ID: 1165231760

View in Genome Browser
Species Human (GRCh38)
Location 19:34391677-34391699
Sequence CTGTCAGTATCTGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 2, 1: 1, 2: 10, 3: 25, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165231760 Original CRISPR CTGTCAGTATCTGAGGAGGT AGG Intronic
901428250 1:9197272-9197294 CGGTCAGGATCTGAGGCGCTAGG + Intergenic
901656131 1:10770721-10770743 CTGTCAGGAACTGATGGGGTGGG - Intronic
904235919 1:29117134-29117156 CTGTCAGTGTCTGTTGGGGTTGG - Exonic
910182429 1:84500138-84500160 CTGTCAGCATCAGTGTAGGTGGG + Intronic
911527181 1:99002134-99002156 CTGTCACCATGTGAGGAGCTGGG - Intronic
911540816 1:99156308-99156330 CTGTCAGGGTGTGGGGAGGTAGG - Intergenic
912426592 1:109598286-109598308 CTCTCAGAATCTTACGAGGTTGG + Exonic
912470923 1:109906210-109906232 CTGGCAGTCTGTGAGGAGGGAGG + Intergenic
912649033 1:111421884-111421906 CTGAGAGTACCTGTGGAGGTAGG + Intronic
912822879 1:112881828-112881850 CTGTCTGTGTCAGAGGAGGAAGG + Intergenic
914894889 1:151660845-151660867 CTATCAGAATCCGATGAGGTAGG + Exonic
915421912 1:155789729-155789751 CCCTCAGTATCTGTGGAGGTTGG + Intronic
916102000 1:161400623-161400645 GTGAAATTATCTGAGGAGGTAGG + Intergenic
919542011 1:198859177-198859199 CTGTAAGTATCTGAAGGGGATGG + Intergenic
919993479 1:202726307-202726329 GTTTCAGTATCCTAGGAGGTGGG - Exonic
921823020 1:219639450-219639472 GAGACTGTATCTGAGGAGGTGGG + Intergenic
922022608 1:221719548-221719570 CTGCTTGTCTCTGAGGAGGTGGG + Intronic
923003462 1:230026577-230026599 CTGACAAGATCTCAGGAGGTGGG + Intergenic
1065903549 10:30228724-30228746 CTGCCAATATCAGAGGAGCTGGG - Intergenic
1066735789 10:38477642-38477664 CTGTCAGTATCTAAAGTGGATGG + Intergenic
1067023467 10:42822609-42822631 TTTTCAGTATTTGGGGAGGTTGG + Intronic
1067808604 10:49410020-49410042 GTGTCAGCAGCAGAGGAGGTGGG + Intergenic
1074670264 10:115782282-115782304 CTGTTAGTTTCTAAGGAGCTTGG - Intronic
1084199219 11:67544102-67544124 CTGTGAGTATCTGTGCATGTGGG + Intergenic
1084682618 11:70675668-70675690 CTGCCAGTATCTGAGCTGCTGGG + Intronic
1085149227 11:74235085-74235107 ATGTCATTATCTGAGGAGAGGGG + Intronic
1085221432 11:74876823-74876845 CTGAAAGTATCTGATAAGGTAGG - Intronic
1088096226 11:106104202-106104224 CTCTCAGTATCTGTGGGGGTTGG + Intergenic
1089508623 11:118981291-118981313 CTGTGTGTGTCTGTGGAGGTGGG + Exonic
1090068740 11:123525840-123525862 CTGCCAGTTTCTGATGAGGATGG - Exonic
1090213866 11:124943106-124943128 CTCTCACTTTCTGAGGAGGCCGG - Intergenic
1092971517 12:13700097-13700119 CTGTCTGTCTGTGGGGAGGTGGG + Intronic
1097748092 12:63321509-63321531 ATGTCTGTATCTGAGTAAGTAGG + Intergenic
1097913507 12:64995588-64995610 CTCTCAGTCTCTGAGTAGCTGGG + Intergenic
1099124213 12:78732137-78732159 CTGACAGTTTGGGAGGAGGTGGG + Intergenic
1104987782 12:132606699-132606721 CTGTCAGCAGCTGGGGAGGGAGG - Intronic
1106565291 13:30879462-30879484 TACTCAGTATCTTAGGAGGTAGG - Intergenic
1107820114 13:44277966-44277988 CCCTAACTATCTGAGGAGGTAGG - Intergenic
1109284402 13:60394935-60394957 TTGTCACAATCTGAGGAGGTAGG - Intergenic
1111819076 13:93191963-93191985 ATTTGAGTATCTGAGGAGTTTGG + Intergenic
1111901319 13:94202716-94202738 ATGTCAGTAACTGGGGAAGTGGG + Intronic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1118164820 14:63325825-63325847 CTTTCAGTATCTGAAGTTGTAGG - Intergenic
1120243301 14:81975134-81975156 CTATCAGGATCTCAGGAGGCTGG + Intergenic
1121003169 14:90466588-90466610 CTGCCAGGAAGTGAGGAGGTGGG + Intergenic
1121114615 14:91334977-91334999 CTGCAGGTATCTGAGAAGGTGGG + Intronic
1122065296 14:99168997-99169019 CTGTCAGAATCTCTGGAGGCAGG - Intergenic
1122594849 14:102883042-102883064 CTGTCAGTATCCTACTAGGTTGG + Intronic
1122788735 14:104175647-104175669 CTTCCAGCAACTGAGGAGGTGGG - Exonic
1126377832 15:48013701-48013723 CTGTCAGCATCTGCTGAGGCTGG + Intergenic
1126961440 15:54001092-54001114 CTGTTTGTAGCTGAGCAGGTTGG + Intergenic
1127037886 15:54939392-54939414 CTGTCAGGATCGGGGGAGGGAGG - Intergenic
1127167644 15:56263714-56263736 TTGTCAGGATCTGAGGATATGGG - Intronic
1127499573 15:59543740-59543762 CTGTCAGTGGCTGTGGAGCTGGG + Intergenic
1129152597 15:73698450-73698472 GTGACAGTATCTGAGGACTTGGG - Intronic
1129289146 15:74550052-74550074 GTCTCAGTAACTGAGGAGTTTGG + Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131462641 15:92629462-92629484 ATGTCAGTAGCTGAGGACGTGGG - Intronic
1131952405 15:97694820-97694842 CTGTCTCTAGCTGAGGAGCTTGG + Intergenic
1140600936 16:76474180-76474202 CTCCCAGTCTCTGGGGAGGTAGG - Intronic
1144625893 17:16844325-16844347 CTGTGAGGATCTGCGGAGATGGG + Intergenic
1146163058 17:30570254-30570276 CTGTGAGGATCTGAGGAGATGGG + Intergenic
1147580045 17:41623023-41623045 CTGTGAGGATCTGAGGAGAAGGG + Exonic
1149566304 17:57643083-57643105 ATATCAGAATCTCAGGAGGTAGG + Intronic
1152129654 17:78468366-78468388 CCTTTGGTATCTGAGGAGGTTGG - Intronic
1152466578 17:80469958-80469980 CTTGCAGGATCTGAGGAGGTGGG + Exonic
1155840727 18:30639447-30639469 CTGACAGTATGTGAGAAGGAGGG + Intergenic
1157085380 18:44575227-44575249 CTGTGAGTATCTTTGGTGGTAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158778623 18:60618459-60618481 TTGTCAGTATCAGAAGAGTTTGG - Intergenic
1158894679 18:61901655-61901677 CAGTTAGAATCAGAGGAGGTGGG - Intergenic
1161040419 19:2108205-2108227 GTGTCTGTATATGAGGAGTTGGG - Intronic
1161731787 19:5965117-5965139 CAGTAGGTCTCTGAGGAGGTGGG + Intronic
1162974209 19:14199022-14199044 CTGCCAGCATCTGATGAGGCAGG - Intronic
1163632559 19:18424846-18424868 CTGACAGTCTCTGAGCAGGGAGG + Intronic
1164123140 19:22286301-22286323 CACTCAGGATCTGAGGAGGCGGG + Intergenic
1165231513 19:34390204-34390226 TTGTCAGTATCTGAGGATGTGGG + Intronic
1165231570 19:34390526-34390548 CTTCCAGTGTGTGAGGAGGTAGG + Intronic
1165231688 19:34391225-34391247 CCATCAGTATCTGAGGAGGTGGG + Intronic
1165231715 19:34391375-34391397 CTGTCAATATCAGAGGAGGTAGG + Intronic
1165231733 19:34391526-34391548 CTGTCAATGTCTGAGGAGGTAGG + Intronic
1165231742 19:34391576-34391598 CTGTCCATGTCTGAGCAGGTAGG + Intronic
1165231753 19:34391626-34391648 CTGTCAATTTCTGAAGAGGTGGG + Intronic
1165231760 19:34391677-34391699 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165231776 19:34391777-34391799 CTTCTAGTGTCTGAGGAGGTGGG + Intronic
1165231781 19:34391828-34391850 CTGTCAGTGACTGAGGAGGTAGG + Intronic
1165231800 19:34391975-34391997 CTGTTCATGTCTGAGGAGGTAGG + Intronic
1165231807 19:34392025-34392047 CTTTCAATGTCTGAGAAGGTAGG + Intronic
1165231815 19:34392075-34392097 CTGTTAATGTCTGAGGAGGTAGG + Intronic
1165231821 19:34392125-34392147 CTGTCAGTTTCTGAGGAGGTAGG + Intronic
1165231827 19:34392175-34392197 CTGTCAATTTCTGAGGAGGTTGG + Intronic
1165231835 19:34392225-34392247 CTGTCAATATCTGAAGAGGTAGG + Intronic
1165231840 19:34392278-34392300 GTGTCAGTGTCTGAGGAATTAGG + Intronic
1165231845 19:34392329-34392351 GTCTCTGTATCTGAGGAAGTAGG + Intronic
1165231855 19:34392425-34392447 CTGTCAGTGTCTGAAGTGGTTGG + Intronic
1165231865 19:34392475-34392497 TTGTCAGTATTTGAGGAGGTAGG + Intronic
1165231882 19:34392575-34392597 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165231889 19:34392625-34392647 TTTTCAATGTCTGAGGAGGTAGG + Intronic
1165231916 19:34392775-34392797 CTGTCCATATCTGAGGAGGTAGG + Intronic
1165231925 19:34392825-34392847 GTGTCCGTGTCTGAGGAGGTGGG + Intronic
1165231939 19:34392875-34392897 CTGTCCGTGTCTGAGGAGGTGGG + Intronic
1165231953 19:34392925-34392947 GTGTCCGTGTCTGAGGAGGTGGG + Intronic
1165232246 19:34394434-34394456 CTGTTAGTATCTGGGGAGGAAGG + Intronic
1165232256 19:34394484-34394506 CTGTCCATGTCTGAGGAGGTGGG + Intronic
1165379585 19:35468876-35468898 CAGGCAGAATCTGAGGAGGATGG - Intergenic
927276450 2:21266398-21266420 ATGTCAGTCTCTGAGCAGATGGG + Intergenic
927710378 2:25321932-25321954 CTGTCAATATTTAAGGAGGATGG + Intronic
928128588 2:28632805-28632827 CCATCAGTATCTGAGCAAGTTGG + Intronic
929642072 2:43591464-43591486 CTGTGATTCTCTGTGGAGGTGGG - Intronic
930141225 2:47953330-47953352 ATGCCAGTGTCTGGGGAGGTGGG + Intergenic
930676732 2:54209634-54209656 CTGTCAGTTTCTGAAGAGATAGG - Intronic
930776795 2:55180689-55180711 CTGACATTTTCTGAGGAGGCTGG - Exonic
931619434 2:64195018-64195040 TTGGCAGAATCTGAAGAGGTGGG + Intergenic
932412401 2:71555113-71555135 CTGCCAGTCTCTGGGAAGGTGGG - Intronic
934720097 2:96568126-96568148 CTGCAAGTATCTGAGAGGGTGGG + Intergenic
934919643 2:98332417-98332439 TTGTCAGAATGTGATGAGGTGGG + Intronic
935079997 2:99783354-99783376 CTGTCAGTGTCTGGGGACGCTGG + Intronic
936736966 2:115456805-115456827 CTGTCAGTGGGTGAGGAGCTAGG + Intronic
937052862 2:118906529-118906551 ATGTCATCAGCTGAGGAGGTGGG - Intergenic
937085003 2:119165770-119165792 CTGTGAGCATCTCAGGAGCTAGG - Intergenic
937826026 2:126369295-126369317 CTGTGAGGGTCTGAGAAGGTTGG + Intergenic
938383676 2:130850247-130850269 CTGTCTGTACCTGAGGAAGGAGG + Intronic
939981985 2:148793550-148793572 CTGTCACAATCTGAGGAGCTTGG - Intergenic
941754277 2:169167958-169167980 ATGTCAGTAGCAGAGGAGGAGGG - Intronic
942632922 2:177971449-177971471 CTGAAAGTATCTGTGGAGGTAGG - Intronic
947572854 2:231249496-231249518 GTGTCAGGATGTGGGGAGGTGGG - Intronic
948132057 2:235608263-235608285 CTGTCAGAATCAGAGCAGGCTGG + Intronic
948915637 2:241033932-241033954 CTGTCATGAGCTGATGAGGTAGG + Intronic
1169765365 20:9142566-9142588 ATGTCAGTATCTGAAGATATGGG - Intronic
1174250937 20:49219179-49219201 GTGGCAGTATTTGAGGAGGGTGG - Intergenic
1178600683 21:33991968-33991990 CTGCCAGTCTCTGGGGAGGAGGG + Intergenic
1179463116 21:41550960-41550982 CTGCAAGTATCTGAAGAGGTAGG + Intergenic
1182203758 22:28601649-28601671 CTCTCAGTATCTTGGGAGATTGG - Intronic
1182489902 22:30664615-30664637 CTGGCAGTCACTGAGGAGGCTGG + Intronic
1185385208 22:50528777-50528799 GTGTCAGTAGGGGAGGAGGTTGG + Intronic
949142763 3:654751-654773 CTGTCAGTAGGTGAGGGGCTAGG + Intergenic
950579735 3:13854333-13854355 TTGTCAGTTACTGAAGAGGTTGG - Intronic
950813800 3:15676541-15676563 CTGTCAGTCTATCTGGAGGTTGG + Intronic
951588235 3:24236595-24236617 ATGACAGCATCTGGGGAGGTGGG - Intronic
951880389 3:27475657-27475679 CTGTTTGTATCTGGGGAAGTTGG - Intronic
953234735 3:41096238-41096260 CTTGCAGTCACTGAGGAGGTGGG - Intergenic
954643481 3:52116316-52116338 CTCTCAGTATCAGAGGAACTAGG + Intronic
955660013 3:61288460-61288482 CTGGAAGTATCAGAGTAGGTTGG - Intergenic
955963360 3:64363490-64363512 CAGTCAGTGACTGGGGAGGTGGG - Intronic
956043955 3:65175457-65175479 GTGTCAGTATCTGAGCAGGCAGG - Intergenic
959821128 3:110736915-110736937 CTGTGAGAAGCTGAGGTGGTAGG - Intergenic
961392939 3:126567174-126567196 TTGTCAGGAGCTGGGGAGGTGGG + Intergenic
963130226 3:141851161-141851183 CTGTCTGTTTCTGAGTAGCTGGG + Intergenic
964309335 3:155375999-155376021 CTGCCACTATCAGAGGAGATTGG + Intronic
968221202 3:196941704-196941726 TTTTCAGTATCAGCGGAGGTAGG - Intronic
970665869 4:18335507-18335529 ATGTAGATATCTGAGGAGGTGGG + Intergenic
971134016 4:23847073-23847095 AAGTCAGTATCTTTGGAGGTGGG + Intronic
971592796 4:28490257-28490279 ATGTCCGCATCTCAGGAGGTTGG - Intergenic
975530849 4:75397577-75397599 CTGTCAGTGTTTGCGGAGTTTGG - Intergenic
975855207 4:78617378-78617400 CTGTCAGTATCTGGGAAAGCAGG - Intergenic
976785165 4:88811479-88811501 CTGGCACTAGCTGAGTAGGTAGG - Intronic
977986979 4:103394432-103394454 CAGTCAGGATCTGTGGATGTGGG + Intergenic
982285527 4:153729809-153729831 AGGTGAGTATCTGAGGAGTTCGG + Intronic
983750575 4:171264521-171264543 CTGGAAGTCTCTGAGGAGGTGGG + Intergenic
985976049 5:3419954-3419976 CTTTCCTTCTCTGAGGAGGTTGG - Intergenic
987197703 5:15543894-15543916 CTGTCAGCAGTTGATGAGGTAGG + Intronic
990128602 5:52550824-52550846 CTGTCAATGACTGAGGAGCTGGG - Intergenic
996406665 5:123111958-123111980 CTATCTATATCTGGGGAGGTGGG - Intronic
998387391 5:141765525-141765547 CTCTCAGTAGCTGCGGAGGTGGG + Intergenic
998452168 5:142243359-142243381 CTGTCATTATTTGCGGAGGAAGG - Intergenic
999064123 5:148667213-148667235 CTGTAAATATCTGAAGAGTTTGG + Intronic
999702241 5:154238791-154238813 CTGTTATTGTCTGAGGATGTTGG + Intronic
999779902 5:154840913-154840935 CTTTCAGTGTTTGAGGAGTTAGG + Intronic
1001155076 5:169265683-169265705 CTTGCAGTATCCTAGGAGGTAGG - Intronic
1001291900 5:170469572-170469594 CAGTCAGTAGCTGGGGAGGCAGG - Intronic
1001420808 5:171585897-171585919 CTGTTAGTGTCTGGGAAGGTTGG + Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1005003860 6:21269121-21269143 CTGTCAGTCTCTGTGCAGGCTGG - Intergenic
1010481266 6:76357106-76357128 CTGTCAGTATCTGATAACATTGG - Intergenic
1012085633 6:94823039-94823061 ATGTCAGTATCTGAAATGGTGGG - Intergenic
1012908056 6:105090382-105090404 GTGTCAGTATCTGTGAGGGTGGG + Intergenic
1017011275 6:150065317-150065339 CTGTCAGTGTCTGAGTATGGTGG - Intronic
1017427103 6:154333474-154333496 CTGTCTGAAGCTGAGGAGCTAGG - Intronic
1019141039 6:169943345-169943367 CAGTCAGCATGTGAGGAGTTTGG + Intergenic
1021431280 7:20560821-20560843 CTGTCTGCAGCTGGGGAGGTGGG - Intergenic
1022738072 7:33094516-33094538 TGGTCAGTATCTGAGGGGGTTGG - Intergenic
1022999538 7:35793988-35794010 CTCTCAGTATCAGAGGGGATTGG + Intergenic
1023070719 7:36430200-36430222 CTGACAGTATCTGACAAGGCAGG - Intronic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1029916804 7:104218597-104218619 CTGTCAGGTAATGAGGAGGTGGG + Intergenic
1030100600 7:105941765-105941787 CTGTCAATCACTGAGCAGGTGGG - Intronic
1031197401 7:118633384-118633406 CTTTGAGAATCTGAGGAGGGTGG - Intergenic
1033030444 7:137820910-137820932 CTGACATTTTCAGAGGAGGTTGG - Intronic
1033116853 7:138633086-138633108 TTGTCAGTATCTCAGTAGGAAGG + Intronic
1033374551 7:140745416-140745438 CTTTCAGTATCTGCTGGGGTGGG + Intronic
1034639571 7:152591988-152592010 CTGCCAGGGTGTGAGGAGGTGGG + Intergenic
1035628958 8:1093896-1093918 CTGTCTGCATCTGAGGAAGCGGG + Intergenic
1036584622 8:10111868-10111890 CTGTCATTAACGGAGGAGGATGG + Intronic
1037306660 8:17511882-17511904 GTGTCAGTGTGTTAGGAGGTGGG - Intronic
1038431938 8:27507417-27507439 CTGTCCGTCCCTGAGGTGGTTGG + Intronic
1040516573 8:48140422-48140444 GAGACTGTATCTGAGGAGGTGGG + Intergenic
1041008090 8:53515300-53515322 CTGTGAGTATCTGGTTAGGTGGG - Intergenic
1042760389 8:72266226-72266248 CTGAAAGTATCTGATAAGGTAGG + Intergenic
1043707084 8:83363883-83363905 TTGACAGTATCTGAGGATATTGG - Intergenic
1043959028 8:86394253-86394275 ATTTGAGTCTCTGAGGAGGTAGG - Intronic
1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG + Intergenic
1049319286 8:141987403-141987425 CTGTCAGGAGGTCAGGAGGTAGG + Intergenic
1051044862 9:12860812-12860834 CTAACAGTATCTGACAAGGTAGG + Intergenic
1051580724 9:18670872-18670894 CTTTTGGTATCTGTGGAGGTGGG - Intronic
1052697624 9:31898551-31898573 CTGTCAGGAGGTGGGGAGGTAGG - Intergenic
1056198150 9:84248690-84248712 CTGTCAGTAGGTGGGGAGCTGGG + Intergenic
1059803045 9:117770420-117770442 CTGCCAATATCTGTGGGGGTAGG + Intergenic
1061200932 9:129138152-129138174 CTGTCAGTGCCTGAGGACGTGGG + Intronic
1061201313 9:129140070-129140092 CTGTCAGTAACTGGGGGGATGGG - Intronic
1061530696 9:131209918-131209940 CTGTAAGTATCTGAGGTGGGAGG - Intronic
1062130373 9:134889462-134889484 CAGTCAGTATGTCAGGAGGCTGG + Intergenic
1187651054 X:21406716-21406738 CTGTCAAGATCAGAAGAGGTAGG + Intronic
1188546821 X:31316874-31316896 CTGTCAGTCTTTGAGGATGCTGG - Intronic
1189240881 X:39523398-39523420 GTGACTGTCTCTGAGGAGGTAGG - Intergenic
1191165645 X:57387865-57387887 ATGTGTGTATCTGAGGAGGGAGG + Intronic
1191952106 X:66603694-66603716 GTGGTTGTATCTGAGGAGGTAGG + Intronic
1192216420 X:69162507-69162529 CTGTGAGTATTTGTGGTGGTGGG - Exonic
1194456251 X:94107295-94107317 CTGTCAGGAAGTGAGGAGGTGGG + Intergenic
1194719084 X:97319755-97319777 CAGTCAGTATCTGTGTAGGAAGG + Intronic
1194804803 X:98314076-98314098 CTGTAAATATTTGAGGATGTTGG + Intergenic
1195338442 X:103879734-103879756 CTTTCTTTATCTGAGGGGGTCGG + Intergenic
1196371867 X:114987997-114988019 TTGTCAGTACTTGAGGAGGTAGG + Intergenic
1198159900 X:133997558-133997580 CTTTCAGAGTCTGAGGTGGTCGG - Intergenic
1200846996 Y:7840527-7840549 CTCTCTGTAGCTGAGAAGGTCGG + Intergenic
1202384218 Y:24309073-24309095 CTGTCAGTATCTAAAGTGGATGG + Intergenic
1202486565 Y:25361051-25361073 CTGTCAGTATCTAAAGTGGATGG - Intergenic