ID: 1165225066

View in Genome Browser
Species Human (GRCh38)
Location 19:34349020-34349042
Sequence GGCCTGCACGGTGGCTGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165225054_1165225066 12 Left 1165225054 19:34348985-34349007 CCCTGGCCCAGCTTCTCTCTCTG 0: 2
1: 0
2: 9
3: 88
4: 674
Right 1165225066 19:34349020-34349042 GGCCTGCACGGTGGCTGGTCGGG 0: 1
1: 0
2: 0
3: 12
4: 193
1165225057_1165225066 6 Left 1165225057 19:34348991-34349013 CCCAGCTTCTCTCTCTGGCTTTC 0: 1
1: 0
2: 4
3: 111
4: 1224
Right 1165225066 19:34349020-34349042 GGCCTGCACGGTGGCTGGTCGGG 0: 1
1: 0
2: 0
3: 12
4: 193
1165225055_1165225066 11 Left 1165225055 19:34348986-34349008 CCTGGCCCAGCTTCTCTCTCTGG 0: 1
1: 2
2: 7
3: 66
4: 648
Right 1165225066 19:34349020-34349042 GGCCTGCACGGTGGCTGGTCGGG 0: 1
1: 0
2: 0
3: 12
4: 193
1165225058_1165225066 5 Left 1165225058 19:34348992-34349014 CCAGCTTCTCTCTCTGGCTTTCA 0: 1
1: 0
2: 10
3: 98
4: 970
Right 1165225066 19:34349020-34349042 GGCCTGCACGGTGGCTGGTCGGG 0: 1
1: 0
2: 0
3: 12
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165225066 Original CRISPR GGCCTGCACGGTGGCTGGTC GGG Exonic