ID: 1165223823

View in Genome Browser
Species Human (GRCh38)
Location 19:34339890-34339912
Sequence GCTTCTCTGCAGCAGGGACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165223823_1165223827 -1 Left 1165223823 19:34339890-34339912 CCATGTCCCTGCTGCAGAGAAGC 0: 1
1: 0
2: 4
3: 36
4: 300
Right 1165223827 19:34339912-34339934 CCTTGATCCTGAGAAGACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 217
1165223823_1165223830 8 Left 1165223823 19:34339890-34339912 CCATGTCCCTGCTGCAGAGAAGC 0: 1
1: 0
2: 4
3: 36
4: 300
Right 1165223830 19:34339921-34339943 TGAGAAGACCCTGGGTCTAGTGG 0: 1
1: 0
2: 0
3: 21
4: 176
1165223823_1165223828 0 Left 1165223823 19:34339890-34339912 CCATGTCCCTGCTGCAGAGAAGC 0: 1
1: 0
2: 4
3: 36
4: 300
Right 1165223828 19:34339913-34339935 CTTGATCCTGAGAAGACCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165223823 Original CRISPR GCTTCTCTGCAGCAGGGACA TGG (reversed) Exonic
900649176 1:3722671-3722693 GCCTCTCTGCACCTGGCACAGGG + Intronic
900965342 1:5953503-5953525 TCCTCTCTCCAGCAGGAACACGG + Intronic
901061046 1:6472028-6472050 GCTTCCCTCCAGGAGGGACCAGG - Intronic
901251913 1:7785049-7785071 CCTTCCCTGGAGCAGGGAAAGGG + Intronic
901923849 1:12553656-12553678 GCTGCCCTGGGGCAGGGACAGGG - Intergenic
902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG + Intronic
902808901 1:18877329-18877351 GCTCCTCTGCAGCCGGGGCTGGG - Intronic
903179283 1:21597341-21597363 GGTTCTCTGAGGCAGGGACTTGG - Intronic
903184242 1:21620348-21620370 TCATCTCTGCAGCTGGGACTTGG - Intronic
903184922 1:21623375-21623397 GCCACTGTACAGCAGGGACAGGG + Intronic
904474844 1:30758011-30758033 CCTTCTCTGCACCAGGGCCAGGG + Intergenic
904755596 1:32766882-32766904 GCTCCTCTGCAACAGGGGCCAGG + Intronic
904767947 1:32864657-32864679 GCTTCTCCGCAGCAAGGTGAGGG - Exonic
904916255 1:33972634-33972656 GCTTCTCCGAAGCTGGGAAAAGG + Intronic
904922605 1:34020604-34020626 GCTTATTTTCAGCAGGAACACGG + Intronic
906023590 1:42653972-42653994 GCTTCTCTGAAGGAGACACATGG + Exonic
907241057 1:53081316-53081338 GCTTCCATGCAGCAGAGCCAGGG + Intronic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
908251399 1:62268694-62268716 GCCTCTCTGCACCAGAGCCAGGG - Intronic
910220013 1:84880553-84880575 GGTCCTCTGCAGCATGGACTTGG - Intronic
912174351 1:107139336-107139358 GCTTCTCTCCAGCAGGTCCCTGG + Intergenic
913529056 1:119720440-119720462 CCTTCCCTGTATCAGGGACAGGG + Intronic
913586230 1:120278053-120278075 GCTTCTCCGAGGCAGGGGCAGGG + Intergenic
913621956 1:120620316-120620338 GCTTCTCCGAGGCAGGGGCAGGG - Intergenic
914568239 1:148889911-148889933 GCTTCTCCGAGGCAGGGGCAGGG + Intronic
914604586 1:149240338-149240360 GCTTCTCCGAGGCAGGGGCAGGG - Intergenic
915098196 1:153478941-153478963 GGTTCTCAGCAGAGGGGACATGG + Intergenic
915815494 1:158961613-158961635 GCTTCTCCACTGCAGGGAAATGG + Intronic
917681937 1:177376285-177376307 TCTTCTCTGCAGCATGAAAATGG - Intergenic
919569365 1:199226963-199226985 ACTTCTTAGCAGCTGGGACAAGG + Intergenic
919847132 1:201649274-201649296 GCTGCTCTCCAGCAAGGCCAAGG + Exonic
920255165 1:204649782-204649804 GATTCTCTGCAGCCGGGAGAGGG - Intronic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
922542052 1:226427164-226427186 GCTTCTGTGCATGAGGGACCAGG - Intergenic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
924308358 1:242715029-242715051 GCATCTAAGCAGCAGGGTCAGGG - Intergenic
1062772867 10:117466-117488 GCTTCTTTGCATGAGGGAAAAGG + Intergenic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1064699758 10:18006917-18006939 GGGTCTCTGCAGCAGTGACTGGG + Intronic
1064716288 10:18180251-18180273 GCTTCTCTGCAACAGACAGAGGG + Intronic
1064775608 10:18773300-18773322 GCTTGACTCCAGCAGTGACATGG - Intergenic
1068639226 10:59383447-59383469 GCATCTCACCAGCAGTGACATGG - Intergenic
1069921082 10:71816055-71816077 GCCTCTAGGGAGCAGGGACAGGG + Intergenic
1071417080 10:85451402-85451424 GCTTCACTGCAGCAGATAAATGG + Intergenic
1071523915 10:86347266-86347288 GCTTCTCTGCCACAGGCACTTGG - Intronic
1073119445 10:101112641-101112663 GCTTCTGTGCAGGAGGCACGTGG - Intronic
1073867228 10:107818952-107818974 GCTTCTCTGTGGCAGTGAGAGGG - Intergenic
1074293098 10:112156189-112156211 GATTCTCTGCATGAGGGGCAGGG - Intronic
1074875105 10:117607577-117607599 GCTCCTGTGAAGCAGGGAGATGG - Intergenic
1075259417 10:120949716-120949738 TCATCTCCGCAGCAGGGACGAGG + Intergenic
1075912717 10:126139729-126139751 GCTTCTCTGGGGGAGGAACAGGG - Intronic
1076209039 10:128625930-128625952 GTCTCTCTGCAGCAGGGAGTAGG + Intergenic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1078062784 11:8059221-8059243 CCTTCTCTGTAGCAGGCTCAGGG + Intronic
1078282889 11:9920364-9920386 GCTTCTCTGTATCAGGAACTTGG - Intronic
1078715621 11:13836499-13836521 GCTACTTTGTAGCAGGGAGAAGG - Intergenic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079175635 11:18137645-18137667 GATACTCCGCAGCAGGGACAGGG - Exonic
1079181390 11:18196811-18196833 GGTGTTCAGCAGCAGGGACAGGG - Intronic
1079256620 11:18836632-18836654 GATGCTCAGCACCAGGGACAGGG - Intergenic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1079261571 11:18887435-18887457 GATGCTCTGCAACAGGGACAGGG + Intergenic
1079263826 11:18910933-18910955 GATGCTCTACAGCAGGGACAGGG + Intergenic
1079266064 11:18934320-18934342 GATGCTCCGCAGCAGGGACAGGG + Exonic
1079269647 11:18972236-18972258 GATGCTCCGCAGTAGGGACAGGG + Intergenic
1079277530 11:19055917-19055939 GATGCTCAGCAGTAGGGACAGGG + Exonic
1081118319 11:39232587-39232609 GGTGCTCTGTAGCAGGGAGATGG - Intergenic
1081375263 11:42351086-42351108 GGTTCTCTGCAGAAGGGATGAGG - Intergenic
1081556227 11:44164614-44164636 GCTTCTCTAGGGCAGGGACTGGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1084297851 11:68224844-68224866 GCTCCTCAGCAGCAGGCACCCGG + Intergenic
1084935642 11:72585185-72585207 GCTCCAATACAGCAGGGACAGGG - Intronic
1085055003 11:73398293-73398315 GCCTGTCTGCAGCAGGCACAGGG + Intergenic
1085358962 11:75868148-75868170 GTTTTTCTGCAGCAGTCACATGG + Intronic
1086201140 11:84203612-84203634 TATCCTTTGCAGCAGGGACATGG + Intronic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1089515419 11:119028824-119028846 GCTACCCTTCAGGAGGGACAAGG - Intronic
1090354482 11:126130673-126130695 GCTTCTCAGAGGCAGTGACATGG - Intergenic
1091765025 12:3114175-3114197 ACTTCTATGCTGCAAGGACAGGG - Intronic
1092206650 12:6618670-6618692 GCTTCTCTGGGGGAGGGAAAAGG - Intergenic
1094852008 12:34386528-34386550 GCTTCTCTGGATCAGGCCCACGG - Intergenic
1096587490 12:52632263-52632285 GCTCCTATGCAGCAGGGCAAGGG + Intergenic
1096620065 12:52858840-52858862 GGTTCACTGCAACAGGGAAAGGG + Intergenic
1098328279 12:69325191-69325213 GCTTCTCTTCAGCAGAGCCTGGG - Intergenic
1098470791 12:70841094-70841116 GCTTTTCTGGGGCAGGGAAAAGG - Intronic
1098828556 12:75330378-75330400 GCTTCTCCTGAGCAGGGAAAGGG + Intronic
1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG + Intronic
1103447277 12:121002349-121002371 GGTTCTCAGCAGCAGGCCCAGGG - Exonic
1103643476 12:122371891-122371913 GCTTCTCTGCAGCAGCATAAGGG + Intronic
1104483327 12:129127932-129127954 GCTTCTGTGCAGCTGTCACATGG + Intronic
1110794818 13:79623943-79623965 GCTTTGCTGCACCAGGTACACGG + Intergenic
1111028515 13:82567015-82567037 GCACCTCTGCAGCAGGGTCAGGG - Intergenic
1112574448 13:100623168-100623190 GCTTCCCTGCTGCAGGGCCAAGG + Intronic
1113344635 13:109465285-109465307 GCTTTTCTGCAGCATGCACATGG - Intergenic
1113442305 13:110338660-110338682 CCATCTCTGCAGCTGGGAAAAGG + Intronic
1113521468 13:110944859-110944881 GCCTGCCTGCAGCTGGGACATGG + Intergenic
1114049233 14:18907375-18907397 GCCTCTCTCCAGAAGGGAAAAGG - Intergenic
1114113331 14:19494556-19494578 GCCTCTCTCCAGAAGGGAAAAGG + Intergenic
1114115034 14:19612310-19612332 GCCTCTCTCCAGAAGGGAAAAGG + Intergenic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1116569315 14:46495545-46495567 TCTTCTTTGCAGCACTGACAAGG + Intergenic
1116795418 14:49384773-49384795 GCTTGGATGCAGCAGGGGCAGGG - Intergenic
1118266055 14:64295565-64295587 ACTTCTCTGCCTCAAGGACAGGG - Intronic
1118433860 14:65751251-65751273 GGTTCTCTGAAGCACAGACAGGG - Intergenic
1119474911 14:74921543-74921565 GCTGCCCTGCAGCTGGGACCTGG + Exonic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1121585579 14:95060847-95060869 GCTTCACTGTAGCAGGGCCCAGG - Intergenic
1122686615 14:103511182-103511204 GCTTCGCTGGAGCGGGGGCAGGG + Intergenic
1125214924 15:37261023-37261045 GCTTCTGTGCAACAAAGACATGG + Intergenic
1125520943 15:40347543-40347565 GCATCTCTGGGGCAGGGAAAAGG + Intergenic
1125728607 15:41880677-41880699 GCGTCTGTGCTGCAGGGACCTGG + Intronic
1128837059 15:70817643-70817665 GCTCCACTGGTGCAGGGACAGGG - Intergenic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1129672322 15:77614148-77614170 GTTTCTCTGGAGCCGGGGCAAGG - Exonic
1129699875 15:77761716-77761738 GCTTCTCAGCTTCAGGGACATGG + Intronic
1130427455 15:83815595-83815617 GCTTGTCTTGAGCTGGGACATGG + Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131172320 15:90187232-90187254 GCTTCCCTAAAGCAGGGAAATGG + Intronic
1131285122 15:91050620-91050642 GCTGATCCGCAGCAGAGACAGGG + Intergenic
1132385578 15:101397834-101397856 GCTTCTCTGCCGATGGGCCAAGG - Intronic
1132760668 16:1507206-1507228 GCTGGGCAGCAGCAGGGACAGGG - Intronic
1132892344 16:2210492-2210514 CCTCCTCAGCACCAGGGACATGG - Intronic
1133040349 16:3057256-3057278 TGTCCTCTGCAGCAGGGCCAGGG + Intronic
1133964831 16:10523177-10523199 CCTTCCCTGCAGCCAGGACATGG + Intergenic
1137364485 16:47848931-47848953 GTGTCTCTGCAGCAGGGAGCAGG - Intergenic
1137841881 16:51648643-51648665 GTTTTTCTGGAGCAGGAACAAGG + Intergenic
1137933768 16:52613761-52613783 GAATCTCTGCAGCAGGGGCAGGG - Intergenic
1140442718 16:74999598-74999620 ACTTCTCAGCAGCAGGGGGAGGG - Exonic
1140487622 16:75306348-75306370 GCTGCTTTGCGGCAGGGACGTGG - Intronic
1140835732 16:78792059-78792081 GCTCCCCCGCACCAGGGACAGGG - Intronic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142311527 16:89316956-89316978 GCTTCCCCTCAGCAGCGACATGG - Exonic
1143909317 17:10234754-10234776 GCTTCTGTTCCTCAGGGACAGGG - Intergenic
1144961103 17:19044649-19044671 GCCTCTCTGAAGAAGTGACATGG + Intronic
1144974058 17:19129875-19129897 GCCTCTCTGAAGAAGTGACATGG - Intronic
1146648265 17:34589831-34589853 GCCTCTCTCCAGTAGAGACAGGG - Intronic
1147791961 17:43019641-43019663 GCCTCTGTGCAGGAGGGAAAGGG + Intronic
1148069842 17:44902301-44902323 GCTGTTCTGCAACAGTGACAGGG - Intronic
1148451579 17:47781444-47781466 GCATCTCTACAGCACGGTCATGG - Intergenic
1148717020 17:49723180-49723202 GCTTATTTGCAGCGGGGGCAGGG - Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150471982 17:65445243-65445265 GCTTCTCAGCAACAGGAACTGGG - Intergenic
1152068804 17:78125258-78125280 GCTTCTCTGCGAGAGGGAGAGGG + Exonic
1152699977 17:81813864-81813886 TCACCTCTGCACCAGGGACAAGG - Exonic
1153225847 18:2899126-2899148 GCTGCTCAGCAGCAGGGATGAGG + Intronic
1154164440 18:12003889-12003911 GCTGCTCCACAGAAGGGACAAGG - Intronic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157030722 18:43904308-43904330 GCTTCTCTGAAGTAGGAAAAAGG - Intergenic
1158098670 18:53804677-53804699 GCTGCTCTGCCCCAGGGAGATGG - Intergenic
1159394636 18:67839608-67839630 ACTTCTATGCACCAGGGAGAGGG - Intergenic
1159785445 18:72708486-72708508 GCCTCTCTTCTGCTGGGACATGG - Intergenic
1160153521 18:76413356-76413378 GCTCCTAGGCAGCAGGGAGAGGG + Intronic
1160389386 18:78518635-78518657 GCACCTCTGGAGGAGGGACATGG + Intergenic
1160767191 19:813850-813872 GCTTCTCTGCAGGTGGGGCCTGG + Exonic
1160782990 19:886061-886083 GCTGGGCTTCAGCAGGGACACGG + Exonic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1162769493 19:12940564-12940586 GCTTCTTAGCATCAGGGTCAGGG - Exonic
1163688173 19:18724142-18724164 GCTCCTCGGCAGCATCGACACGG + Intronic
1165176494 19:33934289-33934311 GAAGCTCTGGAGCAGGGACAAGG + Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165282266 19:34807469-34807491 ACCTCTGTGCAGTAGGGACAAGG + Intergenic
1165326325 19:35116431-35116453 GCTTCTATGGGGCAGGGTCAGGG - Intronic
1165407795 19:35641732-35641754 GCTTATCTGCAACAGGAAGAGGG - Exonic
1167169170 19:47819850-47819872 CCTTCCCTGCTGCAGGGCCAGGG + Intronic
1168156745 19:54477717-54477739 TCTTCTGAGTAGCAGGGACATGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925903985 2:8528325-8528347 GCATCTGTGCACCAAGGACATGG + Intergenic
926064938 2:9831067-9831089 TCTTCTCTCTAGCAGGAACATGG + Intergenic
927875518 2:26652931-26652953 TCTTCACTGCTGCAGGGACAGGG + Intergenic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
930088955 2:47518129-47518151 GCTTCCCTGAAGCAGGGATGTGG - Exonic
930241334 2:48938423-48938445 GCTGCTGTGCTGCAGAGACAAGG - Intergenic
930747510 2:54900272-54900294 GCTTCTGTGTGGCAGGCACAGGG + Intronic
931877708 2:66531779-66531801 GCCTGACTGCAGCAGGGCCAAGG + Intronic
932781415 2:74560890-74560912 GCTTAAATGCAGCAAGGACAAGG - Intronic
933585472 2:84175324-84175346 GCATCTCTGAAGCAGGGGCAGGG - Intergenic
935078060 2:99765398-99765420 GCTTCTCTGCAATTGCGACAGGG - Intronic
935287102 2:101574724-101574746 GCTTACCTGCAGCAGAGAGACGG + Intergenic
935403534 2:102684932-102684954 TAAGCTCTGCAGCAGGGACAGGG - Intronic
937361129 2:121230951-121230973 GCTTCACTTCAGCAGGGGCTGGG + Intronic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
937968983 2:127535539-127535561 GCTGCTCTGCAGAAGGGGCCTGG + Intergenic
938152468 2:128899398-128899420 GCTTCTCAGCAGGATGCACAGGG + Intergenic
938426574 2:131195702-131195724 GCCTCTCTCCAGAAGGGAAAAGG - Intronic
938811684 2:134859485-134859507 GCTTCACTGTGGGAGGGACAGGG + Intronic
941367759 2:164627760-164627782 ACTTCTCTGCATCAAGAACAAGG - Intergenic
941740263 2:169028351-169028373 GCTCCTCTGCATCAGGGCCCAGG - Intronic
941759814 2:169229426-169229448 CCTTCCCTGGAGCAAGGACAAGG + Intronic
943213563 2:185001008-185001030 GCTTATTAGAAGCAGGGACATGG + Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
945200579 2:207277217-207277239 GTCTCTCTGCAGCCAGGACATGG - Intergenic
947586474 2:231360010-231360032 GTGTCGCTGCAGCAGTGACATGG + Intronic
948181830 2:235988382-235988404 GATTCATGGCAGCAGGGACAGGG - Intronic
948398390 2:237664066-237664088 GTCTCTCTGCAGCATGGACATGG - Intronic
1169722568 20:8694978-8695000 TCTTTTCTGCATTAGGGACAAGG - Intronic
1170302024 20:14894831-14894853 GCTTTTGTGGATCAGGGACAAGG + Intronic
1170666550 20:18391734-18391756 GCTTCACAGGAGCAAGGACAGGG - Intronic
1171385610 20:24767679-24767701 GCTTGGCTGCAGCAGGGACTGGG - Intergenic
1172254871 20:33508733-33508755 TGTCCTTTGCAGCAGGGACATGG - Intronic
1172526573 20:35603309-35603331 GCTTCTCTCCAGCCGCGCCAGGG - Intergenic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1172649389 20:36492230-36492252 GCCTCCCTGAAGCAGGGAGATGG - Intronic
1173961319 20:47074465-47074487 GCTTCTCTGAAGGAGGGACCTGG + Intronic
1175301367 20:57945633-57945655 GTTACCCTGCAGGAGGGACAAGG - Intergenic
1175391974 20:58633223-58633245 GCTTCTCTGAGGAAGGGACTTGG + Intergenic
1175815697 20:61882166-61882188 GCTTCTCGGCAAAAGGGACTGGG - Intronic
1176075311 20:63245560-63245582 GCCTCCATGCAGCAGGGAGAGGG - Intronic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1178683399 21:34692632-34692654 ACTTCTCTGCAGCTGGGAGCTGG - Intronic
1178827645 21:36030071-36030093 TCTGCCCTGCAGCAGGGCCAGGG + Intergenic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1180170982 21:46058065-46058087 GCCTCTCTTCAGCAGGGAGACGG + Intergenic
1180467712 22:15629749-15629771 GCCTCTCTCCAGAAGGGAAAAGG - Intergenic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
1183815170 22:40293721-40293743 GCTTCACAGCAGCAGGGTCTGGG + Intronic
1183930242 22:41231866-41231888 GCCCCTCTGCTGCAGGGAAAGGG + Intronic
1183976086 22:41513131-41513153 CCCTCTCTGCAGCAGGGTTAGGG + Intronic
1184606100 22:45575716-45575738 GTTTCTCTGGAGCAGGGCCTGGG + Intronic
1184924762 22:47629477-47629499 GCCTCTCTGCAGCCCGGCCACGG + Intergenic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185388287 22:50546558-50546580 CCGGCGCTGCAGCAGGGACAGGG - Intergenic
950020205 3:9781757-9781779 GCTGCTCTGCAGCAGGGTAAGGG + Intronic
950046191 3:9949866-9949888 GCATCTCTTCAGCAGGGGCGTGG + Exonic
950657077 3:14443352-14443374 GCTTCTCTTCAGCAGGTGCCCGG + Intronic
952238918 3:31509708-31509730 GCTTCCAGGCAGCAGGGAGAAGG - Intergenic
952257590 3:31708922-31708944 GCCGCCCTGCAGCAGGGCCAAGG - Intronic
952615287 3:35263603-35263625 GTATCTCTGCAGCAGGGTAATGG + Intergenic
954659705 3:52220516-52220538 GCATCCCTGCAGCAGGGAGCTGG - Intergenic
954808958 3:53236276-53236298 GCCTCCCTGCCGCAGGGCCAAGG + Intronic
956674887 3:71724831-71724853 GCGTCCCTGCTGCAGGGAGAGGG - Intronic
957436214 3:80180249-80180271 GCTTCTCTACAGAAAGGAAAAGG + Intergenic
959837148 3:110932769-110932791 TCTTCTCAGGAGAAGGGACATGG - Intergenic
960851095 3:122055401-122055423 GCTTCTCTGCTGCTGTAACAGGG + Exonic
961666775 3:128497665-128497687 GAGCCTCTGCAGCTGGGACAAGG + Intergenic
963919699 3:150893666-150893688 ACTACTATGAAGCAGGGACATGG - Intronic
967438380 3:189477785-189477807 CCCTCTCTGCGGCAGGGCCAAGG - Intergenic
971727180 4:30328444-30328466 GCTTCAGGGCAGCAGGGGCAGGG + Intergenic
974736729 4:65945248-65945270 GCTTAGCTCCATCAGGGACATGG - Intergenic
977570527 4:98624653-98624675 GATTCTCTGAACTAGGGACAGGG - Intronic
979199683 4:117962122-117962144 GCTTCCCAGCAGAAGGGAAAGGG + Intergenic
980800627 4:137744774-137744796 GCTTTTATGCAGCAAGTACAAGG - Intergenic
980897482 4:138874119-138874141 ACTTCTCAGCAGCATGGAGAAGG - Intergenic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
982069060 4:151679399-151679421 GCAACCATGCAGCAGGGACAAGG + Intronic
982084173 4:151817345-151817367 GCTTTTCTGGGGGAGGGACAAGG - Intergenic
982093473 4:151899567-151899589 GCTTCTCTGTCTCTGGGACATGG - Intergenic
982202472 4:152973891-152973913 GGTTCTCTGGAGCAGGGTGAAGG + Intronic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
985591713 5:768925-768947 CCTCCTCTGCAACACGGACATGG + Intergenic
985609629 5:879884-879906 CCTCCTCTGCAACACGGACATGG + Exonic
985639478 5:1056998-1057020 GCCTCACTGCAGCAGGCAGATGG - Intronic
985663292 5:1168139-1168161 GCTGCTCAGCACCAGGGGCAGGG - Intergenic
987546553 5:19317583-19317605 TGTCCTTTGCAGCAGGGACATGG - Intergenic
990530647 5:56670015-56670037 GCTTTTCTGCACCATGCACAAGG - Intergenic
990848475 5:60173096-60173118 GTTTCTCTCCAGTAGGCACATGG + Intronic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
992583321 5:78204771-78204793 CCTTCTCTGCCTCAGTGACAGGG - Intronic
992891126 5:81205304-81205326 GCTTCTCTTAAGCAGGCTCAGGG - Intronic
994106548 5:95955886-95955908 GCTTCTCTGTTGCAGAGAAAAGG + Intronic
995152366 5:108863988-108864010 GTTTCTCTTCAGCAGTGACAGGG + Intronic
995674058 5:114642444-114642466 GCTTTTCTTCTGCAGGGACTTGG + Intergenic
997469725 5:134110397-134110419 GCTACTCTGCATCAGGTACCAGG - Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999261358 5:150240873-150240895 CCTTCTTTCCAGCAGGGAGAGGG - Intronic
999954455 5:156685404-156685426 GCTTCTTTCCTGCAGGGAAATGG + Intronic
1000049954 5:157554309-157554331 GCTGCTCTTCAGCAGGAGCACGG - Intronic
1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG + Intergenic
1001836971 5:174840795-174840817 GCTTCTCTGCAGGAAGAAGAGGG + Intergenic
1002054842 5:176592884-176592906 GCTTCTCTGCACCAGGCCCCAGG + Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1007224687 6:40304688-40304710 CATACTCTGCAGCAGGGTCATGG + Intergenic
1007701357 6:43768337-43768359 GCTCCCCAGCAGCAGGGACAAGG - Intergenic
1011284252 6:85706547-85706569 TCTGCTCTGGAGCAGGTACAGGG + Intergenic
1011733269 6:90288012-90288034 GCTTCTTTACATCTGGGACACGG + Intronic
1015455359 6:133421009-133421031 GCTTCGCTGCAGAAAGGAGATGG + Intronic
1019035761 6:169057308-169057330 TCTTCTCAGTAGCAGAGACATGG + Intergenic
1019317750 7:397816-397838 GCTCCTTTGCAGCAGAGCCACGG + Intergenic
1019402781 7:866094-866116 GCTCCTCTTCAGCATGGACTCGG + Intronic
1019669704 7:2270816-2270838 GTCTTCCTGCAGCAGGGACAAGG + Intronic
1021963085 7:25891931-25891953 ACTTCTTTGGAGCAGGGATATGG - Intergenic
1023494897 7:40784591-40784613 TCTTTTCTGTAGCAGGGACTGGG + Intronic
1024231302 7:47365870-47365892 GTTTCTTTGCAGCAAGAACAGGG + Intronic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1029513461 7:101011181-101011203 TCTTCCCTGCTGCAAGGACACGG - Intronic
1029607680 7:101608980-101609002 GTTCCTCAGCAGCAGAGACAGGG + Intergenic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1032195951 7:129788672-129788694 GTTTCTCTGCAGCAGAGGCTGGG - Intergenic
1032441630 7:131946624-131946646 GCCTCTCTGGAGAAGGGAAACGG + Intergenic
1032477759 7:132224019-132224041 GCTTCTCAGCAGCAGAGACCCGG - Intronic
1033030701 7:137823440-137823462 GCTTCTTTGCAGAGGGTACATGG - Intronic
1033521193 7:142162087-142162109 GGTTATGTGCAGCAGAGACAGGG + Intronic
1033540705 7:142353259-142353281 GCTTCTCTGCAGAGAGGACTGGG + Intergenic
1033586517 7:142778684-142778706 GGTGCTCAGCAGCAGGGACTGGG + Intergenic
1034593304 7:152162967-152162989 TCTTCTGTGAAGCAGGGACATGG - Exonic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035152026 7:156882597-156882619 GGTTCTCAGGGGCAGGGACAGGG + Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035420164 7:158723379-158723401 GCTTTTCTGCAACAGGGATAGGG - Intergenic
1036156928 8:6350819-6350841 GCTTCTCTGCAGACGTGACCTGG + Intergenic
1036770415 8:11575037-11575059 GCCTCTCTGGCACAGGGACAGGG - Intergenic
1036792421 8:11730254-11730276 TCTTCGCTGCAGGAGTGACAGGG + Intronic
1037902785 8:22697348-22697370 GCTCCTCTGCAGCAGAGCCAGGG + Intergenic
1038248922 8:25884455-25884477 GCCTCTCTGAAGAGGGGACATGG - Intronic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1042802262 8:72732397-72732419 GCCTCTCAGCAGCAGAGTCAGGG - Intronic
1043473703 8:80585657-80585679 GGATTTCTGCAGCAGGGAGATGG - Intergenic
1043765839 8:84131198-84131220 GCTTCTCTGAAGAGGGGAAATGG - Intergenic
1046221568 8:111223536-111223558 GCTTATCTGAAACAGGGAGAGGG - Intergenic
1047785668 8:128151891-128151913 GCAGCTCTCCAGCTGGGACAGGG + Intergenic
1047812512 8:128425870-128425892 GCTTGACAGCAACAGGGACAAGG - Intergenic
1048295630 8:133211676-133211698 GCTTCTGTGGGGCTGGGACAGGG - Intronic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1049822296 8:144643095-144643117 GCTACTCTACAGAAGAGACAAGG - Intergenic
1050625600 9:7500785-7500807 CCTTCTCTGCTGCAGAGACCCGG - Intergenic
1052021557 9:23531267-23531289 GCTTCACTGCCACAGGGCCAGGG - Intergenic
1052245038 9:26324154-26324176 ATTTCTCTGAAGAAGGGACATGG - Intergenic
1058514230 9:105752778-105752800 ACATCTCTGCAGCAAGGGCATGG + Intronic
1059004461 9:110385954-110385976 GGTTTTCTGCTGCAGGGCCACGG - Exonic
1059871563 9:118584027-118584049 GCTTATCTCCAGCAGGCAGATGG - Intergenic
1060773965 9:126355391-126355413 GCTACACTGCAGCAGGCCCAGGG + Intronic
1060795656 9:126510908-126510930 CCTTCTCTGGAGCGGGCACAGGG + Intergenic
1060913022 9:127365784-127365806 GCTACTAAGCAGCAGGGCCAGGG + Intronic
1060995470 9:127873056-127873078 GCTTCTCTGCGGGAGAGAAAAGG + Exonic
1061055789 9:128222324-128222346 GCCTCACTGCAGCAGGGCCTTGG - Exonic
1061285674 9:129621054-129621076 GCCTCTCTGCAGCCGTGAAACGG + Intronic
1061581172 9:131537402-131537424 GCTTTTTGGCACCAGGGACATGG + Intergenic
1062267481 9:135693922-135693944 GCCTCTGTGCAGCGGGGACAGGG - Intronic
1062384139 9:136302393-136302415 GCTTCCCTCCTGCAGGGACAGGG - Intronic
1185644996 X:1609902-1609924 GTTTGGCTGCAGTAGGGACAGGG - Intergenic
1186129878 X:6455068-6455090 GCTTGTCTGGTGCAGGTACAGGG + Intergenic
1192318043 X:70067103-70067125 GCTTGGCTGCAGGAGGGGCATGG + Intergenic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1198249223 X:134863472-134863494 GATTCTCTGTAGCTTGGACAAGG + Intergenic
1198627354 X:138591874-138591896 GCTACTGTGCAGCAGGGAAGAGG + Intergenic