ID: 1165225472

View in Genome Browser
Species Human (GRCh38)
Location 19:34351771-34351793
Sequence ACATAGCCACATGTGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 578}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165225472_1165225475 8 Left 1165225472 19:34351771-34351793 CCATTCACCACATGTGGCTATGT 0: 1
1: 0
2: 6
3: 69
4: 578
Right 1165225475 19:34351802-34351824 ATACAAATAAAAATTCAGGCCGG 0: 1
1: 0
2: 16
3: 311
4: 3468
1165225472_1165225478 17 Left 1165225472 19:34351771-34351793 CCATTCACCACATGTGGCTATGT 0: 1
1: 0
2: 6
3: 69
4: 578
Right 1165225478 19:34351811-34351833 AAAATTCAGGCCGGGTGTGGTGG 0: 1
1: 70
2: 787
3: 4043
4: 16042
1165225472_1165225476 9 Left 1165225472 19:34351771-34351793 CCATTCACCACATGTGGCTATGT 0: 1
1: 0
2: 6
3: 69
4: 578
Right 1165225476 19:34351803-34351825 TACAAATAAAAATTCAGGCCGGG 0: 1
1: 5
2: 36
3: 356
4: 2451
1165225472_1165225477 14 Left 1165225472 19:34351771-34351793 CCATTCACCACATGTGGCTATGT 0: 1
1: 0
2: 6
3: 69
4: 578
Right 1165225477 19:34351808-34351830 ATAAAAATTCAGGCCGGGTGTGG 0: 1
1: 12
2: 151
3: 1076
4: 4777
1165225472_1165225474 4 Left 1165225472 19:34351771-34351793 CCATTCACCACATGTGGCTATGT 0: 1
1: 0
2: 6
3: 69
4: 578
Right 1165225474 19:34351798-34351820 TTAAATACAAATAAAAATTCAGG 0: 1
1: 0
2: 18
3: 227
4: 1878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165225472 Original CRISPR ACATAGCCACATGTGGTGAA TGG (reversed) Intronic
900031068 1:373604-373626 ACACAGCCACATGTGGGACAGGG + Intergenic
900051639 1:601858-601880 ACACAGCCACATGTGGGACAGGG + Intergenic
900531971 1:3158916-3158938 ACTTAGCCAGATGTGGTGGCAGG - Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902027698 1:13395930-13395952 AATTAGCCAGATGTGGTGATGGG - Intergenic
902240526 1:15085648-15085670 TCATAACCACTTGTGGTTAATGG + Intronic
902773816 1:18661634-18661656 ACAAAGCCACGTGTGGTGCCTGG + Intronic
903135223 1:21305064-21305086 AAATAGCCACATGTGGCTCATGG - Intronic
903197553 1:21702763-21702785 AAATAGCTACATGTGGCTAATGG - Intronic
904129433 1:28264639-28264661 AAATAGCCACATGTAGTGAGGGG - Intronic
905024705 1:34841762-34841784 AAATAGTCACATGTGGCTAATGG + Intronic
905386787 1:37610213-37610235 CAATAACCACATGTGGTGAGCGG - Intergenic
905606548 1:39305575-39305597 ACATAACCACATTTGGAAAACGG - Intronic
905712788 1:40120878-40120900 AGATAGCCACATGTGGCCAGTGG + Intergenic
905841963 1:41188442-41188464 AAATAGCCACATGTGGCTAGTGG - Intronic
906227971 1:44137797-44137819 ACATTTCCACATGGGCTGAAGGG + Intergenic
907692442 1:56682799-56682821 ACACAGCCACATGTGGCCACTGG - Intronic
908430093 1:64048218-64048240 AAATAGCCACATGTGGCTAGTGG - Intronic
908481789 1:64547684-64547706 AATTAGCCACATTTGGTGCAAGG - Intronic
909040345 1:70642048-70642070 ACATGGCCACATGTAGATAAAGG - Intergenic
909292526 1:73901923-73901945 ACATAGCCGAATGAGATGAAAGG + Intergenic
909539374 1:76773586-76773608 AAATAGCCACATGTGGCTAGTGG - Intergenic
909842117 1:80340576-80340598 ATATAGCCACATGTAGTTAGTGG + Intergenic
911575317 1:99570177-99570199 ACATAGCCAGGTGTGGTGGCAGG + Intergenic
911627861 1:100146411-100146433 ACAAAGCCACATATGCAGAAAGG - Intronic
912304369 1:108551398-108551420 AAATACCCACATGTGGCTAATGG - Intergenic
914912403 1:151798227-151798249 CAATAGCCACATGTGGCCAATGG - Intergenic
915212105 1:154318119-154318141 AAATAGCCAGATGTGGTGGCGGG - Intergenic
915802987 1:158814605-158814627 TTATAGCCACATGTGGTAGAAGG + Intergenic
916461502 1:165029432-165029454 ACAGGGCCAGATGTGGGGAAGGG - Intergenic
917068523 1:171123945-171123967 AAATAGCCAGATGTGGTGGCGGG + Intergenic
917156740 1:172009457-172009479 TAATAGCCACATGTGGATAAAGG - Intronic
917344437 1:174014398-174014420 ACATAGCCACATATAGTTAGTGG + Intronic
917388368 1:174503510-174503532 AATTAGCCAGATGTGGTGATGGG + Intronic
918217959 1:182409447-182409469 AAATAGCCACATGTGGTTAGTGG - Intergenic
918941008 1:190996749-190996771 CAATAGCCACATGTGGCTAATGG - Intergenic
918977113 1:191503956-191503978 ACTTAGCCAGATGTGGTGGCGGG - Intergenic
919754054 1:201055528-201055550 AAATAGTCACATGTGGCTAATGG - Intronic
920007560 1:202844581-202844603 ACATAGAGACATGTGGTGGTCGG + Intergenic
921230833 1:213068691-213068713 AAATAGCTACATGTGGTTAATGG - Intronic
922026352 1:221752918-221752940 AAATAGCCACATGTGGCTAGTGG - Intergenic
922251532 1:223853409-223853431 AAATAGCCACATGTGAGTAATGG + Intergenic
922369677 1:224896710-224896732 ACATAGCCACATGGCATGCAAGG + Intronic
923313945 1:232761093-232761115 ACATAGCCAGATATGGGGAAAGG - Intergenic
923522486 1:234746462-234746484 AAATATACACATGTTGTGAAAGG - Intergenic
924217278 1:241836330-241836352 CAATAGCCACATGTGGTTAGTGG - Intergenic
1063096016 10:2909808-2909830 AATTAGCCAGATGTGGTGATGGG - Intergenic
1063683680 10:8214810-8214832 ACCTAGCCACATGTGGCAAGTGG + Intergenic
1064330195 10:14386552-14386574 AGGTAGCCACATGTGGTTAGTGG - Intronic
1065198004 10:23285862-23285884 CAATAGCCACATGTGGCCAAGGG + Intronic
1065888156 10:30097237-30097259 AAATAGCCACATGTGGCTAGTGG + Intronic
1066462539 10:35624399-35624421 AATTAGCCAGGTGTGGTGAAAGG + Intergenic
1066536651 10:36399187-36399209 CCTTAGCCTGATGTGGTGAATGG - Intergenic
1068095411 10:52485523-52485545 AAATAGCAAGATGTGGTGACAGG - Intergenic
1068417351 10:56741161-56741183 GCATAACCACATATGGAGAAGGG - Intergenic
1069487762 10:68835469-68835491 AATTAGCCAGATGTGGTGATGGG - Intronic
1070591234 10:77802749-77802771 AATTAGCCAGATGTGGTGACAGG + Intronic
1070738106 10:78878627-78878649 AATTAGCCACATGTGGTGGCAGG - Intergenic
1071775893 10:88787490-88787512 ATATAGCCACATGTGGCTAGTGG - Intergenic
1072099126 10:92212583-92212605 CAATAGCCACATGTGGTTAGTGG - Intronic
1073482454 10:103795246-103795268 AAATAGCCACATGTGGCTAGTGG + Intronic
1073806058 10:107099464-107099486 ACATAGTTACATGTGGCTAAAGG - Intronic
1074129119 10:110557629-110557651 AAGTAGCCACATGTGGTGGCAGG - Intergenic
1075140158 10:119826210-119826232 TCACAACCACATGTGGTGAGTGG - Intronic
1075374037 10:121963729-121963751 ACTTAGCCAGGTGTGGTGACAGG + Intronic
1075626701 10:123969104-123969126 ACATAGCGACATGTGGCTAGTGG - Intergenic
1075928185 10:126270542-126270564 AAATAGCCACATGTGGCTAGTGG + Intronic
1076529459 10:131134921-131134943 GCATGGCCACATGTGGGGTAGGG - Intronic
1078506698 11:11955536-11955558 CAATAGCCACATGTGGCTAATGG + Intronic
1078518599 11:12045972-12045994 AAATAGCCACATGTGGCTAGTGG + Intergenic
1079025337 11:16943350-16943372 CCATAGCCACATGTGGTCAGTGG + Intronic
1079634692 11:22721599-22721621 AAATAGCCACATGTGGATAGTGG - Intronic
1079634695 11:22721668-22721690 CAATAGCCACATGTGGCTAATGG + Intronic
1079694946 11:23470128-23470150 AATTAGCCAGATGTGGTGACGGG + Intergenic
1080655520 11:34254993-34255015 AAATAGCCACATATGGTTAGTGG + Intronic
1081733169 11:45385429-45385451 ACACAGGCCCATGTGGTGACTGG - Intergenic
1082771365 11:57210413-57210435 GCATAGCCACATGTGGCTATTGG + Intergenic
1083159472 11:60845930-60845952 ACATAGCCACATGTGGCTGGCGG - Intronic
1083194541 11:61077036-61077058 AAATAGCCACATGTGGCTAGTGG - Intergenic
1083568093 11:63737459-63737481 AATTAGCCAGATGTGGTGACGGG + Intronic
1084346659 11:68555506-68555528 TGATAGCCACATGTAGTGAATGG + Intronic
1084821189 11:71692103-71692125 AATTAGCCACGTGTGGTGGACGG - Intergenic
1085427317 11:76416011-76416033 TAATAGCCACATGTGGTTAATGG + Intergenic
1085623863 11:78057241-78057263 AAATAGCCACATGTGGTGGTGGG + Intronic
1085763892 11:79265355-79265377 CCATAGCCACATGTGGCCAATGG - Intronic
1085919201 11:80931597-80931619 ACAGACCCACAAGTGCTGAAGGG + Intergenic
1086331777 11:85761600-85761622 ACAGCGCCACATGTGTAGAAGGG - Intronic
1086424830 11:86672757-86672779 ATATAGCCACACGTGGCGAATGG - Intergenic
1087972860 11:104507178-104507200 AAATAGTCACATGTGGCTAATGG - Intergenic
1088128783 11:106461923-106461945 AAATAGCCACATGTGGCTAGTGG + Intergenic
1088212216 11:107469319-107469341 AAATAGGCACATGTGGTTAGTGG - Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1089437109 11:118478471-118478493 CAATAGCCACATGTGGCTAATGG - Intronic
1089800059 11:121020527-121020549 AAATAGCCACATGTGGCTAGTGG + Intergenic
1089909965 11:122088205-122088227 AAATAGCCACATATGATGAGTGG + Intergenic
1089937897 11:122384474-122384496 AATTAGCCAGATGTGGTGATGGG + Intergenic
1090510918 11:127374379-127374401 ACATAGCAACATGAGATGATGGG - Intergenic
1090807883 11:130213653-130213675 ACATGCCCACGTGTGGTAAATGG - Intergenic
1090919909 11:131198388-131198410 TGCTAGCCACATGTGGTGGAGGG - Intergenic
1091561301 12:1615978-1616000 AAATAGCCACATGTGGTCAGTGG + Intronic
1092227920 12:6760649-6760671 AAATAGCCACATGTGGCTAGTGG - Intronic
1093608718 12:21127665-21127687 ACATAGATAAATGTGGTCAAGGG + Intronic
1093700059 12:22210255-22210277 ACATATACATATGTGGTGCATGG + Intronic
1094284540 12:28778121-28778143 CAATAGCCACATGTGGCTAATGG + Intergenic
1095326129 12:40895489-40895511 ACAGGGCGTCATGTGGTGAAGGG + Intronic
1096345124 12:50839573-50839595 AAATTGTCACATGTGGTGAGGGG + Intergenic
1096345411 12:50842198-50842220 ACATGGTAACATGTGGGGAAGGG - Intergenic
1096428656 12:51525145-51525167 CCATAGCCACATGTGGCTAATGG + Intergenic
1096483541 12:51959762-51959784 TGAAAGCCACATGTGGTCAAAGG - Intronic
1098111589 12:67127639-67127661 ACATAGCCACATATACTGAAGGG - Intergenic
1099565153 12:84233059-84233081 ACTTAGCCAGATGTGGTGGCGGG + Intergenic
1099853632 12:88137258-88137280 ACATAGCTACATGTAGCGAGTGG - Intronic
1100071497 12:90725179-90725201 AAATATCCACATGTGGTTAAAGG + Intergenic
1100195777 12:92242618-92242640 AAATAACCACATGTGGTTAGTGG - Intergenic
1100605831 12:96151244-96151266 CAATAGCCACATGTGGCTAACGG - Intergenic
1101388546 12:104279136-104279158 TAATAGTCACATGTGGTGAGTGG + Intronic
1101806850 12:108071563-108071585 CAATAGCCACGTGTAGTGAAGGG + Intergenic
1101943359 12:109117209-109117231 AATTAGCCAGATGTGGTGATGGG + Intronic
1101974862 12:109348381-109348403 AAATAGCCACATGTGGCTAGTGG + Intronic
1102286725 12:111663668-111663690 ACATAAACACATGTGGTTCAGGG - Intronic
1102398485 12:112608262-112608284 AAATAGCCAGATGTGGTGACGGG - Intronic
1103013835 12:117478787-117478809 ACATAGCCACATCTGGCTAGTGG + Intronic
1103252698 12:119514323-119514345 AAATAGCCAGATGTGGTGGCAGG - Intronic
1103357346 12:120331522-120331544 TCATAGACACATGTGGCGAGTGG + Intergenic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1103454521 12:121054383-121054405 AAATAGCCACATGTGGTTCTTGG - Intergenic
1103771504 12:123330204-123330226 CAATAGCCACATGTGATGAGTGG + Intronic
1103773884 12:123350971-123350993 AATTAGCCACATGTGGTGGCGGG + Intronic
1103862851 12:124028076-124028098 ACACAGCTAGATGTGGTGGAGGG - Intronic
1104105493 12:125654902-125654924 AAACAGCCACATGTGGGGACTGG + Exonic
1105754052 13:23448717-23448739 AAATAGCCAGGTGTGGTGGAGGG - Intergenic
1106014417 13:25854746-25854768 CAATAGCCACATGTGGCTAATGG - Intronic
1106955700 13:34936178-34936200 ACATGGACATATTTGGTGAAGGG + Intergenic
1107858653 13:44639960-44639982 CAATAGCCACATGTGGTTAGTGG - Intergenic
1108014537 13:46060675-46060697 GGATAGCCACATGTGGTTAGTGG + Intronic
1108031661 13:46237461-46237483 CTATAGGTACATGTGGTGAAGGG + Intronic
1108297243 13:49036277-49036299 AAATAGTCACATGTGGTTAATGG - Intronic
1108931995 13:55836764-55836786 ACATAACCACATGTGGCAAGTGG + Intergenic
1109076350 13:57840958-57840980 AGATAGCCACATGTGGCACATGG - Intergenic
1109077989 13:57862825-57862847 ACATAGCTACAGATGGTGATAGG + Intergenic
1109213982 13:59566409-59566431 AAATAGCCACATGTGGACAATGG - Intergenic
1109261316 13:60148338-60148360 AAATAGCCATATGTGGCTAATGG - Intronic
1111971402 13:94920846-94920868 AAATAGCCACATGTGGCTAGTGG + Intergenic
1112571804 13:100600187-100600209 CACTAGCCACATGTGGTGAGTGG + Intergenic
1113109493 13:106807217-106807239 ACTAAGTCACAGGTGGTGAATGG - Intergenic
1113295918 13:108958672-108958694 ACATAGCCATGTGTGGTTAGTGG + Intronic
1114185001 14:20394406-20394428 AAATAGCCACATGTGGCTAGTGG + Intronic
1114808881 14:25872320-25872342 AAATAGCCACTCGTGGTGGAAGG - Intergenic
1116275347 14:42825175-42825197 AAATCTCCACATGTTGTGAAAGG + Intergenic
1116850520 14:49904254-49904276 CCATAGCCACATGTGGCTAGTGG + Intergenic
1117097131 14:52310397-52310419 AAATAGCCAGATGTGGCTAATGG + Intergenic
1117361711 14:54981726-54981748 ACATAGCTACATGTTGTTAAAGG + Intronic
1117618438 14:57558951-57558973 CAATAGCCACATGTGGCTAATGG + Intergenic
1117716460 14:58586630-58586652 ACATTCCAATATGTGGTGAAGGG - Intergenic
1118356646 14:65019336-65019358 AAATAGCCAGATGTGGTGGCTGG + Intronic
1119010897 14:70987387-70987409 AAATAGCCACATATGGCTAATGG + Intronic
1120191120 14:81440660-81440682 AAATAGCCACATGTGGTTAGAGG + Intergenic
1120358145 14:83459846-83459868 ACATAACCACCTGTGGTGGGAGG + Intergenic
1120627820 14:86850796-86850818 AAATAGCCACATGTGGCTAGTGG - Intergenic
1120783889 14:88512675-88512697 GAATAGCCACATGTGGCTAATGG - Intronic
1120981554 14:90293575-90293597 AAATAGCCACATGTGGCTAGAGG + Intronic
1121380533 14:93462155-93462177 AATTAGCCAGATGTGGTGACCGG + Intronic
1122144417 14:99681058-99681080 AGAAAGCCACATGTGGCCAATGG + Intergenic
1122237906 14:100343023-100343045 ATTTAGCCACATGTGGTGGCAGG - Intronic
1122333379 14:100945169-100945191 AAATAGCCACATGTGGATAGAGG - Intergenic
1122336048 14:100985219-100985241 AAATTGGCAGATGTGGTGAAGGG - Intergenic
1124126756 15:26944026-26944048 ATAAAGCAGCATGTGGTGAACGG + Intronic
1124972989 15:34508265-34508287 ACATGGCGACATTTGGTGTAAGG + Intergenic
1126015479 15:44346493-44346515 AAATAGCCACATGTGACCAATGG - Intronic
1126621221 15:50641849-50641871 ACTTAGCCACGTGTGGTGACGGG + Intronic
1127159836 15:56170629-56170651 AAATAGCCACATGTGGCTAGTGG - Intronic
1127322981 15:57865594-57865616 ACAGAGCCACATGTGGCTAGTGG + Intergenic
1127342373 15:58061134-58061156 ACATAGGCCCATGTAGTGGAAGG + Intronic
1127623890 15:60761229-60761251 ACACAGCCACAACTGGTGAGTGG - Intronic
1127640991 15:60915663-60915685 AAATAGCCACATGTGGCTATTGG + Intronic
1127809542 15:62551548-62551570 AAATAGCCAGATGTGGTGGCAGG + Intronic
1127926925 15:63555481-63555503 AAATAGCCACATGGAGTGAGTGG + Intronic
1128077163 15:64834668-64834690 AAATAGCCACATGTGGCTAGTGG - Intergenic
1128226667 15:66006482-66006504 GCTCAGCCACATGTGGAGAATGG - Intronic
1129797319 15:78387981-78388003 AAATAGCCACATGCGGTTGATGG - Intergenic
1130097307 15:80865528-80865550 ACATAGCCACATGTGATTCATGG + Intronic
1130241087 15:82192249-82192271 AATTAGCCAGATGTGGTGATGGG + Intronic
1131372328 15:91893227-91893249 ACTTAGCCACATGTGGCCAGTGG + Intronic
1131377316 15:91936330-91936352 AAATAGCCATATGTGGTTAGTGG - Intronic
1132080239 15:98857646-98857668 CCATAGCCACATGTGGCTAGCGG - Intronic
1132528381 16:429646-429668 AAATAGCCAGGTGTGGTGACGGG - Intronic
1133091464 16:3407571-3407593 ACATAGTCACATGTGGCTAGTGG + Intronic
1134021729 16:10925669-10925691 GCATGTGCACATGTGGTGAAAGG - Exonic
1134210251 16:12270497-12270519 ACTTAGCCTCATGGGATGAATGG + Intronic
1134768032 16:16779686-16779708 ATATAACCACATTTGGTGTATGG + Intergenic
1135251429 16:20903442-20903464 AAATAGTCACATGTGGTCAGTGG - Intronic
1135558465 16:23456421-23456443 AATTAGCCACATGTGGTGGTGGG - Intergenic
1135735371 16:24927120-24927142 AAATAGCCAGATGTGGTGGCAGG + Intronic
1135818229 16:25655606-25655628 AATTAGCCAGATGTGGTGGAGGG - Intergenic
1137484032 16:48876828-48876850 CAATAGCCACATGTGGTTAGTGG - Intergenic
1137713396 16:50582856-50582878 ACTTAGCCAGATGTGGTGGTGGG + Intronic
1138636024 16:58339094-58339116 ACTTAGCCAGATGTGGTGGCAGG + Intronic
1139338691 16:66252229-66252251 AATTAGCCAGATGTGGTGATGGG - Intergenic
1139798921 16:69505354-69505376 AAGTAGCCAGATGTGGTGATTGG + Intergenic
1140152116 16:72378138-72378160 AAATAGCCACATGTGACCAATGG - Intergenic
1140623459 16:76764190-76764212 AATTAGCCAGATGTGGTGATGGG - Intergenic
1140837384 16:78807785-78807807 AAATAGCCACATGTGGCTAATGG - Intronic
1141072644 16:80972160-80972182 ACATAGCAGAAAGTGGTGAAGGG - Exonic
1141196327 16:81864306-81864328 AAATGGCCACCTGTGGTGAGGGG - Intronic
1143570963 17:7758205-7758227 CCATAGCCAAATGTGATGAGTGG + Intronic
1143749282 17:9016604-9016626 AAGTAGCTACATGTGGTGACTGG + Intergenic
1143979485 17:10856015-10856037 TCATAGCCACATGTGGCTAGTGG - Intergenic
1144102293 17:11952498-11952520 AAATAGCCACATGTGGCTAGTGG + Intronic
1144608130 17:16685918-16685940 AAATAGCCAGATGTGGTGGTGGG - Intergenic
1145082168 17:19903049-19903071 AGTTAGCCAGATGTGGTGATGGG - Intergenic
1145196709 17:20900282-20900304 AAATAGCCAGATGTGGTGGTGGG + Intergenic
1145739115 17:27257424-27257446 AAATAGCCACATGTGACTAATGG + Intergenic
1145977264 17:28991517-28991539 AAATAGCCACATGTGGTCAGTGG + Intronic
1146385995 17:32374043-32374065 AAATAGCCAGATGTGGTGGCGGG - Exonic
1146648778 17:34593415-34593437 CCACAGCCACATGTGGTGAGTGG + Intronic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1147015360 17:37487848-37487870 AGATAGCCACATGTGGCTAGTGG - Intergenic
1147396925 17:40150862-40150884 ACTTAGCCAGATGTGGTGGCGGG + Intronic
1147593912 17:41704376-41704398 AATTAGCCAGATGTGGTGATGGG + Intergenic
1148198069 17:45729008-45729030 GAAAAGCCACATGTGGGGAAAGG + Intergenic
1148725443 17:49786626-49786648 AAGTAGCCACATGTGGTGGCGGG + Intronic
1148851324 17:50556859-50556881 ACATAGCCACACATGGTCACTGG + Intergenic
1149433661 17:56615724-56615746 AAATAGCCAGATGTGGTGGTGGG - Intergenic
1149544906 17:57496291-57496313 ACATAGCCACAGATGGCCAAAGG - Intronic
1149646837 17:58247324-58247346 AAATAGCCACATGTGGTTAGTGG + Intronic
1149676370 17:58466649-58466671 AAATAGCCACATGTGGCTAGTGG + Intronic
1149714201 17:58771473-58771495 AATTAGCCAGATGTGGTGACGGG + Intronic
1150546650 17:66165244-66165266 AAATAGCCACATGTGATTAGGGG - Intronic
1151485526 17:74396972-74396994 AATTAGCCAGATGTGGTGACGGG - Intergenic
1152948572 17:83212065-83212087 ACACAGCCACATGTGGGACAGGG - Intergenic
1153669432 18:7396378-7396400 AGATTACCACATCTGGTGAAGGG + Intergenic
1154955338 18:21248730-21248752 AAATAGCCACATGTGGCTAGAGG - Intronic
1155959563 18:31982686-31982708 AAATAGCCAGATGTGGTGGCAGG - Intergenic
1156336376 18:36176196-36176218 TCATAGCCACATGTGGCTCATGG + Intronic
1156575262 18:38307533-38307555 ACATAGCCACCTGTGACTAATGG + Intergenic
1156639054 18:39067970-39067992 ACATAGCCTCATGATGTTAATGG + Intergenic
1157001854 18:43536638-43536660 TAATTGCCACATGTGGTGAGTGG - Intergenic
1157120192 18:44902025-44902047 AAATAGCCACATGTGGCTACTGG - Intronic
1157250417 18:46090710-46090732 AAATAGCCACATGTGGTTAGTGG - Intronic
1157573654 18:48730145-48730167 GGCTAGCCACATGTGGTGAAGGG + Intronic
1157859759 18:51130298-51130320 AATTAGCCACATGTGGTGGCAGG - Intergenic
1157899428 18:51500195-51500217 TCATAGCCACATGAGGTTAGTGG + Intergenic
1158251339 18:55491149-55491171 GCATAGAGGCATGTGGTGAAGGG - Intronic
1158268948 18:55691641-55691663 CAATAGCCACATGTGGTCAGTGG - Intergenic
1158422302 18:57306039-57306061 TCATAGCCACATTTGGTTAGAGG + Intergenic
1159016906 18:63108372-63108394 AAATAGCCACATGTGGCTAGTGG - Intergenic
1159460462 18:68716445-68716467 CAATAGCCACATGTGGTTAGTGG - Intronic
1159644009 18:70896226-70896248 ACTTAACCACATGTGGATAATGG + Intergenic
1159863430 18:73675787-73675809 CCGTAGCCACACGTGGTAAATGG + Intergenic
1160597078 18:79983147-79983169 ACTTAGCCAGATGTGGTGGTGGG - Intronic
1161193582 19:2973491-2973513 AAATAGCCACATGTGCTTACTGG + Intergenic
1162762248 19:12895758-12895780 AAATAGCCAGATGTGGTGGTGGG - Intronic
1162963432 19:14142854-14142876 AAATAGCCACATGTGGCTAGTGG - Intergenic
1163062496 19:14770590-14770612 ACACAGCCCCATTTGGGGAATGG - Intronic
1163812593 19:19443091-19443113 AAATAGCCACATGTGGCTAATGG + Intronic
1164410141 19:27995790-27995812 AAATAGCCAGATGTGGTGGCAGG + Intergenic
1164571973 19:29381137-29381159 ACTTAGCCAGATGTGGTGGCAGG + Intergenic
1164659759 19:29953187-29953209 TAATAGCCACATGTGGTTAATGG - Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165294403 19:34915133-34915155 AAATAGCCACATGTGGTGGCGGG + Intergenic
1165367892 19:35380733-35380755 CCACAGCCCCATGTGGTGACAGG - Intergenic
1166212772 19:41317900-41317922 AATTAGCCACATGTGGTGGCAGG + Intronic
1166513585 19:43428447-43428469 ACTTAGCCAGGTGTGGTGATGGG + Intergenic
1167438582 19:49494879-49494901 AAATAGCCACATGTGGCTAAAGG - Intergenic
1167778618 19:51579818-51579840 CAATAGCTACATGTGGTGAGTGG - Intronic
1168014099 19:53557371-53557393 CCATGGCCACACATGGTGAAAGG + Intronic
924963259 2:53647-53669 TAATAGCAACATGTGGTCAACGG - Intergenic
926278869 2:11428447-11428469 AAATAGCCACATGTGGCTAGTGG + Intergenic
926390210 2:12382439-12382461 TAATAGCCACATGTGGCTAATGG + Intergenic
926657814 2:15428319-15428341 AAATAGCCACATGTGGCCAGTGG + Intronic
927180321 2:20441778-20441800 TAATAGCCACATGTGGTTACTGG + Intergenic
927837462 2:26411473-26411495 TTATAGCCACATGTGGTTATTGG + Intronic
929714254 2:44294354-44294376 AATTAGCCAGATGTGGTGACGGG + Intronic
930114156 2:47704599-47704621 CAACAGCCACATGTGGTGAGTGG - Intronic
930133327 2:47875279-47875301 ACATAGTCACATGTGGCAAGTGG + Intronic
931272255 2:60713342-60713364 ACTTAGCCAGATGTGGTGGTGGG + Intergenic
932199827 2:69815777-69815799 AAACAGCCACATGTGGTTAGTGG + Intronic
933049412 2:77584517-77584539 CAATAGCTACATGTGGTTAATGG - Intronic
933227722 2:79769908-79769930 CAGTAGCCACATTTGGTGAATGG - Intronic
933381122 2:81547043-81547065 ACATACCCTCACGTGGTTAAAGG + Intergenic
933698879 2:85240159-85240181 CCATAGCCACATGTGGCAAGTGG + Intronic
933942609 2:87257103-87257125 AAATAGCCAGGTGTGGTGACAGG + Intergenic
934059504 2:88281099-88281121 AAATAGCCACATGTGGCTAGTGG - Intergenic
934059507 2:88281166-88281188 ATCTAGCTACATGTGGTGAGTGG + Intergenic
935747087 2:106197988-106198010 TCATAGCAAAATGTGGTGAGTGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936337613 2:111604463-111604485 AAATAGCCAGGTGTGGTGACAGG - Intergenic
936508778 2:113129187-113129209 CAATAGCCACATGTGGTTAGTGG + Intronic
937243866 2:120479722-120479744 AATTAGCCAGGTGTGGTGAAGGG + Intergenic
937969520 2:127538430-127538452 AAATAGCCACATGTGGCTAGTGG + Intronic
938677275 2:133650731-133650753 AAATAGCCACACGTGGTGGTGGG + Intergenic
939363188 2:141200341-141200363 ACATGGACACATGAGGTGGAGGG + Intronic
940941100 2:159561622-159561644 AAATAGCCACATGTGGCTTATGG + Intronic
941376188 2:164733903-164733925 AAGTAGACACATTTGGTGAATGG + Intronic
941605849 2:167595476-167595498 ACATACACACATGTGGAGGAAGG - Intergenic
941614674 2:167705803-167705825 AAATAGCCACATGTGGTTAGTGG - Intergenic
941664837 2:168234385-168234407 AAATAGCCACATATGGTTAGTGG + Intronic
941903677 2:170701178-170701200 AAATAGCCACATGTGGCTACTGG + Intergenic
943890383 2:193278454-193278476 AATTAGCCAGATGTGGTGACAGG + Intergenic
944155051 2:196598790-196598812 AATTAGCCAGATGTGGTGATGGG + Intergenic
944545978 2:200799333-200799355 ACATAGCCACATGTGGCTGGTGG - Intergenic
944655630 2:201874137-201874159 AAATAGCCACATGTGGCTAATGG - Intronic
944682954 2:202093396-202093418 CAATAGCCACATGTGGCTAATGG - Intronic
944779295 2:203001593-203001615 ACATAGCCACATGAGGTTAATGG - Intronic
944828389 2:203508069-203508091 AATTAGCCACATGTGGTGGTGGG + Intronic
944907173 2:204273955-204273977 AAGTAGACACATGTGGCGAATGG + Intergenic
945056081 2:205870152-205870174 ACATAGTGACATGTGGCTAATGG - Intergenic
945812761 2:214568702-214568724 ACATAATCACCTGTTGTGAAAGG - Intronic
945960058 2:216123998-216124020 AAATAGCCACATGTAGCTAATGG - Intronic
946295014 2:218777079-218777101 AATTAGCCAGATGTGGTGACGGG + Intergenic
946534784 2:220615085-220615107 AAAAAGCCACATGTGGTTAGTGG - Intergenic
946903275 2:224392979-224393001 CAGTAGCCACATGTGGCGAATGG + Intronic
947409142 2:229816487-229816509 AAATAGCCATTTTTGGTGAAAGG - Intronic
947688377 2:232111661-232111683 AAATAGCTACATGTGGTTAGTGG + Intronic
1169049496 20:2564074-2564096 AAATAGTCCCATGTGGTGAGTGG + Intronic
1169513908 20:6295918-6295940 AAATAGCCACATGTGGCTAGTGG - Intergenic
1169698110 20:8414798-8414820 AAATAGCCACATGTGGCTAGTGG + Intronic
1169833462 20:9851855-9851877 AAATAGCCACATGTAGCTAATGG + Intergenic
1170636200 20:18106679-18106701 CAGTAGCCACATGTGGTTAATGG - Intergenic
1170738191 20:19028515-19028537 ACTTAGCCAGATGTGGTGGTGGG - Intergenic
1170785655 20:19465091-19465113 AGATAGCCACATGTGGCCAGTGG + Intronic
1171009304 20:21499561-21499583 AAATAGCCACATGTGGCCAGTGG - Intergenic
1171223757 20:23423367-23423389 AAATAGCCACCAGTGGTGAGTGG - Intergenic
1172158085 20:32843717-32843739 ATATAGACACATGTGGTTGATGG + Intronic
1172238022 20:33391425-33391447 AAATAGCCACATGTGGCTAGTGG + Intronic
1172595119 20:36145735-36145757 TCATAGCCACATGTGGTTAGTGG - Intronic
1172668829 20:36619777-36619799 AAATAGCCACGTGTGGTGACAGG - Intronic
1172757431 20:37296079-37296101 AAAAAGCCACATGTGGCCAAAGG - Intronic
1173200389 20:40950430-40950452 AAATAGCCACATGTGGTTGGTGG - Intergenic
1174126997 20:48313972-48313994 AAAAAGCCAGATGTGGAGAATGG - Intergenic
1174509854 20:51042849-51042871 ACATTGCCCCTTGTGGTGAGTGG + Intergenic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1175045298 20:56099310-56099332 AAAAAGCCACTTGTGCTGAAGGG + Intergenic
1175526110 20:59634895-59634917 AAATAGCCACCTGTGGCTAATGG + Intronic
1176914540 21:14609252-14609274 ACATAGACACATGTACAGAAAGG - Intronic
1177554643 21:22673071-22673093 ACATTCCCACATGTTGTGAGAGG + Intergenic
1177790496 21:25717512-25717534 ACAAAGCCACCTGTGGAAAAAGG - Intronic
1177964792 21:27714375-27714397 AAATAGCCTCATGTGGTGGCAGG + Intergenic
1178092198 21:29176325-29176347 AATTAGCCAGATGTGGTGATGGG - Intergenic
1178985746 21:37301401-37301423 AATTAGCCACATGTGGTGGTGGG - Intergenic
1179155544 21:38847892-38847914 GCATAGCCGCATGTGATGACAGG + Intergenic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1180764688 22:18339456-18339478 AATTAGCCACATGTGGTGGCGGG + Intergenic
1180814341 22:18780227-18780249 AATTAGCCACATGTGGTGGCGGG - Intergenic
1181200527 22:21214564-21214586 AATTAGCCACATGTGGTGGCGGG - Intronic
1181983930 22:26786034-26786056 ACATAGCCCCATGTTGGGAGCGG + Intergenic
1182409034 22:30166376-30166398 CAATAGCCACATGTGGTAAGTGG - Intronic
1182776375 22:32834299-32834321 AATTAGCCAGATGTGGTGGAGGG - Intronic
1183920241 22:41160827-41160849 AAATAGCAACATGTGGCTAATGG - Intronic
1183993250 22:41613073-41613095 AAATAGCCACATGTGGTCAGTGG - Intronic
1184078437 22:42199736-42199758 AATTAGCCAGATGTGGTGACAGG + Intronic
1184303170 22:43575337-43575359 ACATAGCCGGATGTGGTGGCTGG - Intronic
1184718506 22:46295812-46295834 ACATAGCAACATGGAGTGATTGG + Exonic
1185400950 22:50616542-50616564 AAATAGCCAGATGTGGTGGCAGG + Intergenic
1203264440 22_KI270734v1_random:5914-5936 AATTAGCCACATGTGGTGGCGGG - Intergenic
949317583 3:2773906-2773928 ACTTAGCCAGATGTGGTGGCGGG - Intronic
949938370 3:9135065-9135087 AAATAGCCACATGTGGCTAGTGG - Intronic
950298150 3:11849794-11849816 ACTTAGCCAGATGTGGTGGCGGG - Intergenic
950888792 3:16384723-16384745 AAATAGCCACATGTGGCTAGTGG - Intronic
951122837 3:18948628-18948650 AGTTAGCCACATGTGGTGGTGGG - Intergenic
951126704 3:18993338-18993360 CAATAGCCACATGTGGCTAATGG - Intergenic
951648012 3:24915461-24915483 CAATAGCCACATGTGGCTAATGG + Intergenic
951691909 3:25405623-25405645 AAATTGCCACATGTGGTTAGTGG - Intronic
952205129 3:31173544-31173566 CAACAGCCACATGTGGTGAATGG - Intergenic
952366275 3:32677640-32677662 AAATAGCCAGATGTGGTGGCGGG + Intergenic
952521568 3:34163952-34163974 AAATAGCCACATGTGGCTAGTGG - Intergenic
952707508 3:36394168-36394190 AACTAGCCACATGTGGTTAATGG - Intronic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
952793807 3:37221260-37221282 AAATAGCTACATGTGGCTAATGG - Intergenic
953034437 3:39199994-39200016 CAGTAGCCACATGTGGTGAGTGG + Intergenic
953168298 3:40484741-40484763 AAATAGCCACATGTGGCTAGTGG + Intronic
953611724 3:44452569-44452591 ACATTGCCACATGAGCAGAAAGG - Intronic
953774393 3:45803167-45803189 CAATAGCCACATGTGGTTAGTGG + Intergenic
953801407 3:46026729-46026751 AAATAGCCAGGTGTGGTGACGGG - Intronic
953967418 3:47320352-47320374 AAATAGTCACATGTGGCTAATGG + Intronic
955025883 3:55166947-55166969 AAATAGCCACGTGTGGTAAGGGG + Intergenic
955293955 3:57718431-57718453 AAATAGCCAAATGTGGCTAATGG - Intergenic
955319633 3:57965000-57965022 ACCTAGCCACAGGTGGCAAAGGG + Intergenic
955710800 3:61777337-61777359 AAATAGCCACATGTGGCTAGTGG + Intronic
956068487 3:65422157-65422179 CCATAGCCACATGTGGCGAGTGG - Intronic
956215205 3:66841749-66841771 CCTTAGCCACATGTGGTTAGTGG + Intergenic
957261135 3:77902693-77902715 ACATAGCCAGATGTAGTGGCAGG + Intergenic
958712533 3:97735075-97735097 ATATAGCCACATGTGTCTAATGG - Intronic
958879245 3:99650789-99650811 AAATAACCACATGTGGCTAATGG + Intronic
960432537 3:117587262-117587284 CAATAGCCACATGTGGTGGGTGG + Intergenic
960844784 3:121995413-121995435 ACACAGCCACATAGGGTGTAGGG + Intronic
961899659 3:130198240-130198262 AATTAGCCACGTGTGGTGGATGG + Intergenic
961933112 3:130554687-130554709 ACACATCCACCTGTGGAGAAGGG + Intergenic
962110727 3:132443910-132443932 AAATAGCCACATGTAGTTAGCGG - Intronic
962925113 3:139985943-139985965 AAATAGCCACATGTGGCTAGTGG + Intronic
963208236 3:142658325-142658347 AATTAGCCAGATGTGGTGATGGG + Intronic
963547251 3:146675570-146675592 CAATAGCCACATGTGGCTAAGGG + Intergenic
963707798 3:148709960-148709982 AAATAGCCACATATAGTAAATGG - Intronic
963933500 3:151028420-151028442 AGTTAGCCAAATGTGGTGATGGG - Intergenic
964683984 3:159374836-159374858 CTATAGCCACATGTGGCTAATGG - Intronic
964801311 3:160562156-160562178 TAATAGCCACATGTGGTTAGTGG - Intronic
965493715 3:169371543-169371565 ACATAACTACATGAGGTGATGGG + Intronic
966104281 3:176317149-176317171 AAATAGCCACATGTGATAAGTGG + Intergenic
966337037 3:178879992-178880014 AAATAGCCATATTTGGTTAATGG + Intergenic
966658578 3:182388087-182388109 CAATAGCTACATGTGGTTAACGG + Intergenic
966794898 3:183704000-183704022 AAATAGCCAGATGTGGTGGTGGG + Intronic
969100475 4:4764556-4764578 AAATAGCCACAGGTTGTGAAAGG - Intergenic
969147984 4:5141063-5141085 AAATATCCACATGTGGTTAGTGG - Intronic
969232385 4:5840659-5840681 AGATAGCCACGTGTGGTTAGTGG + Intronic
969313704 4:6369141-6369163 AAATAGCCACATGTGGCCAGTGG - Intronic
970851249 4:20605585-20605607 ACATACCCACATGTAATGCATGG - Intronic
971070295 4:23083197-23083219 CAATAGCCACATGTGATTAATGG - Intergenic
971477523 4:27086323-27086345 AAATAGCCCCATGTGGTTAGAGG - Intergenic
971529483 4:27667194-27667216 ACATTGCCAAATGTCCTGAAGGG + Intergenic
972491217 4:39589233-39589255 AATTAGCCAGATGTGGTGATGGG - Intronic
973644345 4:52935064-52935086 AAATAGCCACATGTGGCTAGTGG + Intronic
974015150 4:56642585-56642607 AAATAGCCACGTGTGGTGGCAGG + Intergenic
974733830 4:65902357-65902379 AAATAGCCAGGTGTGGTGATGGG - Intergenic
975356008 4:73405439-73405461 ATATAGTCACATGTGGCTAATGG + Intronic
975480359 4:74872273-74872295 AAATAGCCACATGTAGCTAATGG - Intergenic
976869409 4:89772649-89772671 AAATAGCCAGGTGTGGTGACAGG - Intronic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
978136299 4:105265304-105265326 AAACAGCCACATGTGGATAATGG + Intronic
978718946 4:111882395-111882417 TCATAGCCACATGTGGCCAGTGG - Intergenic
978922764 4:114204177-114204199 AATTAGCCAGATGTGGTGATGGG + Intergenic
979290381 4:118973531-118973553 ACATATTTACATTTGGTGAAGGG - Intronic
980005734 4:127540401-127540423 ACATAGCCATATTTAGTGACAGG - Intergenic
980040648 4:127935831-127935853 AAATAGCCACATGTGGCTAATGG + Intronic
980420800 4:132558273-132558295 ACTTAGTGACAAGTGGTGAAGGG + Intergenic
980482985 4:133413602-133413624 AATTAGCCAGATGTGGTGACAGG - Intergenic
980944676 4:139307650-139307672 AAATAGTCACATGTGGTGAATGG + Intronic
981960824 4:150536764-150536786 ACATAAACAAATGAGGTGAAAGG + Intronic
982360614 4:154515286-154515308 TAATAGCCACATGTGGCTAATGG - Intergenic
982375969 4:154690977-154690999 CCATAGCCACATGTGGTGAGTGG - Intronic
983528737 4:168787489-168787511 AAATAGCCACATGTGGTTAGTGG - Intronic
984156012 4:176196880-176196902 AAATAGCCACATGTGGCTAGTGG - Intergenic
984488028 4:180397376-180397398 AATTAGCCAGATGTGGTGATGGG - Intergenic
984791671 4:183620434-183620456 ACATAACCACATGTGGCTAGTGG - Intergenic
985172041 4:187161091-187161113 AGATAGCCACATGTGGTTGATGG + Intergenic
985801297 5:2006798-2006820 ACATCTCCACATTTGGTGTAGGG + Intergenic
985948970 5:3208757-3208779 AAATAGCCAGATGTGGTGGCTGG - Intergenic
986786193 5:11116250-11116272 ACATTGCCACATGTCCTGCAGGG - Intronic
987160288 5:15134498-15134520 AAATAGCCATATGTAGTGAGTGG + Intergenic
987177354 5:15328185-15328207 AATTAGCCAGATGTGGTGATGGG + Intergenic
988341019 5:29972070-29972092 AAATAGCCACATGTGGCTAGTGG + Intergenic
988790473 5:34602975-34602997 AAATAGCCAGATGTGGTGGCGGG + Intergenic
988916278 5:35896593-35896615 AAATAGCCACATGTGGCTAGTGG - Intergenic
989245416 5:39248931-39248953 AAATAGCTACATGTGGCTAATGG - Intronic
989381045 5:40809782-40809804 TTGTAGCCTCATGTGGTGAAAGG - Intergenic
990294698 5:54389146-54389168 AAATAGCCAGATGTGGCTAATGG + Intergenic
990686864 5:58313770-58313792 CAATAGCCACATGTGGATAATGG - Intergenic
990875688 5:60482451-60482473 ACATGGCCCCATATAGTGAAAGG - Intronic
990963508 5:61419513-61419535 AAATAGCCACATGTGGCTAGTGG - Intronic
991159317 5:63478155-63478177 ACTTAGCCAGGTGTGGTGGAGGG + Intergenic
991449303 5:66734753-66734775 AAATAGCCACATGTGGTTGGTGG + Intronic
991647842 5:68819099-68819121 ACAAAGCCACATGGAGTGACAGG + Intergenic
991943375 5:71876492-71876514 TAATAGCCACATGTGGCAAATGG - Intergenic
992894855 5:81236998-81237020 AATTAGCCACATGTGGTGGTGGG + Intronic
992952111 5:81869699-81869721 ACATCACCACAGGTAGTGAAGGG - Intergenic
993171418 5:84424312-84424334 CAAAAGCCACATGTGGTTAATGG + Intergenic
993522215 5:88916662-88916684 CAATAGCCACATGTGGTCAGGGG + Intergenic
994159418 5:96539460-96539482 ACATAGAAACATGAGTTGAAAGG - Intronic
994366704 5:98925898-98925920 AAATAGCCACATGTGGCTAGTGG + Intronic
994384563 5:99114662-99114684 AAATAGCCACATGTGGCTAATGG + Intergenic
995259707 5:110088834-110088856 ACATAGCATCATAGGGTGAATGG + Intergenic
996089595 5:119338046-119338068 TCAGGGGCACATGTGGTGAAGGG - Intronic
996145564 5:119971127-119971149 TAATTCCCACATGTGGTGAAAGG - Intergenic
996471430 5:123865705-123865727 CGATAGCCACATGTGGCGAGTGG + Intergenic
997167799 5:131680150-131680172 AAATAGCCACATGTGGCTGACGG + Intronic
997263550 5:132481595-132481617 AAATAGTCACATGTGGTCAGTGG - Exonic
997330909 5:133060957-133060979 AAATAGCCACATGTGGCTAGTGG + Intronic
998027676 5:138833340-138833362 CAATAGCCACATATGGTGAGTGG - Intronic
998051227 5:139037380-139037402 AAATTCCCAAATGTGGTGAAAGG - Intronic
998268988 5:140690153-140690175 ACATAACCACATGTGGTGGCCGG + Intronic
998411723 5:141916250-141916272 AAAAAGCCCCAGGTGGTGAAGGG - Intergenic
998546818 5:143035785-143035807 ACTTAGCCAGATGTGGTGGTGGG + Intronic
999048401 5:148494765-148494787 CATTAGCCACATGTGGTGAGTGG - Intronic
999285131 5:150390081-150390103 ACTTACCCACATGTGCTGATGGG + Intronic
999294822 5:150452592-150452614 AATTAGCCAGGTGTGGTGAAGGG - Intergenic
999451339 5:151680556-151680578 AAATAGCCACATGTGGCTAGTGG + Intronic
999902205 5:156096522-156096544 TCATTGCCCCATCTGGTGAATGG + Intronic
1000408235 5:160911447-160911469 CCCTGGCCACATTTGGTGAACGG - Intergenic
1001267677 5:170286601-170286623 AAGTAGCCACATGTGGTTAGAGG + Intronic
1001631248 5:173177276-173177298 AATTAGCCAGATGTGGTGATGGG + Intergenic
1001703062 5:173721339-173721361 ACACAGCCTGATGTGGTGAGTGG - Intergenic
1002091330 5:176808431-176808453 ACACAGCCAGATGTGGTGGTGGG - Intergenic
1002670587 5:180863025-180863047 AAATAGCCACATGTGGCTAATGG + Intergenic
1002742752 5:181445264-181445286 ACACAGCCACATGTGGGACAGGG - Intergenic
1003445944 6:6184461-6184483 TGCTAGCCACATGTTGTGAAAGG + Intronic
1003957794 6:11180414-11180436 AAATAGCCACATGTGTTTAGTGG - Intergenic
1004518671 6:16342022-16342044 ACATAGCCAGGTGTGGTGGCAGG - Intronic
1004582332 6:16966156-16966178 AATTAGCCAGATGTGGTGATGGG - Intergenic
1004738249 6:18430134-18430156 AAATAGCCACATGTGGCTAGTGG - Intronic
1004784891 6:18957237-18957259 CCATAGCCACATGTGGGTAGTGG + Intergenic
1005100057 6:22161983-22162005 AAATAGCCACATGTGGCTAGTGG + Intergenic
1005594976 6:27370314-27370336 AAATAGCTACATGTGGGGAATGG - Intergenic
1006681111 6:35797322-35797344 ACAGAGCCAGCTGTGGTGATGGG + Intronic
1007911523 6:45519977-45519999 AAATAGCCAGATGTGGTGGTGGG - Intronic
1008559373 6:52708814-52708836 AAATAGCCAGGTGTGGTGATGGG - Intergenic
1008873544 6:56301672-56301694 AAATAGCCACATGTGGTTAGTGG - Intronic
1009742889 6:67770387-67770409 AAATAGCCATATGTGGTGGTGGG - Intergenic
1009968380 6:70601637-70601659 ACAAAGCCAGATGTGTAGAAGGG - Intergenic
1010886193 6:81244351-81244373 AGATAATCATATGTGGTGAACGG + Intergenic
1011226714 6:85115945-85115967 TCAGAGCCAGATGTGATGAATGG + Intergenic
1011631693 6:89332543-89332565 CCATAGCCACATGTGGCTAATGG - Intronic
1011772561 6:90691192-90691214 AAATAGCCACATGTGGTTAATGG - Intergenic
1011820380 6:91246224-91246246 CAATAGCCACATGTGGCTAATGG + Intergenic
1012426339 6:99118799-99118821 GAATAGCCACATGTGGTGGGTGG - Intergenic
1012673504 6:102086993-102087015 TTAGAGCCACATGTGGTTAATGG - Intergenic
1012742523 6:103036690-103036712 AATTAGCCAGATGTGGTGACAGG + Intergenic
1012880652 6:104783855-104783877 ACATTGCCACATTTCCTGAAAGG - Intronic
1012988417 6:105899465-105899487 ACTTAGCCAGGTGTGGTGACAGG - Intergenic
1013986675 6:116202043-116202065 CGGTAGCCACATGTGGTTAATGG - Intronic
1014425028 6:121293760-121293782 ACTTAGCCAGATGTGGTGGCAGG + Intronic
1015451737 6:133377391-133377413 AAATAGCCACGTGTGGTTAGTGG + Intronic
1015487324 6:133787561-133787583 ACATAGCCAGCTGTGGGGACAGG + Intergenic
1015820780 6:137258356-137258378 GAATAGCCACATGTGGTCAGTGG - Intergenic
1016085855 6:139913457-139913479 AAATAGCCACATGTGGCTATTGG + Intergenic
1016378314 6:143447256-143447278 AAATAGACACATGTGGTTAGTGG + Intronic
1016518241 6:144921299-144921321 AAATAGCCACATGTGGCTAGTGG + Intergenic
1016696498 6:147002262-147002284 AAATAGTCACATGTGGTTAATGG - Intergenic
1017033409 6:150244693-150244715 AAATAGCCACATATGGTTAGTGG + Intronic
1017185123 6:151592817-151592839 ACATAGCCAAATGTGTTGTTTGG + Intronic
1017245588 6:152221084-152221106 ACATATCCACATTTGGTGAGAGG - Intronic
1017938956 6:159034194-159034216 ACATAGCTAGGTGTGGTGATGGG - Intergenic
1018217297 6:161541273-161541295 AAATAGCCATATGTGGCTAAAGG + Intronic
1018376078 6:163214255-163214277 AAATAGCCACATGTGGCTAGTGG + Intronic
1019143286 6:169961732-169961754 AAGTAGCCACATGTGGCTAAGGG + Intergenic
1019247885 6:170721003-170721025 ACACAGCCACATGTGGGACAGGG - Intergenic
1019280717 7:198613-198635 ACAAAGGCACACGTGGTGCATGG - Intronic
1019423249 7:961395-961417 ACATAGCGTCAGGTGCTGAAGGG - Intronic
1020334883 7:7055633-7055655 AAATAGCCACATGTGGCTAGTGG + Intergenic
1021668954 7:23015553-23015575 TGATAGCCACATGTGGCTAATGG - Intergenic
1022311622 7:29201606-29201628 AAATAGCCACATGTGACTAATGG - Intronic
1022711524 7:32855268-32855290 AAATAGCCACATGTGGCTAGTGG + Intergenic
1022913133 7:34919691-34919713 AAATAGCCACATGTGGCTAGTGG - Intergenic
1022961950 7:35435540-35435562 AAATAGCCACGCGTGGTGACAGG + Intergenic
1023374678 7:39544150-39544172 TGATAGCCACACGTGGTGAGTGG - Intergenic
1023576198 7:41629973-41629995 TCATAGCCAAATGAGTTGAAAGG - Intergenic
1023642723 7:42276671-42276693 ACATAGCCACATTTGGGCAAGGG - Intergenic
1026093620 7:67322664-67322686 CAATAGCCACATGTGGTCAGGGG - Intergenic
1026477257 7:70747605-70747627 ACATAGCCAGGTGTGGTGGTGGG - Intronic
1026869796 7:73843316-73843338 AAATAGCCACATGTGGCTAGTGG + Intergenic
1027357121 7:77368405-77368427 AAATAGCCACATGTGGCTATTGG + Intronic
1027434384 7:78149162-78149184 CCACAGCCACATGTGGCTAATGG + Intronic
1028338639 7:89690679-89690701 AAATAGCCAGGTGTGGTGGAAGG - Intergenic
1029093716 7:98068623-98068645 AAATAGCCACATGTGGCTAGTGG - Intergenic
1029255203 7:99264969-99264991 ACTCAGCCACATGTGGTTAGCGG - Intergenic
1029310780 7:99661852-99661874 AAATAGCCACATGTGGATAGTGG - Intronic
1029928930 7:104350146-104350168 AAATAGCCACATGTGGTGACAGG - Intronic
1030258919 7:107542822-107542844 AAATAGCCAAATGTGGTGGCAGG + Intronic
1030648196 7:112087992-112088014 ACATACCCAACAGTGGTGAAGGG + Intronic
1030696535 7:112590947-112590969 AATTAGCCAGATGTGGTGACAGG + Intergenic
1030964708 7:115976474-115976496 AAATAGACACATGTGGTTCATGG + Intronic
1031675521 7:124607032-124607054 ATATAGCCACATGTGGCTAGTGG - Intergenic
1032059146 7:128709138-128709160 TCAAAGCCACATGTTGAGAAGGG + Intronic
1032261856 7:130344619-130344641 AAATAGCCACATGTGGCTAATGG - Intergenic
1032288433 7:130562918-130562940 TCACAGCCACATGTGGTCAGTGG - Intronic
1032590541 7:133188064-133188086 TCATAGCCACATGCAGTGAAAGG + Intergenic
1032965029 7:137086495-137086517 TAATTCCCACATGTGGTGAAAGG - Intergenic
1035500230 8:86861-86883 ACACAGCCACATGTGGGACAGGG + Intergenic
1036248936 8:7145267-7145289 AATTAGCCACGTGTGGTGGACGG - Intergenic
1037577025 8:20216201-20216223 AGATAGCCACATTTGGCTAATGG + Intronic
1038471862 8:27830733-27830755 AAATAGCCACATGTAGCTAATGG + Intronic
1039133704 8:34296741-34296763 AAATAGCCACATGTGGCTAATGG - Intergenic
1041154295 8:54968762-54968784 ACATAGCCAGGTGTGGTGGTAGG + Intergenic
1041428591 8:57751542-57751564 AAATAGCCACGTGTGGTTAATGG - Intergenic
1041454295 8:58041087-58041109 AATTAGCCACATGTGGTGGTGGG - Intronic
1041492029 8:58443657-58443679 AATTAGCCGCATGTGGTGACAGG + Intronic
1041878883 8:62723509-62723531 ACAAAGCCGGATGTGTTGAATGG + Intronic
1042129360 8:65571859-65571881 ACTTAGCCAGATGTGGTGGTGGG - Intergenic
1042235195 8:66605257-66605279 CAATAGCCACATGTGGCTAATGG + Intronic
1042322665 8:67494218-67494240 ACATAGCAACATGTCATGAAGGG + Intronic
1042597737 8:70467557-70467579 AAGTAGCCACATGTGGTGGCAGG + Intergenic
1042881484 8:73496853-73496875 CAATAGCCACATGTGGCTAATGG + Intronic
1043384868 8:79738287-79738309 CCATAGCCACATGTGGCTAGTGG + Intergenic
1044208900 8:89526105-89526127 AAATAGCCACATGTGGTTAGTGG + Intergenic
1044246589 8:89954547-89954569 ACAAAACCACATTTGGTGAGAGG + Intronic
1044522830 8:93219225-93219247 AAACAGCCACATGTGGCTAATGG - Intergenic
1044526458 8:93257369-93257391 AAATAGTCACATGTGGTTAGTGG + Intergenic
1044752127 8:95426463-95426485 ACATGGACACATGAGGTGCAGGG + Intergenic
1044768920 8:95608647-95608669 TAATAGCCACATGTGGTTAGTGG + Intergenic
1044781205 8:95745204-95745226 ACTTAGCCACATGTGATTAGTGG + Intergenic
1044837275 8:96308582-96308604 CAATAGCCACACGTGGTGAGTGG - Intronic
1044890651 8:96831949-96831971 CAATAGCCACATGTGGCTAATGG + Intronic
1044966930 8:97582824-97582846 AAATAGCCACATGTGGTTAATGG - Intergenic
1045601105 8:103717957-103717979 AAATAACCACATGTGGCTAATGG + Intronic
1046352705 8:113036563-113036585 ACAGAGCAACATGTGCAGAAAGG + Intronic
1049098489 8:140562759-140562781 CCATAGCCACATGTGGCTAGTGG - Intronic
1050297326 9:4218728-4218750 AAATAGCCACATGTGGCTAATGG + Intronic
1050373348 9:4945512-4945534 ACTTAGCCAGATGTGGTGGCAGG - Intergenic
1050728489 9:8679466-8679488 AGATACCCGCAAGTGGTGAAAGG - Intronic
1050733769 9:8739491-8739513 ACACAGCCACATGTGGCTAGTGG + Intronic
1051062688 9:13063034-13063056 AAATAGCCACATGTGGCTAGTGG + Intergenic
1051666486 9:19471544-19471566 AGATAGCCACATATGATTAACGG + Intergenic
1051863651 9:21654217-21654239 ACTTAGCCAGGTGTGGTGATGGG - Intergenic
1053563192 9:39217885-39217907 ACATTCCCAGATGTGGTGAGGGG + Intronic
1053828977 9:42055801-42055823 ACATTCCCAGATGTGGTGAGGGG + Intronic
1054133955 9:61401194-61401216 ACATTCCCAGATGTGGTGAGGGG - Intergenic
1054601582 9:67131634-67131656 ACATTCCCAGATGTGGTGAGGGG - Intergenic
1054841094 9:69741025-69741047 CAATAGCCACATGTGGCTAATGG + Intronic
1054856641 9:69907248-69907270 AGATAGCCACATTGGGTGTAAGG + Intergenic
1054961482 9:70975014-70975036 AATTAGCCAGATGTGGTGATGGG - Intronic
1055234085 9:74098807-74098829 AAATAGCCACATGTGGCTAGTGG + Intergenic
1055385302 9:75755610-75755632 TAATAGCCACATGTGGCCAATGG + Intergenic
1055507314 9:76961641-76961663 AAATAGTCACATGTGGTTAGTGG + Intergenic
1055582482 9:77721701-77721723 ACCTATCCACATTTTGTGAATGG - Intronic
1055771967 9:79727187-79727209 AAGTAGCCACATGTGGCTAATGG + Intergenic
1055972420 9:81924886-81924908 AAATAGGCACATGAGGTCAAGGG + Intergenic
1055974173 9:81939958-81939980 AAATAGGCACATGAGGTCAAGGG + Intergenic
1056421501 9:86432007-86432029 AATTAGCCAGATGTGGTGATGGG + Intergenic
1057050900 9:91923389-91923411 AAATAGCCACATGTGATTAATGG + Intronic
1058000826 9:99863259-99863281 ACACAGCCACATGGAATGAATGG - Intronic
1058657695 9:107238871-107238893 CAGTAGCCACATGTGGTTAATGG - Intergenic
1058805214 9:108583894-108583916 CAATAGCCAGATGTGGTGAATGG - Intergenic
1059907693 9:119006580-119006602 ACATTGCAAGATTTGGTGAAAGG + Intergenic
1061505156 9:131027657-131027679 ACTTAGCCACATGTGGCCAGTGG + Intronic
1203608655 Un_KI270748v1:76482-76504 ACACAGCCACATGTGGGACAGGG - Intergenic
1185593257 X:1292301-1292323 AAATACCCACATGTGTGGAAGGG - Intronic
1186082651 X:5950204-5950226 CAATAGCCACATGTGGTTATTGG - Intronic
1186169730 X:6864037-6864059 CCATAGCCACATGTAGTGAGTGG + Intergenic
1186430715 X:9502012-9502034 CCACAGCCACATGTGGCGCATGG - Intronic
1186830516 X:13385344-13385366 AAATAGCCACATGTGTTTAGTGG - Intergenic
1186841336 X:13487467-13487489 CCATGACCACATGTGGTGATGGG + Intergenic
1187094197 X:16129311-16129333 AAATAGCCACATGTGGTTAGTGG - Intronic
1187286330 X:17907522-17907544 AAATAGCCACATGTGAGTAATGG + Intergenic
1187411600 X:19055416-19055438 AAATAGCCACATGTAGCTAATGG - Intronic
1187941826 X:24390073-24390095 AAATAGCCACATGTGGTTAGTGG + Intergenic
1188322355 X:28755352-28755374 ACACAGCCACATGTGGCTAGTGG - Intronic
1188526249 X:31090958-31090980 ACATAGCCCAATGTGGTGGCAGG + Intergenic
1188741991 X:33795676-33795698 AAATAGTCACATGTGGCTAATGG - Intergenic
1188914945 X:35898882-35898904 AAATAGCCACATGTGGCTAGTGG + Intergenic
1189115906 X:38342435-38342457 CCATTGGCACATGTGGTGAGAGG - Intronic
1189579032 X:42386301-42386323 AAATAGCCACATGTGGCTAGCGG + Intergenic
1189999050 X:46667456-46667478 ATATAGCCACATGTGGCTAATGG - Intronic
1190588146 X:51967866-51967888 ACATTGCCAGCTGTGGTGTATGG - Intergenic
1191011604 X:55765437-55765459 CAATAGCCACATGTGCTGAGTGG - Intergenic
1192588180 X:72337363-72337385 ACTTAGCCACATGTGGCTAGTGG + Intronic
1193737691 X:85179164-85179186 AAATAGCCACATGTGGCTAGTGG + Intergenic
1194272710 X:91837912-91837934 TAATAGCCACATGTGGTTAGTGG + Intronic
1195769976 X:108340346-108340368 AAATGGTCACATGTGGTTAATGG + Intronic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1196688502 X:118533138-118533160 AATTAGCCAGATGTGGTGATGGG - Intronic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1197799489 X:130334716-130334738 CAATAACCACATGTGGTGAGTGG - Intergenic
1197951521 X:131902600-131902622 ACATAGCCACCTGTGGCTAATGG - Intergenic
1198108837 X:133484842-133484864 AATTAGCCAGGTGTGGTGAAAGG - Intergenic
1199199011 X:145065916-145065938 AAATAGCCAGATGTGGTGGCAGG - Intergenic
1199975368 X:152892070-152892092 AAATAGCCACATGTGGCCAGTGG + Intergenic
1200495481 Y:3878033-3878055 AATTAGCCAGATGTGGTGATGGG + Intergenic
1200790314 Y:7293619-7293641 AAATAGCCAGATGTGGTGGCGGG - Intergenic
1200836384 Y:7736125-7736147 AAATAGCCACATGTGGCTAGTGG - Intergenic
1201757111 Y:17498405-17498427 AATTAGCCAGATGTGGTGACAGG - Intergenic
1201844443 Y:18407578-18407600 AATTAGCCAGATGTGGTGACAGG + Intergenic
1201864739 Y:18637746-18637768 ACATCCCCACATGTGTAGAATGG + Intergenic
1201868583 Y:18682632-18682654 ACATCCCCACATGTGTAGAATGG - Intergenic
1201935674 Y:19408351-19408373 GCAAACCCACATGTGGTGGATGG + Intergenic
1202031614 Y:20580854-20580876 ACATAGTCACATGCGGTTAGTGG - Intronic