ID: 1165229456

View in Genome Browser
Species Human (GRCh38)
Location 19:34377826-34377848
Sequence GTTCAGCTGGGCCAGGGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165229456_1165229467 11 Left 1165229456 19:34377826-34377848 CCAAAACCCTGGCCCAGCTGAAC 0: 1
1: 0
2: 1
3: 13
4: 192
Right 1165229467 19:34377860-34377882 CCTGTTCATCATTGCCTCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165229456 Original CRISPR GTTCAGCTGGGCCAGGGTTT TGG (reversed) Exonic
901051623 1:6428450-6428472 GGTGGGCTGGGCCAGGGCTTTGG + Intronic
901671042 1:10856582-10856604 CTTGAGCTGGGCCGGTGTTTTGG - Intergenic
902391995 1:16112317-16112339 GTCCACCTGGGGCAGGGTTAGGG - Intergenic
902883560 1:19389006-19389028 CTTAAGCTGGGCCATAGTTTTGG + Intronic
903219949 1:21864044-21864066 GCTCAGCTGGGCCTGGGTGGGGG - Intronic
904575981 1:31505348-31505370 GATCAGCTGGGCCTGGGTGGGGG + Intergenic
904814034 1:33181964-33181986 GTCGCGCTGGGCCAGGGTTTGGG - Intronic
907288201 1:53395709-53395731 GCTCAGCTGGGACAGGGATGAGG - Intergenic
911095602 1:94052486-94052508 GCTCAGCAGGGCCAGGTTCTGGG - Intronic
912119578 1:106453975-106453997 TTTCATCTGGACCACGGTTTGGG + Intergenic
912724355 1:112045472-112045494 GTTCCACTGGGCAAGGGTTGGGG - Intergenic
912771809 1:112470985-112471007 GTTCATGTGGGCCAGGGTACTGG + Intronic
912937274 1:114014475-114014497 GTTCACATGAGCCAGGGTTGTGG + Intergenic
914538292 1:148587197-148587219 GCTCAGCTGGGCCAGGGGAAGGG - Intronic
919879745 1:201893732-201893754 GAGCTCCTGGGCCAGGGTTTTGG + Intergenic
920339897 1:205269233-205269255 GTGCAGCTGGGCGATGGTCTGGG - Exonic
921048145 1:211491706-211491728 GTGCAGCTGTGCCAGGGTGCGGG + Intronic
922173649 1:223178216-223178238 GTTCTGCTGGGCTAGGGCTGGGG - Intergenic
922594627 1:226804260-226804282 GTTAAGGTGGTACAGGGTTTTGG + Intergenic
922781474 1:228256420-228256442 GCTCATCTGGGGCAGGGATTGGG - Intronic
1063577030 10:7271554-7271576 GTTCATCTGGGCCAGGGTCAGGG + Intronic
1065005843 10:21379387-21379409 ATTCAAATGGGCCAAGGTTTTGG - Intergenic
1070476129 10:76830830-76830852 GGTCAGCTGTGTCAGGCTTTTGG + Intergenic
1073638880 10:105229708-105229730 TGTCAGGTGGGCCAGGGTCTGGG + Intronic
1073725935 10:106230888-106230910 GTTGCGCTGGGACAGGTTTTAGG + Intergenic
1074507311 10:114082943-114082965 GTTCAGCTGAGCCTGGGTGGAGG + Intergenic
1075682663 10:124343614-124343636 TTTGAGCTGGGCCTGGGTCTGGG - Intergenic
1075691390 10:124397221-124397243 GTTTAGGTGGGCCAAGGTTGGGG - Intergenic
1077506173 11:2930894-2930916 GTTGGGCTGTGCCAGGGTTCTGG + Intergenic
1080451147 11:32380019-32380041 GTTCAGGCGGGCCAGGGATGGGG - Intergenic
1081835393 11:46149445-46149467 GGTCAGCTGGGGCAGGCTGTGGG - Intergenic
1081980190 11:47261340-47261362 GCTGAGCTGGGGCAGGATTTGGG - Exonic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1087202238 11:95357448-95357470 GTTCAGCTGGACCAAAATTTTGG + Intergenic
1087209253 11:95429718-95429740 GTTCAGATCAGCCAGGGCTTTGG + Intergenic
1088643385 11:111895670-111895692 GTACAGTTGGGCCAGGGTGGTGG - Intergenic
1089677843 11:120102231-120102253 GGTCAGATGGGCCAGGGCTGGGG - Intergenic
1090049583 11:123365912-123365934 GTTCAGCTGGTGCAGGCTATGGG - Intergenic
1091760355 12:3083421-3083443 TTTCTGCTGGGCCAGGGCTTGGG + Intronic
1094446202 12:30533361-30533383 GTTCAGCTGGTCGGGGGCTTAGG - Intergenic
1095488194 12:42706194-42706216 GTCCAGCTGGGGCAGGGCCTGGG - Intergenic
1095742962 12:45626585-45626607 TTTCTGCTGGGCCAGGTTTTGGG + Intergenic
1096214237 12:49790921-49790943 ATTCTCCTGGGCCAGGGCTTGGG - Intergenic
1100613146 12:96208858-96208880 GTGCAGCTGGGCCAGGGAAAGGG + Intronic
1101158589 12:101951392-101951414 TCTCAGCTCAGCCAGGGTTTGGG + Intronic
1101396966 12:104356855-104356877 GTTCTGCAGGGCCAGGCTTAGGG - Intergenic
1102222644 12:111204922-111204944 TATCAGCTGGGCCAGGGTGATGG - Intronic
1103020637 12:117531176-117531198 GCTCAGCTGGACCAGGGTTCTGG + Intronic
1103512631 12:121485641-121485663 GTTAAACAGGGCCAGGGTTCCGG + Intronic
1103596117 12:122025115-122025137 GGGAAACTGGGCCAGGGTTTGGG + Intronic
1104657278 12:130582699-130582721 ATTCAGCAGGTCCTGGGTTTGGG - Intronic
1105353010 13:19633252-19633274 GTTCTGCTTGGCTGGGGTTTCGG + Intergenic
1106229954 13:27814078-27814100 GTCCAGCTGGGGAAGAGTTTTGG + Intergenic
1108766882 13:53641760-53641782 GTTTGTCTGGGCCAGGGTTGAGG - Intergenic
1110788426 13:79560610-79560632 GTTTCCCTGGGCCAGGGATTGGG - Intergenic
1112082418 13:95987869-95987891 GTTCAGATAGGCCAGCCTTTTGG - Intronic
1113798037 13:113070055-113070077 GTTCAGCTGGGCCAGGAGCCTGG - Exonic
1114319530 14:21535892-21535914 GTACATCTGAGCCAGGGTGTGGG - Intronic
1117454433 14:55883536-55883558 CTGAAGCTGGGCCAGGGTTGAGG + Intergenic
1117530556 14:56656978-56657000 TTCCAGGTGGGCCATGGTTTGGG - Intronic
1118083882 14:62393720-62393742 GCCCAGGTGGGCCAGGTTTTTGG + Intergenic
1119743050 14:77026719-77026741 GCTCAGCTCGGCCAGGGCCTCGG + Exonic
1121638297 14:95468416-95468438 GCTCAGCTGGGCCCTGGGTTGGG - Intronic
1122481455 14:102050034-102050056 GTTCACCTCAGCCTGGGTTTTGG + Intronic
1122823694 14:104359561-104359583 GTCCATCTGGGCCAGAGGTTGGG + Intergenic
1127376512 15:58389708-58389730 CTTCAGCTGGATCAGGGTCTGGG - Intronic
1127378576 15:58407887-58407909 GTACATCTGGGCAAGGGTCTCGG - Intronic
1128259333 15:66221546-66221568 GCTCAGCTGTGCCAGGGCTGTGG - Intronic
1128731552 15:70024897-70024919 GGTCAGCTTGGCCTGGGTTCGGG - Intergenic
1128899721 15:71409279-71409301 CCTCATCTGGGCAAGGGTTTTGG - Intronic
1133161215 16:3913029-3913051 TTTCAGCTGGGGCTGGGCTTGGG - Intergenic
1134374051 16:13653360-13653382 GTTGAGCTGGGCTAGACTTTGGG - Intergenic
1134892504 16:17853625-17853647 GGTTCGCAGGGCCAGGGTTTAGG - Intergenic
1135424544 16:22325803-22325825 GTTCTGCTGGGCCTTGGTTTTGG - Exonic
1137262763 16:46844508-46844530 GTTCAGCTGGGGCAGCGCCTCGG + Intergenic
1137845927 16:51688104-51688126 TTTGTGCTGGGCAAGGGTTTGGG - Intergenic
1139175802 16:64685783-64685805 ATTCAGCTGGGCTTGGCTTTAGG - Intergenic
1140263113 16:73397779-73397801 GTTAAGCTGGGCAAGACTTTGGG + Intergenic
1142364891 16:89645054-89645076 CTTCAGCTGGGCTGGGGTTGGGG - Exonic
1144024601 17:11266873-11266895 GTGGAGCTTGGTCAGGGTTTTGG + Intronic
1144862900 17:18316784-18316806 GCTGAGCTGAGCCAGGGTCTGGG - Exonic
1146271721 17:31489298-31489320 TTTCAGCTGGGCCAGGACCTGGG - Intronic
1149495770 17:57116330-57116352 GCTCAGTTGTGCCAGGGCTTGGG + Intronic
1149655845 17:58309188-58309210 GTTCAGGCGGGCCAGGGTCTCGG + Exonic
1150005445 17:61466123-61466145 CTTCAGGTGGGGCTGGGTTTGGG + Intronic
1150009100 17:61488223-61488245 GTTGTTCTGTGCCAGGGTTTTGG + Intergenic
1150212483 17:63448784-63448806 GGGCAGCTGGGGCAGGGATTAGG + Intergenic
1150638225 17:66931495-66931517 CTTCAGCTTGGCCAGCTTTTGGG + Intergenic
1152342716 17:79734058-79734080 GTTCAGCTGTGACAGGGATGTGG - Intronic
1152789231 17:82269799-82269821 GTTCAGCTGGGCTAGGCTAGAGG - Intronic
1155080454 18:22405178-22405200 GTTAAGGTTGGCCAGTGTTTAGG - Intergenic
1155983972 18:32210071-32210093 TTGGAGCTGGACCAGGGTTTTGG + Intronic
1157530807 18:48418978-48419000 ATGGAGCTGGGCCAGGCTTTTGG - Intergenic
1157828610 18:50835508-50835530 GTTTATCTGGGCCAAGGTTGAGG - Intergenic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1157950989 18:52036681-52036703 GTAGAGATGGGCCAGGGTGTTGG - Intergenic
1158162565 18:54502099-54502121 ATTCTGCTAGGCCAGGGTCTTGG + Intergenic
1160024653 18:75208197-75208219 GGGCAGCTGGGCCAGGGTCGGGG - Intronic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163250389 19:16123244-16123266 GTTCAGGTTGGCCTGGGTCTAGG - Intronic
1163604236 19:18265410-18265432 GTCCAGATGGGCCAGGGATGGGG + Exonic
1164069111 19:21750083-21750105 GTTCATCTGGGCCAAGCTTGAGG + Intronic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
1165245067 19:34493945-34493967 TTTCAGCTGGGGCAGGGGCTTGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
1168110518 19:54189321-54189343 GCTCAGGTGGGCCAGGGTGGCGG - Exonic
926049759 2:9737374-9737396 CTTCAGCTGAGCCAGTGTATTGG + Intergenic
927040993 2:19230146-19230168 GGTCAGCTAGGCCTGGGTTTGGG + Intergenic
927569438 2:24145165-24145187 GTTCAGGTGGGCCAGTTCTTGGG - Intronic
930062396 2:47301006-47301028 GTTCACTTTGGGCAGGGTTTTGG + Intergenic
931082597 2:58792242-58792264 ATTTAACTGGGCCATGGTTTTGG - Intergenic
935066761 2:99655498-99655520 CTTCAGCTGAGCCAGGATCTAGG - Intronic
936080504 2:109429627-109429649 GCACAGCTGGGGCAGGGCTTGGG - Intronic
937264034 2:120604935-120604957 GGACAGCAGGGCCAGGGTCTGGG + Intergenic
937593136 2:123639362-123639384 GGTCAGCTGGTTAAGGGTTTTGG + Intergenic
944502786 2:200379042-200379064 ATTCAGCTGGCTCAAGGTTTTGG - Intronic
946161769 2:217839978-217840000 GTTCAGCTGGGCCTGGGTAGGGG - Intronic
946194292 2:218023894-218023916 GGTCAGCTGGGGAAGGGTGTAGG - Intergenic
947257148 2:228180133-228180155 GTTCCGCTGGGGCAGGGATCGGG + Intronic
948334580 2:237197488-237197510 GTTCAGCTGGGCATGGCTCTGGG - Intergenic
948770628 2:240249770-240249792 GGTCAGCTGAGCCAGGGTGCAGG - Intergenic
1169342960 20:4810194-4810216 CTTCAGCTGGTCCAGAGCTTGGG - Intronic
1169998955 20:11593330-11593352 CTTCAGCTGGTCTAAGGTTTAGG - Intergenic
1173743148 20:45416538-45416560 GATCAGCTGCCCCAGGGCTTTGG - Exonic
1174292657 20:49519888-49519910 GTGCTGCTGGGCCAGGGTCAGGG - Intronic
1174459465 20:50672483-50672505 GTCAAGCTGGGCCAGCTTTTGGG - Intronic
1175651856 20:60731793-60731815 CTTCAGCTAGGCAGGGGTTTGGG + Intergenic
1178829911 21:36047349-36047371 GTTCTGCTGGGCCTTTGTTTTGG - Intronic
1179990568 21:44946449-44946471 GTGCGGCAGGGTCAGGGTTTTGG + Intronic
1180659201 22:17451163-17451185 GTTCAGGTGGGCCAGGCTTGAGG + Intronic
1180864376 22:19107504-19107526 GAGCAGCTGAGCCAGTGTTTTGG - Intronic
1183984113 22:41560202-41560224 CTCCAGCTGGCCCTGGGTTTAGG + Intergenic
1184631196 22:45781300-45781322 GTACAGCTGGGCAGGGGTTGGGG - Intronic
950990312 3:17429826-17429848 GTGCAGCTGTGCCAGTGTTCAGG + Intronic
953126002 3:40092404-40092426 GTTCACCTGGGAGAGGGTTTTGG - Intronic
955994842 3:64669107-64669129 TCTGAGCTGGGCCAGGGTATTGG - Intronic
956445514 3:69322064-69322086 GTTTTTCTGGGCCAGGGCTTGGG - Intronic
964356195 3:155854077-155854099 GTCGCGCTGGACCAGGGTTTCGG + Exonic
964673077 3:159248236-159248258 TTCCATCTGGGCAAGGGTTTGGG + Intronic
966062315 3:175773002-175773024 TTTCAGCTGGGGTAGGATTTAGG + Intronic
966787230 3:183632563-183632585 GTTAAGCTGGGCGAGGGTCTTGG - Intergenic
971068823 4:23066949-23066971 ATCCTGCTGGGCCATGGTTTTGG + Intergenic
972070798 4:35018138-35018160 GTACAGATGGGACATGGTTTAGG + Intergenic
978102094 4:104854085-104854107 GTTCAGCTGGGAAAAAGTTTCGG + Intergenic
981936277 4:150243005-150243027 GATCAGCTGGGAAAGGGTCTTGG + Intronic
985843712 5:2329169-2329191 GCTCAGCTGGACCTGGGCTTCGG - Intergenic
987039250 5:14046369-14046391 GTGCAGGTGGCCCTGGGTTTGGG - Intergenic
989314797 5:40065908-40065930 CTTAATTTGGGCCAGGGTTTGGG + Intergenic
991034585 5:62115724-62115746 GTTTACCTGGTCCAGGGGTTTGG + Intergenic
992172248 5:74114971-74114993 GTTCAGTTGGCCCAGGTTTTTGG + Intergenic
992409744 5:76493479-76493501 GGTCAGAAGGGCCAGGGTTAGGG - Intronic
994518740 5:100802270-100802292 GTTCAGCAAGGCCAGGGATGGGG + Intergenic
998135928 5:139674469-139674491 GCTCTGCTGGGCCAGTGTTGGGG + Intronic
998923636 5:147098582-147098604 CTGCAGCTGGGCCAGGGATCTGG - Intergenic
1000378706 5:160609301-160609323 GTTCTGAAGGGCCAGGGTTGGGG + Intronic
1002173611 5:177388901-177388923 ACTCAGCTGGGCCATGTTTTGGG + Intronic
1002469944 5:179429130-179429152 TGGCAGCTGGGCCAGGGTCTGGG + Intergenic
1003182351 6:3802788-3802810 ATTTATCTGGGCCAAGGTTTAGG - Intergenic
1003291493 6:4782544-4782566 TTTAAGCTGGGCAAGGTTTTGGG + Intronic
1003642265 6:7886087-7886109 GTTGAGCAGGGCCATGCTTTGGG + Intronic
1005876539 6:30014247-30014269 TTTCACCTGGGCCAAGATTTTGG - Intergenic
1013111787 6:107070192-107070214 GTTCAGCTGGGGCAGGCACTCGG + Exonic
1014481800 6:121948308-121948330 GTTCTGCTGGGTTTGGGTTTGGG + Intergenic
1014500826 6:122186769-122186791 GTTCAGTTTGGCCAGGGAATGGG + Intergenic
1018637068 6:165871980-165872002 ATTCAGCTGGGCCAAGATTGTGG + Intronic
1019644170 7:2120293-2120315 GTTGAGCTGGGTCAGACTTTAGG - Intronic
1019895941 7:3983195-3983217 GTAAAGCTGTGGCAGGGTTTGGG + Intronic
1020177088 7:5890955-5890977 GTGCAGCTGGGCCAGGTGTAGGG + Intergenic
1021993185 7:26155767-26155789 GGTCAGCTAGACCTGGGTTTGGG + Intronic
1023495138 7:40787406-40787428 GTTTTGCTGGGTCTGGGTTTAGG + Intronic
1024623215 7:51181630-51181652 GTTTATCTGGGCCAAGGTTGAGG - Intronic
1028156807 7:87439314-87439336 TTTCAGCTGGACCAGTGTCTGGG + Intronic
1029123342 7:98282142-98282164 GTTCATCTGGGGCAGGGATCCGG - Intronic
1029191329 7:98774299-98774321 GTTCAGCTGTGTTAGGGTTCAGG + Intergenic
1030533323 7:110736422-110736444 GCTCTGCTGGTCCAGGGTCTTGG - Intronic
1031351820 7:120741970-120741992 GTTCATTTGGGTCAGGGGTTGGG + Intronic
1034702844 7:153111316-153111338 CCTCAGAGGGGCCAGGGTTTTGG - Intergenic
1034778817 7:153858331-153858353 GTTCTGCTGGGGCAGGGTGAAGG + Intergenic
1038480678 8:27899718-27899740 GTACAGCATGGCAAGGGTTTGGG - Intronic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1040787230 8:51179953-51179975 GTTTATTTGGGCCAAGGTTTGGG - Intergenic
1041439247 8:57875883-57875905 GTTCAGCTGGGGCTGGGGTCAGG - Intergenic
1044715195 8:95093690-95093712 GTTTATTTGGGCCAGGGTTGAGG - Intronic
1047479231 8:125265081-125265103 GTTCAACAGGGCCAGGATTAAGG + Intronic
1048453463 8:134554917-134554939 GTTGAGCTGGGTCTGGGTCTGGG - Intronic
1049098774 8:140564352-140564374 GAACAGCTGGGCCTGGGTTGGGG + Intronic
1049117800 8:140704757-140704779 CTTGTGCTGGGTCAGGGTTTTGG + Intronic
1051051255 9:12934305-12934327 GTTCAGCTGGGCTTGGCTCTAGG - Intergenic
1051486846 9:17617957-17617979 GTTCATTTTGGCTAGGGTTTAGG + Intronic
1052850918 9:33378044-33378066 GTTCACCAGGGACAGGGGTTAGG - Intergenic
1053167934 9:35857800-35857822 GCTCAGCTGGGCCAGCAGTTAGG + Intergenic
1058604748 9:106708275-106708297 GGTCAGATGTCCCAGGGTTTTGG - Intergenic
1059104215 9:111497734-111497756 GTTCATCTGGGCCAAGGTTTAGG - Intergenic
1061307326 9:129739662-129739684 GGGGAGCTGGGCCAGGGTGTAGG + Exonic
1187458394 X:19463400-19463422 GGTCAGCTCTGCCAGTGTTTGGG + Intronic
1191701171 X:64044258-64044280 GTTCAGCTGGGACAGGGCGGCGG + Intergenic
1191723981 X:64259491-64259513 GTTCATCTGTGCCAGGTCTTGGG - Intergenic
1192359574 X:70430654-70430676 GTTCAGCTGGGTCAGCTTCTGGG - Intronic
1192796624 X:74428895-74428917 GTTCAGCTGGCCCAGGAGATGGG - Intronic
1197058561 X:122149555-122149577 GTTTACCTGGGACAGGGTCTGGG + Intergenic
1199491406 X:148404344-148404366 TTTCATCTGGTCCAGGCTTTAGG - Intergenic
1200104744 X:153706067-153706089 GCTGAGCAGGGCCAGGCTTTCGG - Intronic