ID: 1165230327

View in Genome Browser
Species Human (GRCh38)
Location 19:34382725-34382747
Sequence CTAACTCATCTCTACATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 111}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165230327_1165230338 20 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230338 19:34382768-34382790 TGGGTCTGGCCTCCCAGGTAAGG 0: 1
1: 0
2: 3
3: 13
4: 199
1165230327_1165230332 -9 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230332 19:34382739-34382761 ATGAGTTAGGGTGTGGCTTAAGG 0: 1
1: 0
2: 0
3: 19
4: 270
1165230327_1165230334 0 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230334 19:34382748-34382770 GGTGTGGCTTAAGGAGAGGATGG 0: 1
1: 0
2: 1
3: 64
4: 494
1165230327_1165230335 1 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230335 19:34382749-34382771 GTGTGGCTTAAGGAGAGGATGGG 0: 1
1: 0
2: 3
3: 19
4: 263
1165230327_1165230336 6 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230336 19:34382754-34382776 GCTTAAGGAGAGGATGGGTCTGG 0: 1
1: 0
2: 1
3: 13
4: 237
1165230327_1165230339 26 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230339 19:34382774-34382796 TGGCCTCCCAGGTAAGGCCTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
1165230327_1165230333 -4 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230333 19:34382744-34382766 TTAGGGTGTGGCTTAAGGAGAGG 0: 1
1: 0
2: 2
3: 15
4: 212
1165230327_1165230337 15 Left 1165230327 19:34382725-34382747 CCCAGCATGTAGAGATGAGTTAG 0: 1
1: 0
2: 0
3: 20
4: 111
Right 1165230337 19:34382763-34382785 GAGGATGGGTCTGGCCTCCCAGG 0: 1
1: 0
2: 5
3: 26
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165230327 Original CRISPR CTAACTCATCTCTACATGCT GGG (reversed) Intronic
902048191 1:13541702-13541724 CTAACTCATCTCTAGGTGGACGG + Intergenic
903354045 1:22735662-22735684 CTGTCTCAGCTCTACATGATGGG + Intronic
907866910 1:58407389-58407411 CTAACAAATATCTACATGCTAGG - Intronic
908265882 1:62378762-62378784 CTAACTCATCTCTAAAATTTGGG - Intergenic
909885430 1:80936311-80936333 CTAACTAATCTCTAGATGTCAGG + Intergenic
916826240 1:168444608-168444630 CTCACTCATCTCTTTATCCTCGG + Intergenic
918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG + Intergenic
922974767 1:229775056-229775078 GTAACACATTTCAACATGCTTGG + Intergenic
1064381084 10:14842336-14842358 CGAACTCTTCTCTCCATACTAGG + Intronic
1064879735 10:20037498-20037520 CTATCTCATCACTCCATGCCTGG + Intronic
1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG + Intronic
1070611597 10:77937155-77937177 CTAACTCATCTCCTATTGCTTGG + Intergenic
1071624909 10:87157928-87157950 CTATTTGATCTCTACTTGCTTGG + Intronic
1073962347 10:108947023-108947045 CTAACTCCTGTCTTCATGCTGGG - Intergenic
1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG + Intergenic
1077194066 11:1270556-1270578 CTGACCCATCGCTACATGCCCGG + Intergenic
1078478746 11:11657711-11657733 CTCACACATCTTGACATGCTGGG - Intergenic
1080615101 11:33938809-33938831 CTTACTCATCTCTGCCTCCTTGG + Intergenic
1081006431 11:37749464-37749486 CTAGTTCTTCTCTACATGTTGGG - Intergenic
1082673309 11:56062016-56062038 CTAATAAATCTCTACATGTTTGG + Intergenic
1083116403 11:60463714-60463736 CTAACCCATCTCTACTTGTTTGG - Intronic
1087048538 11:93864630-93864652 CCAAGGCATCTCTACATCCTTGG - Intergenic
1089093196 11:115895808-115895830 CTAACTCATCCCAATTTGCTGGG - Intergenic
1090464080 11:126917968-126917990 GTGACTCATCTCTCCAAGCTGGG + Intronic
1092283265 12:7113572-7113594 CAAGCTCCTCTCTAAATGCTGGG - Intergenic
1093930455 12:24950334-24950356 CTGAGTGATTTCTACATGCTAGG + Intergenic
1094265311 12:28552036-28552058 CTAAGTCCTCACTACAGGCTAGG - Intronic
1096739898 12:53685445-53685467 CTAATCCATCTCCACATTCTAGG + Intergenic
1100841691 12:98619573-98619595 CTAACTCTTCTATCCATCCTAGG - Intronic
1100944493 12:99765261-99765283 CTAAATTTTCACTACATGCTAGG - Intronic
1101399734 12:104377046-104377068 CTTACTCATCTCTGCCTCCTTGG - Intergenic
1101561467 12:105861675-105861697 CAAACTCATCTCAAAATGCATGG + Intergenic
1102105852 12:110322432-110322454 CTCACTGATCTCTACATCCTGGG + Intronic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1106941586 13:34786316-34786338 CTAACACATCCATACATTCTGGG + Intergenic
1107200392 13:37708865-37708887 CTAACTAATCTCTACCTTCTCGG + Intronic
1109046668 13:57421638-57421660 CTACCTCATCACAACATGCCAGG - Intergenic
1114829092 14:26117344-26117366 CCAGCACATCTCTACATGCCTGG - Intergenic
1120258087 14:82144856-82144878 CTTATTCCTCTCTACATGATAGG + Intergenic
1120677559 14:87439088-87439110 CAAGCACATCTCTAGATGCTGGG + Intergenic
1124991377 15:34677327-34677349 CTAACTGATCTTTACCTGTTTGG - Intergenic
1127010732 15:54624639-54624661 CTAACTGATCTTTACATATTTGG - Intronic
1127419949 15:58795265-58795287 CCACCTAATCTCTGCATGCTGGG - Intronic
1130123220 15:81070130-81070152 CTTCCTGACCTCTACATGCTGGG - Intronic
1135059129 16:19255925-19255947 CTAGATCATCTCCACATACTGGG + Intronic
1137345186 16:47651139-47651161 GTAGCTCATCTCTAAAAGCTAGG + Intronic
1138975585 16:62203259-62203281 CTAACTCATCTTGACATGTTAGG + Intergenic
1139328419 16:66169310-66169332 CTTACTCATCACTGCATCCTGGG + Intergenic
1140937901 16:79691821-79691843 TTAAAACATCTCTAAATGCTTGG - Intergenic
1145780251 17:27558110-27558132 CTAACACTTCTGTACTTGCTTGG - Intronic
1145928247 17:28664204-28664226 CTATCTAATGTCTAAATGCTGGG + Intronic
1147219870 17:38922210-38922232 CTAATTCATCTCTAAATCCCGGG + Intergenic
1147798788 17:43066756-43066778 TTAACTCCTATCTACCTGCTGGG - Intronic
1153711880 18:7808345-7808367 CTAACTCGCCTCTACATGGATGG - Intronic
1159564863 18:70037070-70037092 CTAAATGATCTCTCCATGCATGG - Intronic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
1166110332 19:40618554-40618576 ATAACTCATCTCTACAGGCCAGG - Intronic
929615864 2:43306747-43306769 CTAACTCCTCTCTCCATGTTGGG - Intronic
931691921 2:64841201-64841223 AAATCTCATCTCTACAAGCTGGG - Intergenic
932988998 2:76763572-76763594 CTAACTCATCTGCATAGGCTAGG - Intronic
937536191 2:122890872-122890894 CTAACTCTTCTTTAAATGTTTGG - Intergenic
941428913 2:165388046-165388068 CTAAGTCTTTTCTTCATGCTAGG - Intronic
942936981 2:181569164-181569186 CTAACTCACATCTGAATGCTGGG + Intronic
943527333 2:189032997-189033019 CTACCTCATCTCTAGAAGCTGGG - Exonic
945165880 2:206944182-206944204 CTTACTGAGCACTACATGCTAGG - Intronic
1170733570 20:18994378-18994400 GTAGCTCATCTCTGCATCCTTGG + Intergenic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1179202680 21:39240853-39240875 ATAACTAAACTCTACATACTAGG + Intronic
949490955 3:4588520-4588542 CTTTCTCACCTCTAAATGCTGGG + Intronic
949934119 3:9103291-9103313 CTAGCTCATCTCTTCTTGCCAGG - Intronic
951727870 3:25780513-25780535 CTTTCAGATCTCTACATGCTGGG + Intronic
952360015 3:32621202-32621224 CTAACTCATCTCTCCAGGAGAGG - Intergenic
953123903 3:40072667-40072689 CCAAGACATCTCCACATGCTTGG - Intronic
957876169 3:86149252-86149274 CTACCTCACCTCTACATCCAGGG + Intergenic
962489311 3:135876839-135876861 ATAACCCATCTTTTCATGCTAGG - Intergenic
966283892 3:178270166-178270188 CCATCTCATCTCATCATGCTGGG - Intergenic
967762672 3:193242549-193242571 CTTATTAATCTCTACATTCTAGG - Intronic
967804537 3:193703727-193703749 CCAACTTATTTCTAGATGCTGGG - Intergenic
969555778 4:7908622-7908644 CTAATTCATCACTAATTGCTGGG + Intronic
972086187 4:35219750-35219772 CTAATTCACTTCTGCATGCTTGG + Intergenic
974399134 4:61378459-61378481 CAGACTCATCTCTATATGCTTGG - Intronic
978916672 4:114133349-114133371 ATAACTCATCACAACATACTGGG + Intergenic
979538100 4:121847501-121847523 GTAATTCATCTCTACAGGCTGGG - Exonic
980768882 4:137345730-137345752 CTAACTCATGACTCCAAGCTTGG - Intergenic
980840405 4:138253158-138253180 CTACCTTTTCTCTACATTCTTGG - Intergenic
983696622 4:170540753-170540775 CTGACTCAACTCTACATTCCAGG + Intergenic
986218895 5:5748868-5748890 CTAAATAATCTCTGCATGCTTGG - Intergenic
988635945 5:32985055-32985077 CCAACTCATCTTGACTTGCTGGG + Intergenic
990058287 5:51613515-51613537 CTAACTAATCTACAAATGCTGGG - Intergenic
990863104 5:60350374-60350396 CTTTCTCATCTCTCCAGGCTAGG + Intronic
994520865 5:100833189-100833211 CTAACTGATCTTTACATCCCTGG + Intronic
996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG + Intronic
997162817 5:131626699-131626721 CTAACTCCTCTCTACAACCTTGG + Intronic
999036904 5:148361669-148361691 TTAAATCATCTCTACAAGCTAGG - Intergenic
1001540338 5:172533447-172533469 CTAATCCATGTTTACATGCTGGG + Intergenic
1001693469 5:173650655-173650677 CTAAATCATCTCTGCATCCGTGG + Intergenic
1003828536 6:9978754-9978776 CTGCCTCCTCTCCACATGCTGGG - Intronic
1004814438 6:19297608-19297630 CTGAATGATCACTACATGCTAGG + Intergenic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1013203357 6:107923598-107923620 CTCACTCATCTCAACCTTCTTGG + Intronic
1013363909 6:109420815-109420837 ATAAATTCTCTCTACATGCTTGG - Intronic
1017934496 6:158992824-158992846 CTTACTCATCTCTGTATCCTAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018961753 6:168454495-168454517 CCAACTCATCTCCCCATCCTGGG + Intronic
1020850160 7:13343034-13343056 CTAAATCATCCCTGCATCCTTGG + Intergenic
1022434866 7:30373377-30373399 CTGTCTCATATCTACATTCTTGG - Intronic
1027666404 7:81046702-81046724 CTAAATCATCTCTCTCTGCTGGG - Intergenic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1029934003 7:104403412-104403434 CTTATTCATCTCTGCATCCTTGG + Intronic
1034016536 7:147593594-147593616 CTAACACCTCTTTACATGATAGG - Intronic
1035131565 7:156659318-156659340 GTAACTCATCTCCATATTCTAGG - Intronic
1037159959 8:15757608-15757630 CTTAATCATCTCTAAATCCTTGG - Intronic
1038123310 8:24642517-24642539 CTGACTCTTCTCTGCATGGTGGG - Intergenic
1039520586 8:38167725-38167747 CTGACCCATCTCTGCATGGTGGG - Intronic
1040529548 8:48255272-48255294 CTATCTCATCTCTGGATGTTTGG + Intergenic
1040735808 8:50507402-50507424 CTAATTCCTCTTTAAATGCTTGG + Intronic
1040835805 8:51730525-51730547 CTTAATCATCTCTACATCCATGG - Intronic
1045842957 8:106600826-106600848 CTGACTGATTTCTTCATGCTAGG + Intronic
1047289930 8:123520958-123520980 CTGCCACATCTTTACATGCTCGG + Intronic
1047517130 8:125564690-125564712 CTCACTCATCTCTATATCCCTGG + Intergenic
1050712971 9:8486803-8486825 CTGACTCCTCACTACATTCTCGG + Intronic
1052983475 9:34466978-34467000 CTAGCTCATCTGTTCATGCTAGG + Intronic
1053484879 9:38444869-38444891 AAAACTCATCTCTTCAAGCTGGG - Intergenic
1054969705 9:71071116-71071138 CTAACTCATACCTACATACTGGG - Intronic
1055519765 9:77069022-77069044 CTTAATGATTTCTACATGCTGGG + Intergenic
1058822550 9:108745962-108745984 CTAGCTCTTCTCTACCTGGTGGG + Intergenic
1058976374 9:110128668-110128690 CTAACCCATCTCGACCTCCTAGG - Intronic
1193258236 X:79375716-79375738 CTAACTCACCTTTGCATCCTTGG + Intergenic
1193638354 X:83980998-83981020 AGATCTCATCTCTACATGCTGGG + Intergenic
1196239221 X:113321453-113321475 TTAAATCATCTTTAAATGCTCGG - Intergenic
1199584670 X:149401843-149401865 TTAACTCATCTTTAAATGTTAGG + Intergenic