
4: 69
Right 1165223112 19:34333804-34333826 AACGTGCCTCTTACTTTCACCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165223112 Original CRISPR AACGTGCCTCTTACTTTCAC CGG Intronic
905675203 1:39819735-39819757 ATCCTGCCTCTCACTTTCCCGGG - Intergenic
910718661 1:90260194-90260216 CATGTGACTCTTCCTTTCACTGG - Intergenic
920853083 1:209642033-209642055 AACAAGCCTCTTTCTTTCCCTGG + Intronic
921610491 1:217207151-217207173 AACTTGCTTCTTAATTTTACAGG + Intergenic
923033063 1:230265094-230265116 ATCGTGCCTCTTCCTACCACAGG - Intronic
924274109 1:242367787-242367809 AACTTGACTCTTATTTTCAAGGG - Intronic
1071885131 10:89941342-89941364 TATGTGTCTCTTATTTTCACTGG + Intergenic
1085307825 11:75498224-75498246 TATGTGACTCTCACTTTCACTGG - Intronic
1092510690 12:9153027-9153049 GAGGTGCCTTTTACTTTCCCAGG + Intronic
1092602368 12:10081153-10081175 TACTTGACTCTCACTTTCACCGG + Intronic
1095396542 12:41768614-41768636 TACGTGCCTCTAACTCTCATGGG + Intergenic
1098796679 12:74897681-74897703 AACCTGCCTCTGACATTCAATGG + Intergenic
1126216049 15:46156575-46156597 CAGGTGCCTCTCTCTTTCACAGG - Intergenic
1126323545 15:47450371-47450393 ACCATGCCTCTTACTGTCCCTGG + Intronic
1126483747 15:49155940-49155962 AAGCTGTCCCTTACTTTCACCGG - Intronic
1129897193 15:79117289-79117311 CCCGTGCCTCTTCCTTTCTCAGG + Intergenic
1146477491 17:33174683-33174705 CACATGCCTCTTCCTTTCATTGG - Intronic
1154472439 18:14717621-14717643 AACATGCATGTTTCTTTCACAGG - Intergenic
1156013013 18:32515633-32515655 GACGTGCCTTTTACCTTCCCAGG + Intergenic
1159001758 18:62981145-62981167 AACCTGCCTCTTACTTGGACAGG + Intergenic
1165223112 19:34333804-34333826 AACGTGCCTCTTACTTTCACCGG + Intronic
926144443 2:10388091-10388113 AACGAGCCTCTGACCTTCTCAGG - Intronic
930914359 2:56669074-56669096 TAAGCTCCTCTTACTTTCACTGG + Intergenic
931404467 2:61962815-61962837 CAGGTGTCTCTTATTTTCACTGG + Intronic
931564013 2:63594695-63594717 AATGTGCCTATTACATTTACTGG - Intronic
933484536 2:82902090-82902112 AACCTTTCTCTTTCTTTCACAGG - Intergenic
939556036 2:143674671-143674693 AACGTACCTCTTATATGCACTGG - Intronic
940474008 2:154137202-154137224 AACGAGCCTTTTACTTTTTCTGG - Intronic
948418404 2:237835321-237835343 AATGTGACTCTTTCTTTCCCTGG - Intronic
1170459350 20:16562541-16562563 CACATGCCTCTTACTTTCTGTGG - Intronic
1172661485 20:36572185-36572207 GACGTGGCTTTTTCTTTCACAGG + Intergenic
1175447716 20:59035750-59035772 CACCTGCCTCTTAGTTCCACGGG + Intronic
1182033122 22:27175509-27175531 AACTTGCCTCTCCCTTTCACAGG - Intergenic
957367531 3:79245710-79245732 AAACTGCCTGTTCCTTTCACTGG + Intronic
960434282 3:117606625-117606647 TCCGTGCATCTTATTTTCACTGG - Intergenic
961155355 3:124675066-124675088 AGCGGGCCTCTGACCTTCACAGG - Intronic
961383363 3:126510066-126510088 AACGTGGCTCCTACTTTAAAGGG + Intronic
966952854 3:184839375-184839397 TAAGTGCCTCTTACTTTGCCTGG + Intronic
977539348 4:98297772-98297794 GATGTGACTCTTCCTTTCACTGG - Intronic
980463782 4:133149638-133149660 AACATGCCTCTTAATGTCAACGG - Exonic
983884670 4:172966899-172966921 AAGTTGTCTCTTACATTCACAGG + Intronic
984195954 4:176658483-176658505 AACCTCTCTCTTACATTCACAGG - Intergenic
997972957 5:138419328-138419350 AACATGCTACTTACTTTCTCTGG + Intronic
999947722 5:156615164-156615186 AAGATGCCTCTTAGTTGCACTGG - Intronic
1007761533 6:44136162-44136184 AATATGCCTCTTCCTTTCAGGGG - Intronic
1012731006 6:102880377-102880399 AATGTGCCTTTTAATTTCAGTGG - Intergenic
1012738444 6:102981248-102981270 AAGGTGCTTCCTATTTTCACTGG + Intergenic
1015747956 6:136530745-136530767 AATCTGCCTCTTCCTTTCAAAGG - Intronic
1020713664 7:11641276-11641298 AACATGCCTTTTAATTTCAATGG + Intronic
1021402830 7:20229306-20229328 AAAGTCCCTTTTATTTTCACTGG + Intergenic
1021764068 7:23929289-23929311 AATGTGGCTAATACTTTCACAGG - Intergenic
1033671357 7:143496382-143496404 AAGGTACCTTTTACATTCACTGG - Intergenic
1034739089 7:153456724-153456746 AAGGTGCCTTTTACATTTACAGG - Intergenic
1039775839 8:40735865-40735887 CCCGTGCCTCTTTCTTTCTCTGG - Intronic
1050155129 9:2658802-2658824 AAGGTACCTGTGACTTTCACCGG - Exonic
1051907932 9:22117816-22117838 AACTTGCCTCTCACTCTAACCGG - Intergenic
1052142994 9:25010862-25010884 AATGTTCCTCTTACTTGGACTGG - Intergenic
1057413010 9:94835010-94835032 ACCATGCCTCTTCCTTTCTCAGG - Intronic
1059156612 9:111995008-111995030 CATGTGACTCTTCCTTTCACTGG + Intergenic
1061703181 9:132432004-132432026 AATGTGCCTATGACGTTCACAGG - Intronic
1187631511 X:21177796-21177818 GATGTACCTCTTACTTGCACTGG - Intergenic
1189241596 X:39528897-39528919 TATGTGCATCTTTCTTTCACAGG - Intergenic
1193928163 X:87516955-87516977 ATCATGCCTTTTACTTTCACAGG - Intergenic