ID: 1165227706

View in Genome Browser
Species Human (GRCh38)
Location 19:34366061-34366083
Sequence GTGGAAGCCCTGGGAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 625}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165227695_1165227706 23 Left 1165227695 19:34366015-34366037 CCATCCCTGTCATCTGGATGGGT 0: 1
1: 0
2: 2
3: 20
4: 167
Right 1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 625
1165227699_1165227706 -1 Left 1165227699 19:34366039-34366061 CCTGAGTAACTTACGGCAGAAAG No data
Right 1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 625
1165227696_1165227706 19 Left 1165227696 19:34366019-34366041 CCCTGTCATCTGGATGGGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 625
1165227697_1165227706 18 Left 1165227697 19:34366020-34366042 CCTGTCATCTGGATGGGTGCCTG 0: 1
1: 0
2: 0
3: 59
4: 768
Right 1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 625
1165227691_1165227706 30 Left 1165227691 19:34366008-34366030 CCGATGGCCATCCCTGTCATCTG 0: 1
1: 0
2: 0
3: 25
4: 195
Right 1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG 0: 1
1: 0
2: 3
3: 61
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165227706 Original CRISPR GTGGAAGCCCTGGGAAGGGG TGG Intronic
900004571 1:36213-36235 TTGGAAGGCTGGGGAAGGGGAGG + Intergenic
900024293 1:206729-206751 TTGGAAGGCTGGGGAAGGGGAGG + Intergenic
900088672 1:909964-909986 GTGGGGGTCCTGGGCAGGGGCGG + Intergenic
900148335 1:1167802-1167824 GTGGAAGCCCAGGGAAGAACCGG - Intergenic
900188361 1:1343258-1343280 GGGGAAGCCCTGGGGGGGGGGGG - Intronic
900212319 1:1462207-1462229 CGGGGAGCCCAGGGAAGGGGAGG - Intronic
900224989 1:1528826-1528848 GGGGGAGCCCAGGGAAGGGGAGG - Intronic
900241732 1:1620542-1620564 GTGGACGGCCTGGCAGGGGGTGG + Intronic
900344685 1:2205146-2205168 GGGGGAGCCCGGGGGAGGGGCGG - Intronic
900409220 1:2505241-2505263 CTGGAGGCCCAGGGCAGGGGTGG + Exonic
900476903 1:2880250-2880272 GTGGAGGCTCAGGGAGGGGGCGG + Intergenic
900808000 1:4780513-4780535 GTGGAAGAGGTGGGCAGGGGTGG + Intronic
900934706 1:5758066-5758088 GGGGCAGCCCTGGGCAGGAGAGG - Intergenic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
901052526 1:6432446-6432468 GTGGAGGCTCTGGGAAAGGAAGG + Intronic
901232058 1:7646822-7646844 GTGGAGGCCCTGGCAAGTGTGGG + Intronic
901608107 1:10475138-10475160 GGGGAGGACCTGGGGAGGGGCGG - Intronic
902005029 1:13225477-13225499 GTGAAAGCCCAGGTCAGGGGTGG - Intergenic
902024255 1:13371271-13371293 GTGAAAGCCCAGGTCAGGGGTGG - Intronic
902459963 1:16567003-16567025 TTGGAAGCCCAGGCAAGGGATGG - Intronic
902481717 1:16715590-16715612 GTGGAGGCTCTGGGAAAGGAAGG - Intergenic
902770191 1:18641315-18641337 GTCGGAGGTCTGGGAAGGGGTGG + Intronic
903132524 1:21289465-21289487 GCGGAGACCCTGGGGAGGGGAGG + Intronic
903218895 1:21857937-21857959 GAAGAAGCCCCGGGGAGGGGTGG - Intronic
903278157 1:22234330-22234352 GGGGAGGCCCTGGGATGGAGCGG - Intergenic
903280755 1:22248637-22248659 GTGGAAGCCCTGGGGGGAGAGGG + Intergenic
903392194 1:22972508-22972530 GGGGGAGCCATGGGAAGAGGAGG - Intergenic
903538953 1:24086052-24086074 GTGGGAGCCCTGGGAAGCTGGGG + Intronic
904029941 1:27527756-27527778 GTGGTTGTCCTGGGAGGGGGCGG - Intergenic
904633839 1:31864261-31864283 GTGGTACTCCTGGGAAGGAGTGG + Intergenic
904683764 1:32246710-32246732 GTTGAAGCCCTGGGAGGGGCAGG + Intergenic
904702435 1:32365948-32365970 GAAGAAGCCCTGGGAAGGCATGG + Intronic
904809930 1:33156922-33156944 GTGGAGGGGGTGGGAAGGGGTGG - Intronic
905174792 1:36128442-36128464 GTGGAAGCCCCTGGCAGGGGCGG - Intergenic
905381668 1:37566094-37566116 GTGGAAGCTCTGCTAAGGAGAGG - Exonic
905456661 1:38092749-38092771 GAGGAAGGACTGGGTAGGGGAGG + Intergenic
906963280 1:50432377-50432399 GTGGAGGCCCTGAGAAGAGATGG - Intergenic
907540664 1:55214073-55214095 GTGGGAGGCCTGGGCAGGGGTGG - Intronic
907851849 1:58262263-58262285 GTGCAAGCCCAAGGAAAGGGAGG + Intronic
908321611 1:62984126-62984148 CTGGAAGCCATTGGGAGGGGTGG + Intergenic
910162762 1:84291877-84291899 GTTGAAGGCCTGGGGAGAGGAGG - Intergenic
911002482 1:93180519-93180541 GGGGAAGCCATGGGAACCGGAGG - Exonic
912453601 1:109783285-109783307 GGGGGTGTCCTGGGAAGGGGAGG + Intergenic
912619530 1:111140596-111140618 GTGGGAGCCCAAGGTAGGGGTGG + Intronic
913156877 1:116108387-116108409 ATAGAAGCCCAGTGAAGGGGTGG + Intergenic
914177654 1:145293027-145293049 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914178199 1:145297785-145297807 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914178744 1:145302547-145302569 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914179122 1:145305716-145305738 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914179498 1:145308899-145308921 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914180042 1:145313655-145313677 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914180587 1:145318427-145318449 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914181130 1:145323189-145323211 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914181673 1:145327937-145327959 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914182218 1:145332704-145332726 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914182763 1:145337460-145337482 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914183308 1:145342210-145342232 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914183852 1:145346968-145346990 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914184396 1:145351740-145351762 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914184940 1:145356502-145356524 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914185485 1:145361249-145361271 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914186031 1:145366003-145366025 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914186577 1:145370763-145370785 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914187121 1:145375511-145375533 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914187664 1:145380263-145380285 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914188209 1:145385017-145385039 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914188752 1:145389767-145389789 CTGGAAGCCCAGGCAAGGGATGG - Intronic
914870895 1:151473056-151473078 GTGGGAGCCCGGGGTAGGGAGGG + Intergenic
915121899 1:153634477-153634499 GCGGAGCCCCTGCGAAGGGGCGG + Intronic
915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG + Intronic
915289824 1:154876038-154876060 GGGAAAGCTCTGGGCAGGGGTGG - Intergenic
915568703 1:156732086-156732108 GGGGATGCCTGGGGAAGGGGAGG + Exonic
915603855 1:156938797-156938819 GTGGAATCCCAGGGGAGGGCAGG + Intronic
915944133 1:160137349-160137371 GCGGAAGGCCAGGGGAGGGGTGG - Intronic
916060960 1:161098444-161098466 GGGGAAGCCCGCGGAAGGCGAGG + Exonic
916479627 1:165203126-165203148 GTTGAATCACTGGGCAGGGGTGG - Exonic
916579288 1:166093379-166093401 GTGGGAGCAATGGGAAGGGCAGG - Intronic
917481352 1:175414799-175414821 GAGGAAGGACTGGGAAGGTGAGG + Intronic
917924068 1:179774370-179774392 ATGGATGCCCAGGGAAGTGGTGG + Intronic
917935112 1:179858857-179858879 GGGGAAAACCTGGGGAGGGGAGG + Intronic
917956251 1:180101899-180101921 GTGGCAGCCCAGGGAAGGCATGG - Intronic
918127247 1:181595536-181595558 GTGGGAGACCCGGGAAGGGGAGG - Intronic
919867577 1:201793876-201793898 GTGAGAGGCCTGGGAAAGGGTGG + Intronic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920216904 1:204367410-204367432 GTGGAGGCAGTGGGAAGGGAAGG - Intronic
920274904 1:204797380-204797402 TTTGAAGGCCTGGGAAGTGGAGG + Intergenic
920527026 1:206674848-206674870 GAGGGAGCCCTGGGAGGGGCAGG + Intronic
921594542 1:217039852-217039874 TGGGAAGCACTGGGATGGGGTGG - Intronic
922316403 1:224446766-224446788 TTGGAAGCACTGGGAAGAGGGGG + Intronic
922614754 1:226955179-226955201 GTGGGAGCCCTGGGAGGATGAGG + Intronic
922677510 1:227561643-227561665 GTCCAAGCCGGGGGAAGGGGCGG + Intergenic
922812704 1:228426694-228426716 GTTGGAGCCCAGGGAGGGGGGGG + Intergenic
922962883 1:229663368-229663390 GTGGCAGTCCTGGGAATGTGGGG - Intergenic
923520934 1:234734531-234734553 GTGGATGACATGGGAATGGGGGG + Intergenic
924801004 1:247329721-247329743 GGAGAAGCCCTGGGAAAGGTAGG + Intronic
1062769140 10:85837-85859 CTGGGAGGCCTGGGAAGTGGCGG + Intergenic
1062825839 10:567963-567985 GTGGATGTCCTGGGATGGGATGG - Intronic
1062939031 10:1408011-1408033 GTGTGAGCCCTTGGAAGGTGGGG - Intronic
1063539120 10:6914317-6914339 GTGGAATCTCTGGGAAGGAGTGG - Intergenic
1063925797 10:10976014-10976036 GTTGTTGCCCTGGAAAGGGGTGG + Intergenic
1065505055 10:26421912-26421934 CAGAAAGCACTGGGAAGGGGAGG - Intergenic
1067373170 10:45703528-45703550 ATAGAAGCCCTGGGTCGGGGGGG + Intergenic
1067386606 10:45822594-45822616 ATAGAAGCCCTGGGTCGGGGGGG - Intergenic
1067447663 10:46362006-46362028 ATAGAAGCCCTGGGTCGGGGGGG + Intergenic
1067469158 10:46523626-46523648 TAGGAGGCCCTGGGAAGGGAAGG + Intergenic
1067589716 10:47498754-47498776 ATAGAAGCCCTGGGTCGGGGGGG - Intergenic
1067636840 10:48006861-48006883 ATAGAAGCCCTGGGTCGGGGGGG - Intergenic
1067876650 10:50013481-50013503 ATAGAAGCCCTGGGTCGGGGGGG + Intergenic
1068886447 10:62102810-62102832 GTGGAAGCTCAGGACAGGGGAGG + Intergenic
1069726403 10:70583029-70583051 GTGGAAGCCCTGGGTAGGTGGGG + Intergenic
1069726418 10:70583065-70583087 GTGGAAGCCCTGGGTGGTGGGGG + Intergenic
1069740042 10:70681674-70681696 GTGGGCGCCCTGGGAAGCTGCGG + Intronic
1069945558 10:71983067-71983089 GGGGAGGCCCCAGGAAGGGGAGG + Intronic
1070133386 10:73670876-73670898 ATAGAAGCCCTGGGTCGGGGGGG - Intergenic
1070604761 10:77890912-77890934 GGGGGAGCCCTGGGAGGGTGTGG - Intronic
1070655385 10:78267621-78267643 CTGGGAGCCCTGGGCTGGGGTGG + Intergenic
1070737297 10:78871996-78872018 GTAGTGGCCCTGGGAAGGGGTGG - Intergenic
1070892227 10:79949553-79949575 TTGGAATACCTGGGCAGGGGTGG + Intronic
1071555834 10:86600682-86600704 GTATTAGCCCTGGGAAGAGGGGG + Intergenic
1071608285 10:87013204-87013226 ATAGAAGCCCTGGGTCGGGGGGG + Intergenic
1071685894 10:87756105-87756127 GTGAAATCCCTAGGAAGGTGAGG + Intronic
1071695372 10:87863885-87863907 GTGGAAGCCGTGGGCTCGGGCGG + Exonic
1072692667 10:97582247-97582269 GTGGTACCCCTGGGAAGGCGGGG - Intronic
1072945364 10:99805090-99805112 GAGAAAGCCTTGGGAAGGGCAGG + Intronic
1073289087 10:102404596-102404618 GTGGCAGCGCTGGGCAGGAGAGG + Exonic
1074702904 10:116108040-116108062 CTGAGAGCCCTGGGAGGGGGTGG + Intronic
1074771840 10:116739972-116739994 GTGGCAGTCCTGGGTTGGGGAGG - Intronic
1074914877 10:117945961-117945983 GGGGAAGCCCTGACAAGGGAGGG - Intergenic
1075808910 10:125210153-125210175 GTGCAGGCCCTGGGAGGGAGGGG + Intergenic
1075988136 10:126806245-126806267 CAGGATGCCCTGGGGAGGGGAGG - Intergenic
1076299990 10:129418655-129418677 GTGGAAGCTCTTGGAAGCGTAGG + Intergenic
1076335525 10:129704002-129704024 GTGGAAGCCCTGTGCAGTGAGGG - Intronic
1076454291 10:130578721-130578743 GCAGCAGCCCAGGGAAGGGGAGG - Intergenic
1076978638 11:193570-193592 GAGGAAGCCCTGGGGAGGAGAGG + Intronic
1076983135 11:215876-215898 GAGGAAGCCCTGGCGAGGGTGGG + Exonic
1077080549 11:722885-722907 GGGGGAGCTCTGGGGAGGGGTGG - Intronic
1077248103 11:1548820-1548842 GAGGAAGCTCTGGGAAGGAAAGG - Intergenic
1077406634 11:2385348-2385370 GTGGTTGCCCTGGGACGGGGAGG - Intronic
1077477459 11:2797175-2797197 GGGGAGGCCCTGTGAAGAGGAGG + Intronic
1077964705 11:7117012-7117034 GCGCAAGACCTGGGATGGGGTGG + Intergenic
1078136642 11:8657457-8657479 ATGGAGGCCCTGGGACAGGGAGG + Intronic
1079081604 11:17417068-17417090 TTGGAAACCCTGGGAATGGGTGG - Intronic
1079128292 11:17733984-17734006 GTTGAAGCCCTAGGAAGTGCGGG + Intergenic
1080571331 11:33559666-33559688 ATGGAGGCCATGGGAGGGGGAGG - Intronic
1081279138 11:41187115-41187137 GGGGAAGTGTTGGGAAGGGGAGG + Intronic
1081461345 11:43275376-43275398 GTGTAAGCCCAGGGAAGGGCAGG + Intergenic
1081794337 11:45809278-45809300 GTGGGAGCTCTGGGCAAGGGAGG + Intronic
1081862622 11:46342178-46342200 GTGCCAGCCCTGGGAAGCTGGGG - Intronic
1082219039 11:49610345-49610367 GTGGGGGCACTGGGAAGGGGAGG - Intergenic
1082769048 11:57191577-57191599 GTGGGAGGGCTGGGGAGGGGTGG + Exonic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084148160 11:67275836-67275858 GCAGAAGCCTTGGGAAGGAGAGG - Intronic
1084416455 11:69035594-69035616 GTGGAGAGCCTGGGAAGGGTGGG - Intergenic
1084479211 11:69409028-69409050 ATGGAAGCCCTGGGCAGGCGTGG - Intergenic
1084520995 11:69662830-69662852 TTGGGAGCCCAGGGGAGGGGAGG - Intronic
1084649305 11:70479383-70479405 CTGGAGGCCTTGGGAAGGGGAGG + Intronic
1084768117 11:71325507-71325529 GAGGAGGCCCTGTGAAGGGGAGG + Intergenic
1084951710 11:72670024-72670046 GGGGAAGCCCTGGGCCGTGGTGG - Intronic
1085201687 11:74705844-74705866 GGGGAATCTCTGGGAAGGGGAGG + Intronic
1085216254 11:74835449-74835471 GTGGAGGCACAGGGAAGGGGAGG - Intronic
1085385783 11:76157389-76157411 GTGGGAGGCCTGGGAAGGGGAGG + Intergenic
1086630610 11:89014529-89014551 GTGGGGGCTCTGGGAAGTGGAGG + Intronic
1086872883 11:92060539-92060561 CTGGATGCCATGGCAAGGGGAGG + Intergenic
1087223625 11:95573237-95573259 TTGGAATCTCTGGAAAGGGGTGG + Intergenic
1087422518 11:97948395-97948417 ATGGAAGTGCTGGGAAGGGAAGG + Intergenic
1089070781 11:115697908-115697930 TTGGGAGCCTAGGGAAGGGGTGG - Intergenic
1089338682 11:117743253-117743275 GTGGAGGCCCAGGGAGGAGGAGG + Intronic
1089348761 11:117809307-117809329 GTGGGAGCTGTGGGAAGGGAGGG + Intronic
1089617478 11:119703095-119703117 GTGCAGGCCCTGGGAAGTGCTGG - Intronic
1089644724 11:119871221-119871243 GTGGAAGCCATCTGAAGGTGGGG + Intergenic
1090884200 11:130861812-130861834 GTGGAAGACCTAGGAAGCTGTGG + Intergenic
1091033151 11:132209664-132209686 GTGGAATCCCCAGGAAGGAGAGG + Intronic
1091112176 11:132979759-132979781 GTTGAGGCCCTGGGAGAGGGAGG + Intronic
1091279413 11:134373628-134373650 GGGGAAGCCCTGGGAAGCTGGGG - Intronic
1091377990 12:38265-38287 TTGGAAGGCTGGGGAAGGGGAGG + Intergenic
1091687589 12:2574700-2574722 ATGGAAGAGCTGGGAAGGTGTGG - Intronic
1091717463 12:2789370-2789392 CTGGAAGCCCTGGCCAGGGGTGG - Intergenic
1091740642 12:2958948-2958970 CTGGGAGGCCGGGGAAGGGGCGG - Intergenic
1092157749 12:6295372-6295394 GGGGCAACCCTGGGAAGGTGAGG + Intergenic
1092206304 12:6616108-6616130 GAGGAAGAACTGGGAAGAGGAGG + Intergenic
1092257866 12:6937030-6937052 TTGAGGGCCCTGGGAAGGGGAGG - Exonic
1093089332 12:14904190-14904212 ATGGAAGCGCTGGGTAGAGGAGG + Intronic
1093441559 12:19203463-19203485 GTGGAGGACCTGGGAACTGGTGG - Intronic
1095371784 12:41476561-41476583 GTAGGAGCATTGGGAAGGGGAGG - Intronic
1095938850 12:47712690-47712712 GGGGAAGCCTTGGCATGGGGTGG - Intronic
1095979328 12:47962259-47962281 GTGGAGGTCTGGGGAAGGGGGGG + Intergenic
1096244119 12:49974840-49974862 CTGGCAGCCCTGGGGAGGGAAGG + Intronic
1097830678 12:64221837-64221859 GTGGAAGCCCAGGGAAGGAAAGG + Intronic
1098167145 12:67710325-67710347 GTGGAAGCCCTGAGAAACGCAGG + Intergenic
1098819402 12:75209073-75209095 GATGAAGCCCTGGGGAGAGGTGG - Intronic
1100689814 12:97027845-97027867 TAGGAAGCCCAGGAAAGGGGAGG + Intergenic
1101055417 12:100907433-100907455 GTGGAAGCACGGGGAAGTAGGGG - Intronic
1101822236 12:108192832-108192854 GTGGGAGCCCAGGGAAGTGAGGG - Intronic
1102681980 12:114697055-114697077 GCCGACGCCCTGGGAGGGGGTGG + Intergenic
1102769105 12:115457862-115457884 ATGGAAGCTGTGGAAAGGGGTGG - Intergenic
1102907343 12:116687173-116687195 GTGGAAACCCTTGAAATGGGAGG + Intergenic
1103009550 12:117447827-117447849 TTTGGAGCCCTGGGAAGGGCAGG + Intronic
1103429705 12:120872699-120872721 GTGGGAGCTCTGGGAAGTGTTGG - Intronic
1103919631 12:124392755-124392777 GTCTAAGGCATGGGAAGGGGAGG - Intronic
1103924026 12:124413923-124413945 GTGGGAGTCCTGGGGTGGGGGGG - Intronic
1103955784 12:124576013-124576035 GGGGACGCCCTGGGAAATGGGGG + Intergenic
1104109264 12:125689925-125689947 GGGGAAAGCCTGTGAAGGGGAGG - Intergenic
1104854076 12:131894214-131894236 GGGGAAGGCATGGGAGGGGGCGG + Intergenic
1104903067 12:132199410-132199432 GTGGGCTGCCTGGGAAGGGGTGG + Intronic
1105251019 13:18698329-18698351 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1105933025 13:25070025-25070047 GAGGAAGGACTGGAAAGGGGTGG - Intergenic
1106622649 13:31385772-31385794 ATGGAAGTGCTGGGAAGGGAAGG - Intergenic
1106667715 13:31870146-31870168 GCAGTTGCCCTGGGAAGGGGTGG - Intergenic
1106709623 13:32315856-32315878 ATGGAGACCCAGGGAAGGGGCGG - Intronic
1106795446 13:33200353-33200375 GTGGAAGCCCTTGGCAAGGCAGG + Intronic
1106840673 13:33682374-33682396 GGGGAAGATGTGGGAAGGGGGGG - Intergenic
1107621204 13:42232300-42232322 GTGGGAGGGCAGGGAAGGGGAGG + Intronic
1107787773 13:43971602-43971624 GAGGAAGCCCGGGGGAGGTGGGG - Intergenic
1107966700 13:45603970-45603992 GTGGAAGGAATGGGAAAGGGAGG - Intronic
1108483318 13:50898127-50898149 GTGAAGGCCCTGGAGAGGGGAGG - Intergenic
1108691487 13:52862974-52862996 GGGCAAGGCCTGGGAAGGGGTGG + Intergenic
1112478447 13:99752953-99752975 GGGGAAGGCCTGTGAAGGGAAGG + Intronic
1113260434 13:108555752-108555774 GTGGAAGGTGTGGTAAGGGGAGG - Intergenic
1113345318 13:109472189-109472211 GGGCAAGACCAGGGAAGGGGAGG + Intergenic
1113574712 13:111387100-111387122 GTGGACACCCTGGGAGGGAGGGG - Intergenic
1113856459 13:113448966-113448988 GTGCCAGGCCTGGGGAGGGGCGG - Intronic
1113967869 13:114164718-114164740 GTAGAAGCACTGGGAAAGGACGG - Intergenic
1114529443 14:23386615-23386637 CAGGGAGGCCTGGGAAGGGGTGG + Exonic
1114679882 14:24475420-24475442 GTGGAAGCACTGGCAGGAGGTGG + Intergenic
1115428359 14:33287398-33287420 GTGTAGGTCCTGGGAAGGTGGGG + Intronic
1116492879 14:45526883-45526905 GCAGGAGCCCTGGGAAGGGCTGG - Intergenic
1117333567 14:54737386-54737408 GCGTAAGCCTGGGGAAGGGGTGG - Intronic
1117736969 14:58777535-58777557 ATGGGAACCCTGGGCAGGGGTGG - Intergenic
1117868024 14:60169638-60169660 GTGGCTGCCTAGGGAAGGGGTGG - Intronic
1117881380 14:60316525-60316547 GTGGGGCCCCTGGGAAGGAGAGG - Intergenic
1118486261 14:66216705-66216727 GTGCAAGTCCTGTGAAGGAGGGG - Intergenic
1118798416 14:69166800-69166822 GTGGAAGAATTTGGAAGGGGAGG + Intergenic
1119443637 14:74646517-74646539 GTGAAAGGCCTGGGACGGAGTGG + Intergenic
1119654107 14:76404640-76404662 TTCTAAGCACTGGGAAGGGGAGG - Intronic
1119777221 14:77256768-77256790 GGGGAGGGCCTGGCAAGGGGAGG + Exonic
1121168856 14:91836453-91836475 GGGGAGGCCCTGGGAAAGGCAGG - Intronic
1121222846 14:92299434-92299456 GTGAAAGCACAGGGAAGTGGGGG - Intergenic
1121223618 14:92305314-92305336 GAGGAAGACCTGGGAAGGCCAGG - Intergenic
1121323440 14:93006248-93006270 GCTGGAGCCCTGGGAAGGGCTGG + Intronic
1122149799 14:99718719-99718741 GTGGGAGCTCTGGGGAGGTGGGG + Intronic
1122207958 14:100157543-100157565 GTGGAACTCCTGGGGAGGGCTGG - Intronic
1122387956 14:101361828-101361850 GTGGAAGCGCTGGAAATGTGTGG - Intergenic
1122446861 14:101775925-101775947 GGAGAGGCTCTGGGAAGGGGAGG + Intronic
1122502845 14:102212679-102212701 GGGGAGGGCCTGGGGAGGGGTGG + Intronic
1122509769 14:102257014-102257036 GTGGGAGCCTGGGGAAGGGATGG - Intronic
1122598584 14:102909622-102909644 GTGGGAGCCCTGGCAGGTGGTGG - Exonic
1122884332 14:104703902-104703924 GCTGCAGCCCTGGGAAGGGACGG - Exonic
1122886089 14:104711065-104711087 GTGGCTGCCCTGGGAGGGGCAGG - Exonic
1122922330 14:104885174-104885196 GACCCAGCCCTGGGAAGGGGAGG - Intronic
1123016275 14:105377153-105377175 GTGCAAGCTCTGGGCTGGGGAGG + Intronic
1123477001 15:20597482-20597504 GGGGAGGTCCTGGGAAGAGGCGG - Intergenic
1123641012 15:22402882-22402904 GGGGAGGTCCTGGGAAGAGGCGG + Intergenic
1123685591 15:22794936-22794958 CTGGAAGAGCTGGGATGGGGGGG - Intronic
1124271127 15:28281773-28281795 GGGGATGCCCTGAGAAGGGCAGG - Intronic
1125390424 15:39186607-39186629 GAGGAAGAACGGGGAAGGGGAGG - Intergenic
1125743044 15:41980752-41980774 AAGGAAGTCCTGGGAAGGGAAGG + Intergenic
1125920184 15:43520774-43520796 GTGGTAGCACTGGCAAGGGTGGG - Intronic
1126475752 15:49063517-49063539 GGGGAAGTGCTGGGAAGGGAAGG - Intergenic
1128079174 15:64845989-64846011 GTGGAAGGCCTGGCAGGGGCTGG + Intronic
1128775064 15:70313944-70313966 CTGGAAGACCAGGGAAGGGTTGG - Intergenic
1128793250 15:70448402-70448424 GTGGAACCCCAGGGAAGGCGTGG - Intergenic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129683253 15:77670475-77670497 GTGGAAGCTCTGGGAGGGTGGGG + Intronic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130791857 15:87163845-87163867 CTGGAAGCCCTTGCAAGTGGAGG - Intergenic
1130966319 15:88700319-88700341 CTGGTAGCCATGGGCAGGGGAGG - Intergenic
1131183827 15:90258376-90258398 GTGAAAGCCCTGGGGTGGGCAGG + Intronic
1132110052 15:99096312-99096334 GCGGAAAGCCTGGGAATGGGAGG + Intergenic
1132448937 15:101954731-101954753 TTGGAAGGCTGGGGAAGGGGAGG - Intergenic
1132572680 16:650876-650898 GAGGCAGCCCTGGGGTGGGGCGG + Intronic
1132646962 16:1003583-1003605 GTGGTGGTCCCGGGAAGGGGTGG + Intergenic
1133239745 16:4407462-4407484 GGGGCTGCCCTGGGAAGGGCAGG + Intronic
1134242013 16:12513259-12513281 GAGGGAGCACTAGGAAGGGGAGG - Intronic
1135303262 16:21348849-21348871 GTGGAAGCATGGGTAAGGGGGGG - Intergenic
1135615550 16:23908111-23908133 GTGGAATCCCTGGGAGCTGGGGG + Intronic
1135698292 16:24609823-24609845 TTGGAAGCTGTGGGGAGGGGAGG + Intergenic
1135969398 16:27061347-27061369 GAGGGAGCCCTGGGGAGGGTGGG - Intergenic
1136300005 16:29328043-29328065 GTGGAAGCATGGGTAAGGGGGGG - Intergenic
1136485834 16:30571292-30571314 CCTGAAGCCCTGGGAACGGGAGG + Intronic
1137328982 16:47471298-47471320 GAGGAAGGCCTGGGATGGGCAGG + Intronic
1137387626 16:48055962-48055984 TTGGAAGGGCTGGGAAGGGAGGG + Intergenic
1137485323 16:48885705-48885727 GTGGCAGCCCTGGGGAGCTGGGG + Intergenic
1137576706 16:49604801-49604823 GTGGCAGCCCAGGAATGGGGTGG - Intronic
1137591203 16:49695033-49695055 ATGGAAGCCCAGGGAGGGGAAGG - Intronic
1137617139 16:49855119-49855141 GGAGAAGGCCTGGGCAGGGGCGG + Intronic
1138458239 16:57133338-57133360 CTGGCAGCCCAGGGGAGGGGAGG - Intronic
1138547331 16:57727674-57727696 GTGGGAGCCCTGAGTAGAGGTGG - Intronic
1139534090 16:67561157-67561179 GTGGAATCCCTGGGCAGAGAAGG - Intergenic
1139882662 16:70188029-70188051 GGCGAAGCCCTGGGAAGCAGTGG - Intergenic
1140369847 16:74407490-74407512 GGCGAAGCCCTGGGAAGCAGTGG + Intergenic
1141171292 16:81693369-81693391 GTGGGAGGTGTGGGAAGGGGAGG - Intronic
1141602585 16:85135426-85135448 GAGGAAGCACTGGGAAGTGCTGG + Intergenic
1142061741 16:88034813-88034835 GTGGAAGCATGGGTAAGGGGGGG - Intronic
1142243107 16:88956044-88956066 TTGGCAGCCCTGGGCAGGGTCGG - Intronic
1142466069 17:138061-138083 GAGGAAGCCCTGGGGAGGAGAGG + Intronic
1142587280 17:981160-981182 GTGGAAGCTCTGAGAGGGGCGGG - Intergenic
1142645687 17:1312580-1312602 GGGGACCCCCTGGGAATGGGGGG + Intergenic
1142806428 17:2373375-2373397 GTGGAAGGCCTGCGAGGTGGTGG + Exonic
1143433962 17:6908947-6908969 GTGGCTGCTCAGGGAAGGGGTGG + Intronic
1143651275 17:8265476-8265498 GTGGGAGCCCCAGGGAGGGGAGG + Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1143772912 17:9179721-9179743 GAGGCAGCCCTGGGTAGGGAAGG + Intronic
1144236172 17:13262551-13262573 GTGGAAGGTCAGGGATGGGGAGG + Intergenic
1144466842 17:15503912-15503934 ATGGAAGGGCTGGGAAGGGTGGG + Intronic
1144505234 17:15823675-15823697 GTGGTAGCCTAGGGTAGGGGAGG - Intergenic
1145169408 17:20641531-20641553 GTGGTAGCCTAGGGTAGGGGAGG - Intergenic
1145353994 17:22119495-22119517 GTGGGAGTGCTGGGAAGGGAAGG - Intergenic
1145786234 17:27595665-27595687 CAGGGAGCCCTGGGAAGGGAGGG - Intronic
1146180974 17:30697967-30697989 GGGGCAGCCCGGGGAAGGGAGGG - Intergenic
1146272135 17:31491450-31491472 GAGGAAGAGCAGGGAAGGGGAGG + Intronic
1146577937 17:34011474-34011496 GAAGAAGCCATGGGAGGGGGAGG - Intronic
1147604865 17:41768891-41768913 ATGGAAGCTCAGGGAAGGGAGGG + Intronic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1147644937 17:42027861-42027883 GGGTAGGCCCTGGGAAGGGGAGG + Intronic
1147702341 17:42404051-42404073 AGAGAAGCCCTGGGAAGGAGGGG - Exonic
1147920341 17:43912422-43912444 GTGCAAACCCTGGGAGTGGGGGG + Intergenic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1148677885 17:49455596-49455618 CTGGTAGCTCTGGGAAGGGCTGG + Intronic
1148782960 17:50131833-50131855 GTGGAAATCTGGGGAAGGGGTGG + Intergenic
1148819065 17:50349755-50349777 GGGGAAGTCCTGGGGAGGTGAGG + Intronic
1149389640 17:56175946-56175968 GTGGGAGGTCTGGGAAAGGGAGG + Intronic
1149494192 17:57106718-57106740 CTGGTAGGCCTGGCAAGGGGAGG - Exonic
1149684844 17:58529379-58529401 GTGGGAGCCAAGGGAAGGGGAGG - Intronic
1151214379 17:72567797-72567819 TGGGAAGCCTTGGGGAGGGGAGG + Intergenic
1151223960 17:72634813-72634835 GTGGCAGCCCTGGGAAGAGAAGG + Intergenic
1151426420 17:74033752-74033774 GTGGAAGGACTGGGCAGAGGAGG - Intergenic
1151814934 17:76467110-76467132 TGGGCAGCCCTGGGAATGGGTGG + Intronic
1152146237 17:78570440-78570462 GTGAGAGCCATGGGAAGGGAAGG - Intronic
1152203912 17:78963516-78963538 CTGGAAGAGCTGGGAAGGTGGGG - Intergenic
1152276243 17:79359233-79359255 CTGGCAGCCCTGGGGAGGGGCGG - Intronic
1152464631 17:80458826-80458848 GTGGAAGCCCAGGGTCAGGGAGG + Intergenic
1152577761 17:81150393-81150415 GGGGGAGCCCTAGGATGGGGTGG - Intronic
1152614436 17:81331321-81331343 GTGGGAGAGCTGGGACGGGGTGG - Intergenic
1152697330 17:81803790-81803812 GGGGACGCCCTGGGACGCGGAGG - Intergenic
1152745313 17:82036124-82036146 GTGTGTGCCCTGGGTAGGGGTGG - Intronic
1153382265 18:4454074-4454096 CGGGAGGCCGTGGGAAGGGGTGG - Intronic
1154437831 18:14360585-14360607 CTGGAAGCCCTGGGATTTGGGGG - Intergenic
1157074329 18:44448603-44448625 TTGGAAGCCCTGGAAATGGATGG - Intergenic
1157199462 18:45646731-45646753 GGGGAAGCCCTGGGGAAGGTGGG - Intronic
1157297383 18:46456215-46456237 ATGGTTGCCCTGGGAAGGTGGGG + Intronic
1157656898 18:49399349-49399371 TGGCATGCCCTGGGAAGGGGTGG + Intronic
1158162141 18:54497160-54497182 GTGGAAGCCCTGGGAAGCCTAGG + Intergenic
1159010910 18:63057917-63057939 ATGGATGCCCGGGGAGGGGGTGG + Intergenic
1159687297 18:71438377-71438399 GTGGAAACCCTGGGGAGGTAAGG + Intergenic
1160074379 18:75658398-75658420 GTGGAAGCGGTGGGGAGGAGGGG + Intergenic
1160168730 18:76535115-76535137 AGGGAAGGCATGGGAAGGGGAGG - Intergenic
1160411479 18:78678035-78678057 GTGGCAGCTCTGGGAAGCAGAGG - Intergenic
1160514824 18:79472430-79472452 GGGAAACCCCTGGGAAGGAGAGG - Intronic
1160636323 19:77822-77844 TTGGAAGGCTGGGGAAGGGGAGG + Intergenic
1160770563 19:828988-829010 GGGGAGGCCCAGGGAAGGGAAGG + Intronic
1160770588 19:829054-829076 GGGGAGGCCCAGGGAAGGGAAGG + Intronic
1161250316 19:3276480-3276502 GGAGAGGCCCTGGGAAGGGTCGG + Intronic
1161318984 19:3632421-3632443 GTGGCAGCCTGGGGAAGAGGAGG + Exonic
1161379620 19:3958213-3958235 GTGGAAGCTCTGGGCAGCTGAGG - Intergenic
1161404305 19:4083091-4083113 GGAGAAGTCCTGGGAAGGAGGGG - Intergenic
1161452617 19:4354935-4354957 GTGGAAGTCCTGGGGAAGGGAGG - Exonic
1161597316 19:5157248-5157270 GCAGGGGCCCTGGGAAGGGGTGG - Intergenic
1161769229 19:6222380-6222402 CTGGAAGCCCGGGGTGGGGGTGG + Exonic
1161979797 19:7624448-7624470 GTGGGGACCCAGGGAAGGGGAGG + Intronic
1161998625 19:7729928-7729950 GAGGAAGCCCTAGAAAGGAGGGG + Exonic
1162065193 19:8121209-8121231 GTGGGCGCCCTGGGCAGGGAGGG - Intronic
1162806129 19:13138844-13138866 GTGGAAGCACTGGGAGGTGGTGG - Exonic
1162811992 19:13169889-13169911 GTGGAACCACTGGGAAGTTGAGG - Intergenic
1163529550 19:17841754-17841776 CTGGAGGACCTGGGAAGGAGGGG + Exonic
1163554503 19:17984471-17984493 ATCTAAGCCCTGGGAAGGAGTGG + Intronic
1163630956 19:18417696-18417718 GAGGAAGCTGGGGGAAGGGGCGG + Intergenic
1163717258 19:18879642-18879664 GGGGAGGGACTGGGAAGGGGAGG - Intronic
1163831219 19:19548012-19548034 GTGGGGGTCCTGGGGAGGGGTGG + Intergenic
1163832200 19:19552480-19552502 GTGGAACCCCAGGGAAAGGAGGG - Intergenic
1164415066 19:28040040-28040062 GTGGCTGCCCTGGGACAGGGAGG + Intergenic
1164573083 19:29387992-29388014 GTGGAAGCCTTGGGAGGTGAAGG - Intergenic
1164981681 19:32619225-32619247 GAGGAAGGGCTGGGGAGGGGAGG - Intronic
1165116705 19:33533221-33533243 TTGCAAGTCCTGGGAGGGGGAGG - Intergenic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165394610 19:35557632-35557654 GTGAGACCCCTGGGCAGGGGAGG - Intronic
1165591614 19:36973791-36973813 TTGGGAGGCCTGGGAGGGGGCGG + Intronic
1165822312 19:38684405-38684427 GGGGCAGCACTGGGAAGGTGTGG - Intronic
1166063524 19:40342639-40342661 ATGGAGGACCTGGGAAGGGAGGG + Intronic
1166406942 19:42528281-42528303 GAGGACACCCTGGGAAGGGGCGG - Intronic
1166662682 19:44657527-44657549 GTGGAAGCCCTGAGGAGAGGTGG + Intronic
1166864361 19:45827056-45827078 GTGGCTGCCCTGGGGAGGGAGGG - Intronic
1166982462 19:46639331-46639353 GCGGGAGCCCTAGGAAGAGGTGG + Intergenic
1167074773 19:47241307-47241329 GGGGAAGGGCTGGGAGGGGGAGG + Intergenic
1167297866 19:48662336-48662358 GTGGAATTCTTGGGAAGGAGGGG + Intronic
1167483449 19:49746613-49746635 GGGGCAGCCCTGGGACGTGGCGG + Exonic
1168517276 19:57018230-57018252 GTGTCAGGACTGGGAAGGGGAGG - Intergenic
1168517286 19:57018269-57018291 GTGTCAGGACTGGGAAGGGGAGG - Intergenic
1168517296 19:57018326-57018348 GTGTCAGGACTGGGAAGGGGAGG - Intergenic
1168517314 19:57018404-57018426 GTGTCAGGACTGGGAAGGGGAGG - Intergenic
1168517324 19:57018443-57018465 GTGTCAGGGCTGGGAAGGGGAGG - Intergenic
1202676394 1_KI270711v1_random:10735-10757 TTGGAAGCCCAGGCAAGGGATGG - Intergenic
1202715756 1_KI270714v1_random:41502-41524 GTGGAGGCTCTGGGAAAGGAAGG - Intergenic
925169546 2:1742818-1742840 CTGGAGGCCCTGGGGCGGGGCGG - Intronic
925611372 2:5705767-5705789 GTGGAGGACCTGAGAAGGGGTGG + Intergenic
926081940 2:9994493-9994515 GTTTAAGCCCTGGGAATGGATGG - Intronic
926126648 2:10276514-10276536 GTGGCAGCCATGGGGAGGTGAGG - Intergenic
926127348 2:10279696-10279718 GTGGAAGTCCTGGGTAGGCTGGG - Intergenic
926750833 2:16197406-16197428 GTGGAGGCCCTGGCATGGGTGGG - Intergenic
926760207 2:16271776-16271798 GTGGAAGTCCTGGGAAAAGCAGG - Intergenic
926787212 2:16530267-16530289 TGGGAAGCCCTAGGAAGGGTAGG + Intergenic
927060714 2:19416825-19416847 CTGGAAGTCCTGGGAGGGGCTGG + Intergenic
927197883 2:20560448-20560470 GTGGAATCCGTGGGGAGGTGAGG + Intronic
927292650 2:21420016-21420038 AGGGAAGCACTGGGAAGGAGAGG - Intergenic
929128166 2:38539438-38539460 GGAGAAGCCCTGGGAGGGAGTGG - Intergenic
929454188 2:42054695-42054717 GGGCAAGTCCTGGGAAGGGTTGG + Intronic
930076395 2:47409081-47409103 GGGGAGGGCCAGGGAAGGGGAGG + Intronic
930176867 2:48310008-48310030 GTGGAAAGCCTGGGAAGCTGAGG - Intergenic
930356758 2:50330474-50330496 GTGAAATCCCTGGGGATGGGAGG - Intronic
931016598 2:57988711-57988733 GTTGAAGGTCTGGGAAGAGGTGG - Intronic
932823745 2:74922309-74922331 CTGGAAGCTCTGAGAAGGTGGGG - Intergenic
934571263 2:95374684-95374706 GTGGAAAGCCTGGGTAGAGGTGG - Intronic
935713515 2:105919530-105919552 GTGGAAGGCCTGGAATGAGGAGG - Intergenic
935810184 2:106789979-106790001 GGGTAAGGACTGGGAAGGGGAGG + Intergenic
936565158 2:113577228-113577250 TTGGAAGGCTGGGGAAGGGGAGG - Intergenic
937226741 2:120374716-120374738 CGGGACTCCCTGGGAAGGGGAGG + Intergenic
937276415 2:120686911-120686933 GTGGAGGCCCTGGGAGGAGGGGG + Intergenic
937315694 2:120930822-120930844 GTGGGAGCCCTGGGCTGGGAAGG + Intronic
937347629 2:121136391-121136413 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
938030169 2:127985642-127985664 AGGGAAGTGCTGGGAAGGGGCGG + Intronic
938703402 2:133898931-133898953 CTGCAACCCCTGGGAAGTGGGGG + Intergenic
939393580 2:141600449-141600471 GTGGTAGAACTGGGAAGAGGAGG + Intronic
939560454 2:143725583-143725605 GTGGAACCACAGGGAAGGAGGGG - Intronic
940360418 2:152790768-152790790 AGGGAAGCTCTGGGAAGGGAAGG + Intergenic
941469667 2:165868968-165868990 TTGGAAGCCCTGCGAATGGAAGG - Intronic
941911906 2:170771561-170771583 CGGGAAGCCCTGGGATGGGCTGG - Intergenic
942037587 2:172025578-172025600 TTGGAAGCCCTGGGAGGCTGAGG - Intronic
942450415 2:176105370-176105392 GAAGAAGACATGGGAAGGGGCGG + Intronic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
944428833 2:199611725-199611747 TTGTAAGCCATGGGAAGGAGTGG - Intergenic
946237373 2:218332470-218332492 GTGGAAGCCCTTGGCAGGGCAGG + Intronic
946327131 2:218990541-218990563 CTGGAAGCAGTGGGCAGGGGAGG - Intronic
947998328 2:234547215-234547237 GTGTAAGCCCCTGGAGGGGGAGG - Intergenic
948132468 2:235610748-235610770 GTGGAAACCCTGGGCTGGGGAGG + Intronic
948176893 2:235950488-235950510 CTGGCAGCGCTGGGAAGGGAGGG + Intronic
948345868 2:237297661-237297683 GTGTAAGCACTGGGGAGGGAAGG - Intergenic
1168762233 20:357129-357151 GTGGGAGCCATGGGAAGGTTTGG - Intronic
1169068827 20:2709435-2709457 GTGGAATCCCTGGGCTGGAGGGG - Intronic
1169271050 20:4199677-4199699 GTGGTTGCCATGGAAAGGGGTGG + Intergenic
1170702106 20:18712996-18713018 GTGGAAACCCAGGACAGGGGAGG - Intronic
1171313935 20:24169515-24169537 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1171823278 20:29874500-29874522 GTCCAAGCCGGGGGAAGGGGCGG + Intergenic
1172358371 20:34295230-34295252 GTGGCAGCACTGGGAAACGGAGG + Intronic
1172600783 20:36181342-36181364 CTGCAAGCCCAGAGAAGGGGTGG - Intronic
1172631520 20:36381694-36381716 ATGGAAGCCCGGGGAAGGGAAGG - Intronic
1172776925 20:37413381-37413403 GTGCAGGCCCAGGAAAGGGGTGG - Intergenic
1172778070 20:37419763-37419785 CTGGGGGCCCTGGGAGGGGGGGG + Intergenic
1173023726 20:39288727-39288749 AAGGAGGCCCTGGGTAGGGGAGG - Intergenic
1173333112 20:42092082-42092104 GTGGAAGAGCTGAGAAGGGAGGG + Intronic
1173976117 20:47187995-47188017 GTGGAACCCGGGGGCAGGGGCGG + Intronic
1174035005 20:47663428-47663450 GAGCAAGCCCAGGGCAGGGGTGG - Intronic
1174308373 20:49631431-49631453 TTGGATTTCCTGGGAAGGGGTGG - Intergenic
1174339552 20:49887288-49887310 TTGGAGGCCTTGGGTAGGGGTGG + Intronic
1175112069 20:56655403-56655425 GTGGGAGGACTGGGAAGAGGAGG + Intergenic
1175287021 20:57843877-57843899 GTGCAAGCCCAGGGCAGTGGAGG + Intergenic
1175737432 20:61396806-61396828 CTGGAAGCCCTGGGGTGGGGAGG + Intronic
1175805947 20:61829607-61829629 GAGGAAGCCCTGGCGAGTGGGGG + Intronic
1175831128 20:61965940-61965962 GTGGCAGGCCAGGGGAGGGGCGG - Intronic
1176084575 20:63290151-63290173 GTTGAATCCCTGGGAGGGGCAGG - Intergenic
1176173483 20:63707138-63707160 GGAGAAGCCCGGGGGAGGGGAGG - Intronic
1176223675 20:63982029-63982051 GAGGAAGCCCAGGGAACAGGAGG + Intronic
1176238394 20:64064717-64064739 GGGTCTGCCCTGGGAAGGGGTGG + Intronic
1176728537 21:10465778-10465800 GTGGAGGGCCTGGGAAAGGAGGG + Intergenic
1179214052 21:39350500-39350522 GGGGAAGCCATCGGCAGGGGGGG + Intergenic
1179407782 21:41139738-41139760 GAGGAAGCCGTGGGAGCGGGAGG - Intergenic
1179635741 21:42707576-42707598 CAGGAAGCCCTGGGAGGGAGTGG - Intronic
1179715839 21:43287794-43287816 GTGGGTGCACTGGGAAGGGAAGG - Intergenic
1179842236 21:44084724-44084746 GTGGCTGGCATGGGAAGGGGGGG - Intronic
1179996719 21:44977616-44977638 CTGGAAGCCCTGGGATTTGGGGG + Intergenic
1180083348 21:45496731-45496753 GGTGAAGGCCTGGGAAAGGGAGG + Intronic
1180140906 21:45892945-45892967 GAGGGAGTCCTGGGGAGGGGAGG + Intronic
1180631664 22:17234214-17234236 GTGGAGCCACTGGGAAGAGGTGG - Intergenic
1180836007 22:18929782-18929804 GTGGCTGGCCTGGGAAGGGGAGG - Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182255783 22:29037290-29037312 GTGGAATTCCTGGTAAGTGGTGG + Intronic
1182283523 22:29231444-29231466 CTGGCAGCCCTGGGGTGGGGGGG - Intronic
1182567546 22:31211588-31211610 TTGGAAGACCTGGGAATGGTAGG + Intergenic
1182803226 22:33049264-33049286 ATTGAAGCCCTGGCAAGGAGTGG - Intronic
1183064314 22:35352928-35352950 GTGGAGGCCCAGGGAGGGGAGGG + Intergenic
1183149900 22:36028921-36028943 GTGGCAGCACCGGGAAGGCGGGG + Intergenic
1183401169 22:37605520-37605542 GAGGAACCCCTGAGAAGGGCAGG - Intergenic
1183590011 22:38774504-38774526 GTGGAGGCCCAAGGAAGGGATGG + Intronic
1183710159 22:39498632-39498654 GAGTAACCCCTGGGAGGGGGTGG + Intergenic
1184362525 22:44026834-44026856 GGGGAAGCTGGGGGAAGGGGCGG + Intronic
1184375000 22:44106195-44106217 GAGGAGGCTCTGGGAAGAGGGGG + Intronic
1184523192 22:45007699-45007721 GTGCGAGCGCGGGGAAGGGGCGG + Intronic
1184837253 22:47031373-47031395 GAGGCAACCCTGGGAAGTGGAGG + Intronic
1185270659 22:49928136-49928158 GTGCACGGCCTGGGAAGGGGGGG - Intergenic
1185270919 22:49929080-49929102 GTGCACAGCCTGGGAAGGGGGGG - Intergenic
1203286099 22_KI270734v1_random:155081-155103 GTGGCTGGCCTGGGAAGGGGAGG - Intergenic
949898050 3:8784999-8785021 GTGGAAGCCCTGGCAGGGAGAGG - Intronic
950107782 3:10399129-10399151 GTGGAAGCCCGGGGCAGGCATGG - Intronic
950297521 3:11845003-11845025 GGGGAAGCACAGGGAAGGGTAGG + Intronic
952310037 3:32180367-32180389 GCTGAAGCCCTGTGAAGGGTAGG + Intergenic
952316762 3:32238665-32238687 GTGGAGGCCCGGAGGAGGGGAGG - Exonic
952829356 3:37551609-37551631 ATGGATGCCGTGGGAATGGGTGG - Intronic
953040728 3:39252894-39252916 CTGGAAGGCCTGGGGAGGAGTGG + Intergenic
953880079 3:46686935-46686957 GGGGAAGCCGAGGGAAGGGAGGG - Intronic
953881902 3:46695057-46695079 GTGGAGGGCATGGGGAGGGGAGG - Intergenic
954387064 3:50249598-50249620 GTGCAGGCCCTGGGAAGGCTGGG - Intronic
954660709 3:52225473-52225495 GGGGATATCCTGGGAAGGGGTGG - Intronic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
954801431 3:53189247-53189269 GTGGAGGCCCTGGGCTGGGCTGG + Intronic
955088104 3:55722383-55722405 GTGGAAGCCCTGTGCATGGAGGG - Intronic
955397189 3:58565925-58565947 GCGGCAGCCCTGGGTAGGTGTGG + Exonic
956338207 3:68189103-68189125 GTGGAAGTTCTGTGAAGGTGAGG + Intronic
957896031 3:86421829-86421851 GTGGAAGCGCTGGGGAGAGGAGG - Intergenic
960943253 3:122948198-122948220 GTGGATGCCCTGGCTGGGGGTGG - Intronic
960945537 3:122963962-122963984 GTGGAAGCCCTGGGGAGAGAGGG - Intronic
961096963 3:124165789-124165811 GCGAAAGCACTTGGAAGGGGTGG - Intronic
961551780 3:127673624-127673646 GTGGAAGCCCAAGGAGGGGAAGG - Intronic
962020138 3:131491544-131491566 GAAGAAGGCCTGGGAAGGGCAGG - Intronic
962425252 3:135263717-135263739 GTGCAAGCCCTGGTAGGGGGTGG + Intergenic
962807750 3:138939047-138939069 GTGGAATCCCGAGGGAGGGGCGG - Intergenic
962866420 3:139451400-139451422 GGGGAAGCTCTAGGAAGGTGGGG + Intergenic
962873804 3:139520211-139520233 GTGGGAGGCCTGGGGTGGGGAGG - Intronic
963598902 3:147360397-147360419 GTGGCAGTTCTGGGATGGGGAGG - Intergenic
966876514 3:184325186-184325208 GCGGAAGGCCTGAGGAGGGGTGG + Intronic
967284862 3:187859179-187859201 GTGGAAGCCCTGTGCCTGGGTGG + Intergenic
967857703 3:194130866-194130888 GTGGGGGTGCTGGGAAGGGGGGG - Intergenic
968086878 3:195877781-195877803 GAGGCAGGCCTGGGAGGGGGTGG + Intronic
968274068 3:197426431-197426453 GTGGAGGGACTGGGAATGGGAGG - Intergenic
968523218 4:1043884-1043906 GGGGAGGCCCTGGGCTGGGGCGG - Intergenic
968578623 4:1379401-1379423 GCGGATGCCATGGGATGGGGGGG - Intronic
968600134 4:1504788-1504810 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
968628195 4:1637476-1637498 GTGGATGCTCTGGGAAGGGTGGG + Intronic
968839789 4:2994675-2994697 GTGGAAGAGGAGGGAAGGGGAGG + Intronic
969198699 4:5584596-5584618 GTGCAGGCGCTGGGAAGGAGAGG - Intronic
969317684 4:6391748-6391770 GGGGAAGCCCTGGGTGGGGCTGG + Intronic
969425161 4:7120010-7120032 GTGGGAGCTCTGGGAACAGGAGG + Intergenic
969466720 4:7361684-7361706 GTGGGGGCCCGGGGAAGGGCTGG + Intronic
969512036 4:7623624-7623646 GAGGACGCCGTGGGATGGGGAGG - Intronic
969648620 4:8448973-8448995 GGGGCAGCACAGGGAAGGGGAGG - Intronic
969691882 4:8708474-8708496 GTGGGAACCCTGGGATGGGGTGG + Intergenic
969860792 4:10033932-10033954 GGGGAAGCCCTTGAAAAGGGCGG - Intronic
970234597 4:13945465-13945487 ATGGAAGTGCTGGGAAGGGAAGG - Intergenic
974787133 4:66633079-66633101 GTGGTAGCAAGGGGAAGGGGAGG + Intergenic
976426827 4:84913834-84913856 GTGGAAGGGAAGGGAAGGGGAGG - Intronic
976704504 4:88007394-88007416 CGGGAAGGCCTGGGAAGGGAGGG - Intergenic
977581406 4:98729029-98729051 GATGAAGCTCAGGGAAGGGGTGG + Intergenic
978340774 4:107719847-107719869 GCGGAGGCGCTGGGGAGGGGGGG + Intronic
978440880 4:108732026-108732048 GGGGAAGCCATGGGAAGTGGAGG + Intergenic
980108209 4:128608490-128608512 GTGGAAGCCCTGAGCAAGAGAGG + Intergenic
980908784 4:138975278-138975300 GAGGAAGACCTGGAAAGGGAAGG - Intergenic
981580671 4:146245690-146245712 GTGGAAGGACTGGAAAGGTGAGG + Intergenic
981918347 4:150059291-150059313 CTAGATGCCCTGGGAAGTGGAGG - Intergenic
981948530 4:150377885-150377907 GCTGAGGACCTGGGAAGGGGAGG + Intronic
982313720 4:154010597-154010619 GGGGAAGCCGTGGGAGGGAGAGG - Intergenic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
984638387 4:182139210-182139232 GTGGAAGCACTGCCAACGGGAGG + Intergenic
985553796 5:546356-546378 CTGGGAGCCCTGGGAAGGCCCGG + Intergenic
985563501 5:603720-603742 GTCCTAGCCCTGGGAAGGTGGGG + Intergenic
985784097 5:1885291-1885313 CTGGCTGCCCTGGGAAGTGGAGG - Intronic
985790277 5:1923013-1923035 AAAGAAGCCATGGGAAGGGGAGG - Intergenic
985906933 5:2846063-2846085 CTGGAGGCCCTGGGAAGCTGGGG + Intergenic
987908585 5:24112038-24112060 ATGGGAGACCAGGGAAGGGGAGG + Intronic
988445981 5:31286614-31286636 TTGGAGGCCATGCGAAGGGGTGG + Intronic
988512599 5:31878322-31878344 ATGGGAGCACTGGGAAGGGATGG - Intronic
988615711 5:32772869-32772891 GTGGCAGAACTGGAAAGGGGGGG + Intronic
988921641 5:35947745-35947767 ATGTCAGCCCTGGCAAGGGGTGG + Intergenic
990275618 5:54192998-54193020 GTAGAAGCCATGGGAATGGAAGG - Intronic
994366885 5:98928074-98928096 ATGGAGGCCCTGGGAGAGGGGGG - Intronic
994629366 5:102264770-102264792 GGGGAAGATATGGGAAGGGGAGG - Intronic
995969626 5:117952449-117952471 ATGGAAGCCCAGAGAAGGGATGG + Intergenic
997440862 5:133907747-133907769 GTGTGAGCCATGGGAAGGGAGGG - Intergenic
998004873 5:138650159-138650181 GTGGAAGCTCTGTGAAGGCAGGG - Intronic
998026285 5:138819299-138819321 GTGTGGGCCCTGGGGAGGGGAGG + Intronic
998328916 5:141306064-141306086 GTTGCAGCCCTGGGAACTGGTGG + Intergenic
998376209 5:141692499-141692521 GCGGAGGCCCTGGGAAGCGCTGG - Intergenic
998801267 5:145872093-145872115 GTTGGAGTCCTGGGAAGGGATGG - Intronic
999255701 5:150209044-150209066 GGGTAAGGCCTGGGAAGTGGCGG - Intronic
999382904 5:151134345-151134367 GTTGGGGCCCTGGGAAGGGCTGG - Intronic
1000460717 5:161514216-161514238 GGGCAAGCCTTGGGAAGAGGTGG - Intronic
1001837306 5:174843155-174843177 GTGGGGGCCATGGGAATGGGAGG + Intergenic
1002063323 5:176639485-176639507 CTGGAAGCTGTGGGAAGTGGTGG + Intronic
1002385338 5:178861463-178861485 GGAGAAGCCTGGGGAAGGGGTGG - Intronic
1003034151 6:2628481-2628503 GTGGGAGCCGAGGGAAGGAGAGG + Intronic
1003034167 6:2628535-2628557 GTGGGAGCCGGGGGAAGGAGAGG + Intronic
1003499850 6:6695192-6695214 GGGGAAGTGCTGGGAAGGGAAGG - Intergenic
1005021285 6:21421669-21421691 GTGAAAGCCCTGCGATGGGAAGG - Intergenic
1005102855 6:22191989-22192011 ATGGCATCCCTGTGAAGGGGTGG + Intergenic
1006019861 6:31111678-31111700 GTGGAGGCCCTGGGACTGGTTGG - Exonic
1006579433 6:35068347-35068369 GGGGAAGCTCTGGGGTGGGGAGG + Intronic
1006798660 6:36745943-36745965 GTGGGAGCCAGGGAAAGGGGTGG + Intronic
1007581723 6:42963934-42963956 GAGTAAGCCCTGGGAGAGGGTGG - Exonic
1007705209 6:43786712-43786734 TGGGAAGCTCTGGGAATGGGTGG + Intergenic
1011585812 6:88924021-88924043 CTGGAGGCCCTGAGGAGGGGTGG + Intronic
1011736214 6:90313219-90313241 GTGGAGGCCCAGGGCTGGGGTGG + Intergenic
1013225990 6:108119632-108119654 GTGGAAGTCCGGGGAATGGGAGG + Intronic
1013475887 6:110506984-110507006 ATGGAAAACCTGGGAAGGGCAGG - Intergenic
1013526884 6:110982318-110982340 GTGGGAGCCGTGGGATGGGAGGG + Intronic
1013941277 6:115666291-115666313 GTGGAAGCCATAGGAAGCAGAGG - Intergenic
1017261805 6:152396138-152396160 GTGGAGTCCCTGGGAAGAGAAGG + Intronic
1017645847 6:156539248-156539270 GTGGAAGTGCTGGGAGGGTGGGG + Intergenic
1017776999 6:157688376-157688398 ATGGAGTCCCTGGGAAGAGGAGG + Intergenic
1018460659 6:163995551-163995573 GTCGAAGCTCTGGGAATTGGTGG - Intergenic
1018792812 6:167162461-167162483 GGGGAAGCTCTGGGCAGGGAAGG + Intronic
1018900834 6:168050989-168051011 GGGCAAGCCCCGGGATGGGGTGG + Intergenic
1019058458 6:169239387-169239409 GTGGAAGCCCTGGGAACGCGGGG - Intronic
1019810962 7:3164955-3164977 GGAGGAGCCATGGGAAGGGGTGG - Intronic
1022232077 7:28423843-28423865 GTGGTCGCCCTGGGAGGAGGGGG - Intronic
1022351038 7:29566224-29566246 GTGGCAAGCCGGGGAAGGGGTGG + Exonic
1023918597 7:44609040-44609062 GTTGAAGGACTGGGAATGGGAGG - Intronic
1024241272 7:47438477-47438499 GAGGAAGCCCTGAGGAGGAGAGG + Intronic
1024569970 7:50715200-50715222 GTGGCAGCCCTTTGAAGGGCAGG + Intronic
1024626237 7:51210419-51210441 GTTCCAGCCCTGGGAAGGGATGG - Intronic
1026109589 7:67448599-67448621 GTGGAATCACAGGGAGGGGGTGG - Intergenic
1026909285 7:74083345-74083367 GTGGTCGCCTTGGGGAGGGGAGG - Intronic
1026991161 7:74586606-74586628 GTTGGAGCCCTGGGAAAAGGAGG + Intronic
1029448219 7:100626704-100626726 GTGGAGCCCCAGGGGAGGGGCGG + Intronic
1029617480 7:101668215-101668237 GTGGAAGCACTGGGACAAGGGGG - Intergenic
1029747632 7:102525278-102525300 GAGGAAGGGCTGGGAAGTGGGGG + Intergenic
1029765583 7:102624368-102624390 GAGGAAGGGCTGGGAAGTGGGGG + Intronic
1030605261 7:111633202-111633224 GTGGAAGGTTTGGGAACGGGGGG + Intergenic
1032003913 7:128285046-128285068 GTGGAGGCCCTAGGAAGGAGAGG - Intergenic
1033550716 7:142445225-142445247 CTGGGAACCCTGGGGAGGGGAGG + Intergenic
1034104914 7:148482073-148482095 GAGGAAGCCCTGGGGTGAGGGGG - Intergenic
1034475732 7:151280427-151280449 GTGGGAGTCCTGGGAGGGTGGGG + Intergenic
1034553070 7:151833415-151833437 GAGGAGGCCCTGGAAAGGAGAGG + Intronic
1034601559 7:152262182-152262204 GTGGAGGGCCTGGGAAAGGAGGG - Intronic
1035459675 7:159031164-159031186 ATGTTAGCCCTGGGAGGGGGTGG + Intronic
1037793350 8:21967881-21967903 ATGGAAGTCTTGGGAAGGGTGGG + Intronic
1037802438 8:22043021-22043043 GTGGGAGTCCCGGGAAGAGGAGG - Intronic
1037829367 8:22178875-22178897 GTAGAAGCACTGAGAAGAGGGGG - Intronic
1037989072 8:23307676-23307698 GTGGAAGCCCTGGGCGGCGGGGG - Intronic
1039422285 8:37453349-37453371 AACTAAGCCCTGGGAAGGGGAGG + Intergenic
1039441360 8:37597636-37597658 ATTGAAGCCCAGGGAAGGGAAGG - Intergenic
1039787589 8:40847513-40847535 GAGGAAGAACAGGGAAGGGGAGG + Intronic
1041544669 8:59029228-59029250 GTGGAAGTCATGGGGATGGGGGG - Intronic
1042514017 8:69641142-69641164 TTGGGAGCCCCGGGAAAGGGTGG + Intronic
1042801168 8:72719311-72719333 GTGGAAGCACTGGGAAGATATGG + Intronic
1043404578 8:79917304-79917326 GGTGTGGCCCTGGGAAGGGGTGG + Intergenic
1043420628 8:80094902-80094924 GAGGAAGCCCTGGGAGAGGCAGG + Intronic
1043527331 8:81111541-81111563 GAGGGAGCCGTGGGAAGGAGAGG - Intronic
1044475350 8:92619083-92619105 GGGGAGGACATGGGAAGGGGTGG - Intergenic
1044695473 8:94918305-94918327 CTGGAAACCCTGGGAAGTGCAGG - Intronic
1046406668 8:113781658-113781680 GAGGTAGGCCTGGGAAGGTGTGG - Intergenic
1046623721 8:116555671-116555693 GTGGATGCCCAGGGTAGGGAAGG + Intergenic
1048468207 8:134684960-134684982 GTGTCAGCCATGGGAAGGAGAGG + Intronic
1049330780 8:142049336-142049358 GTGAGAGCCCTGGCAAGGCGGGG - Intergenic
1049451815 8:142666048-142666070 TTGGAGGCCATGGGGAGGGGTGG + Exonic
1049761222 8:144332775-144332797 CTAGAAGGCTTGGGAAGGGGTGG + Exonic
1049813522 8:144587044-144587066 ATGAGAGCCCAGGGAAGGGGAGG - Intronic
1049887266 9:35996-36018 TTGGAAGGCTGGGGAAGGGGAGG + Intergenic
1049928600 9:433775-433797 GGGGAAGCCATGGGAAGGGTTGG - Intronic
1050588928 9:7142442-7142464 GAGGGAGCCCAGGGGAGGGGAGG - Intergenic
1052888902 9:33677223-33677245 GTGGAAGCCGTGGGCTTGGGCGG - Intergenic
1053265796 9:36712403-36712425 GTGGAGGACATGTGAAGGGGAGG - Intergenic
1056217168 9:84416110-84416132 GTAGCAGCCCAGGGGAGGGGAGG - Intergenic
1056429363 9:86511903-86511925 GTAGAGACCCTGGGAAGGAGAGG - Intergenic
1057018906 9:91680789-91680811 CTGGAAGCACTGGGAAAGGCAGG + Intronic
1057208008 9:93184769-93184791 CTGGGGGCCCTGGGAAAGGGGGG - Intergenic
1057257151 9:93558729-93558751 GCAGAAGCTCTGGGAAGGGGTGG - Intronic
1057268868 9:93636032-93636054 GTGGAAGCCATGGGATGGTGAGG + Intronic
1058339175 9:103873088-103873110 AGGGAAGTGCTGGGAAGGGGAGG - Intergenic
1059374651 9:113872754-113872776 GGGGAAGCCAAGAGAAGGGGAGG - Intergenic
1059567558 9:115398298-115398320 GTGGTTGGCATGGGAAGGGGTGG - Intronic
1059905537 9:118981032-118981054 GTGGAACCCATGGGTATGGGGGG - Intergenic
1060209055 9:121699311-121699333 GAGGAAGCCCTGCGCACGGGGGG - Exonic
1060481943 9:124021692-124021714 GTGTACGTCCTGGGATGGGGTGG - Intronic
1060571284 9:124642801-124642823 GTGGAAGCCATGAGAGAGGGAGG + Intronic
1060794233 9:126503735-126503757 CTGGCAGCCCTGGGCCGGGGAGG - Exonic
1060911206 9:127352540-127352562 GTGGGAGCCCAGGGTAGAGGAGG + Intronic
1061181889 9:129029333-129029355 GTGGAAGAAATGGGAATGGGAGG - Intergenic
1061258860 9:129468065-129468087 GGGGCAGCCCTGGGAAGAGCTGG - Intergenic
1061614919 9:131773319-131773341 GAGGGAGCCAGGGGAAGGGGTGG - Intergenic
1062332791 9:136051838-136051860 GCGGGAGCCCTGGGGCGGGGAGG + Intronic
1062484949 9:136770050-136770072 GAGGCTGCCCAGGGAAGGGGAGG - Intergenic
1203376349 Un_KI270442v1:381033-381055 GTCCAAGCCGGGGGAAGGGGCGG + Intergenic
1203625167 Un_KI270750v1:11242-11264 GTGGGAGTGCTGGGAAGGGAAGG + Intergenic
1185457346 X:317747-317769 GTGGAGTCCGTGGGATGGGGTGG - Intronic
1185630852 X:1514862-1514884 GAGGAAGACAGGGGAAGGGGAGG - Intronic
1190115206 X:47621863-47621885 GTGGAAGCCTAGGGGAGGAGGGG - Intergenic
1190298378 X:49042019-49042041 GTGTGAGCCCTGGGTGGGGGGGG - Intronic
1190628647 X:52363465-52363487 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1193416450 X:81229924-81229946 ATGGAAGCGCTGGGAAGGAAAGG - Intronic
1195235262 X:102890538-102890560 GTAGAAGTCCAGGGAAGAGGTGG + Intergenic
1197746683 X:129936224-129936246 TTACAAGACCTGGGAAGGGGTGG - Intergenic
1199005263 X:142688573-142688595 GAGGAAGGGCTGGGGAGGGGAGG - Intergenic
1199606566 X:149583894-149583916 GAGGAAACCCTGGGCAGGTGTGG - Intronic
1199632557 X:149785474-149785496 GAGGAAACCCTGGGCAGGTGTGG + Intronic
1199785352 X:151100347-151100369 GTGGGAGACCTGGGATAGGGTGG - Intergenic
1199947901 X:152682279-152682301 CTGGAAGCCCTGAGCAGGTGTGG + Intergenic
1199961778 X:152786175-152786197 CTGGAAGCCCTGAGCAGGTGTGG - Intergenic
1200223310 X:154402833-154402855 GTTGAGGGCCTGGGAATGGGTGG + Exonic
1200232314 X:154450151-154450173 GGAGAAGCCAAGGGAAGGGGAGG + Intronic
1201052360 Y:9950413-9950435 GTGGACACCTTGGGAAGGTGGGG + Intergenic
1201065705 Y:10092527-10092549 GTCCAAGCCGGGGGAAGGGGCGG - Intergenic