ID: 1165232202

View in Genome Browser
Species Human (GRCh38)
Location 19:34394184-34394206
Sequence CAAGGAGCACAGATGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 1078}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165232202_1165232207 8 Left 1165232202 19:34394184-34394206 CCAAGGTCCATCTGTGCTCCTTG 0: 1
1: 0
2: 2
3: 37
4: 1078
Right 1165232207 19:34394215-34394237 TGAATCTTTGTAACTGAGGTTGG 0: 1
1: 0
2: 0
3: 18
4: 217
1165232202_1165232206 4 Left 1165232202 19:34394184-34394206 CCAAGGTCCATCTGTGCTCCTTG 0: 1
1: 0
2: 2
3: 37
4: 1078
Right 1165232206 19:34394211-34394233 AGGATGAATCTTTGTAACTGAGG 0: 1
1: 0
2: 1
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165232202 Original CRISPR CAAGGAGCACAGATGGACCT TGG (reversed) Intronic
900521101 1:3105941-3105963 TAAGGAGCACAGGTGGACCCCGG - Intronic
900852803 1:5157354-5157376 CAAGGAGCACTGAAGAACCAGGG + Intergenic
901114006 1:6825993-6826015 CAAGGCACACAAATGGAACTTGG - Intronic
901203767 1:7482404-7482426 CGTGGGGCACAGCTGGACCTAGG - Intronic
901409073 1:9070396-9070418 TAAGGAGCTCAGAATGACCTAGG + Intronic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902141042 1:14355624-14355646 CAAGGAGAACACATGGACGCAGG - Intergenic
902170307 1:14604798-14604820 ACAGGAGCTCAGATGGAGCTTGG + Intronic
902786982 1:18739048-18739070 AAGGGAGGACAGATGGACCTGGG - Intronic
902939589 1:19791105-19791127 CAATGAGCACACATGGACACAGG + Intronic
903727459 1:25461158-25461180 CAAGGAGAACACATGGACACAGG + Intronic
904001073 1:27339115-27339137 CAGGGAGCACAGAAGGCCCAGGG + Intergenic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
906736388 1:48133067-48133089 CAATGAGAACACATGGACATAGG - Intergenic
906872127 1:49494468-49494490 CAATGAGAACACATGGACATAGG - Intronic
907003459 1:50886572-50886594 CAATGAGAACACATGGACCCAGG - Intronic
907582683 1:55586034-55586056 CAATGAGAACACATGGACATAGG - Intergenic
907613593 1:55900014-55900036 CAATGAGCACACATGGACATAGG + Intergenic
907640516 1:56184552-56184574 CAAGGAAAACACATGGACATAGG + Intergenic
907649013 1:56275614-56275636 CAATGAGAACACATGGACATAGG + Intergenic
907650111 1:56286827-56286849 CAAAGAGCACAGATAGGCCTAGG + Intergenic
907821994 1:57979361-57979383 CAACGAGAACACATGGACATAGG + Intronic
908108576 1:60872666-60872688 CAAGGATCACAAAAGGAACTTGG - Intronic
908344249 1:63215525-63215547 CAATGAGAACACATGGACATAGG + Intergenic
908610654 1:65856376-65856398 CAATGAGAACACATGGACATAGG - Intronic
908669941 1:66534619-66534641 CAGGGAGCTGAGATGGAGCTAGG + Intronic
908736710 1:67284106-67284128 CAATGAGAACACATGGACATAGG - Intergenic
908893328 1:68870316-68870338 CAATGAGAACACATGGACATAGG - Intergenic
909268128 1:73588461-73588483 CAAGGAGAACACATGGACACAGG - Intergenic
909403837 1:75263927-75263949 CAATGAGCACACATGGACACAGG + Intronic
909492663 1:76242649-76242671 CAAGGAGAACACATGGACACAGG - Intronic
909513612 1:76482919-76482941 CAATGAGAACAGATGGACACAGG - Intronic
909672944 1:78209363-78209385 CAATGAGAACACATGGACATAGG + Intergenic
909675945 1:78239287-78239309 CAATGAGAACACATGGACATAGG + Intergenic
910004629 1:82381342-82381364 CAATGAGAACACATGGACATAGG + Intergenic
910452537 1:87361703-87361725 CAATGAGAACACATGGACATAGG + Intergenic
910723853 1:90317044-90317066 CAATGAGAACACATGGACATGGG + Intergenic
910740274 1:90508075-90508097 CAATGAGAACACATGGACCCAGG - Intergenic
911009115 1:93260812-93260834 CAATGAGAACACATAGACCTAGG - Intronic
911540831 1:99156356-99156378 CAAGGAGAACAGATGGACACAGG - Intergenic
911791332 1:102019211-102019233 CAATGAGAACACATGGACATAGG + Intergenic
911815446 1:102344053-102344075 CAATGAGAACACATGGACCCAGG + Intergenic
911873744 1:103132621-103132643 CAAGGAGAACACATGGACACAGG - Intergenic
911963954 1:104341919-104341941 CAATGAGAACACATGGACATAGG + Intergenic
912007389 1:104921114-104921136 CAATGAGAACACATGGACATAGG + Intergenic
912034516 1:105295277-105295299 CAATGAGAACACATGGACATAGG + Intergenic
912052620 1:105549025-105549047 CAAAGAGAACACATGGACATGGG - Intergenic
912093913 1:106115958-106115980 CAATGAGAACACATGGACCCAGG + Intergenic
913072189 1:115309619-115309641 CAAGGAGGACACATGGACACAGG - Intronic
913660719 1:121004350-121004372 CAAGAAGCACAGTTTGGCCTGGG + Intergenic
914012082 1:143787506-143787528 CAAGAAGCACAGTTTGGCCTGGG + Intergenic
914165749 1:145173628-145173650 CAAGAAGCACAGTTTGGCCTGGG - Intergenic
914402038 1:147330515-147330537 CAATGAGAACAGATGGACACAGG + Intergenic
914650713 1:149696169-149696191 CAAGAAGCACAGTTTGGCCTGGG + Intergenic
914966851 1:152267194-152267216 CAATGAGAACAGATGGACACAGG + Intergenic
914969530 1:152294820-152294842 CAATGAGAACAGATGGACACAGG - Intergenic
915733585 1:158070866-158070888 AGAGGAGCACAGAGGGACCCTGG - Intronic
916487116 1:165269840-165269862 CAAGGAGAACACATGGACACAGG + Intronic
916499923 1:165377610-165377632 CAATGAGAACACATGGACATAGG - Intergenic
916551665 1:165855741-165855763 CGAGGAGCACAGGTGGATGTGGG + Intronic
916857898 1:168770211-168770233 CAATGAGAACACATGGACGTGGG + Intergenic
916978060 1:170103112-170103134 CAATGAGAACACATGGACATAGG - Intergenic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917482099 1:175421107-175421129 CAAGCAGCAGAGCTGGACATGGG + Intronic
917890809 1:179436637-179436659 CAATGAGCACACATGGACACAGG + Intronic
917993420 1:180408466-180408488 CAATGAGAACACATGGACATAGG + Intronic
918032726 1:180831590-180831612 CAAAGAGAACATATGGACATGGG - Intronic
918060131 1:181053791-181053813 CTGGGATCACAGAAGGACCTGGG + Intronic
918340538 1:183564692-183564714 CAAGGATCACATATAAACCTAGG - Intronic
918404276 1:184196022-184196044 CAAGGAGAACACATGGACACAGG + Intergenic
918675693 1:187282347-187282369 CAATGAGAACATATGGACATAGG + Intergenic
918839725 1:189518843-189518865 CAATGAGAACAGATGGACAAAGG + Intergenic
918910086 1:190556349-190556371 CAATGAGAACACATGGACATAGG + Intergenic
918914947 1:190623052-190623074 CAAGGAGAACACATGGACACAGG - Intergenic
919009448 1:191940759-191940781 CAATGAGAACAAATGGACATAGG + Intergenic
919093362 1:192999761-192999783 CAATGAGGACACATGGACGTAGG + Intergenic
919215845 1:194553243-194553265 CAAGGAGAACACATGGACACAGG - Intergenic
919236070 1:194844018-194844040 CAATGAGAACACATGGACATAGG - Intergenic
919326299 1:196111207-196111229 CAATGAGAACACATGGACCCAGG + Intergenic
919368320 1:196694199-196694221 CAATGAGAACACATGGACATAGG - Intronic
919384821 1:196908105-196908127 CAAGGAGAACAGGTGGACTCAGG + Intronic
920604636 1:207369859-207369881 CAATGAGAACAGATGGACACAGG + Intergenic
921216281 1:212939305-212939327 CAAGGAGAAAAGCTAGACCTAGG + Intergenic
921300593 1:213748056-213748078 TAAAGAGCAGAGATGGATCTAGG - Intergenic
921406940 1:214790501-214790523 CAATGAGCACACATGGACACAGG - Intergenic
921513966 1:216067208-216067230 CAATGAGAACACATGGACATAGG + Intronic
921551899 1:216546998-216547020 CAATGAGAACACATGGACATAGG - Intronic
922085593 1:222344003-222344025 CAAGGACCACAAATGGAGCAAGG + Intergenic
922198606 1:223381792-223381814 CAATGAGAACACATGGACCCAGG - Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923292989 1:232564846-232564868 CAACGAGAACACATGGACATAGG + Intergenic
923655816 1:235915800-235915822 CAATGAGAACACATGGACATAGG + Intergenic
923676661 1:236086435-236086457 CCAGGAGCACTGATAGGCCTAGG - Intergenic
923761287 1:236847306-236847328 CAAGGAGCAGAGATCGAACAGGG - Intronic
924029664 1:239873536-239873558 CAATGAGAACACATGGACATAGG - Intronic
924160158 1:241222858-241222880 CAATGAGAACACATGGACATAGG - Intronic
924170855 1:241339083-241339105 CAATGAGAACAGATGGACACAGG - Intronic
924559364 1:245144621-245144643 CAATGAGAACACATGGACCCAGG - Intergenic
924661266 1:246019665-246019687 AAGATAGCACAGATGGACCTAGG - Intronic
924727071 1:246681002-246681024 GAAAGAGACCAGATGGACCTTGG - Intergenic
924869481 1:248025896-248025918 CAATGAGAACACATGGACATAGG + Intronic
1063290120 10:4736432-4736454 CAAGGAGAACACATGGACACAGG + Intergenic
1063500413 10:6548680-6548702 CAATGAGAACACATGGACATAGG + Intronic
1063798427 10:9540383-9540405 CAATGAGAACACATGGACTTAGG - Intergenic
1064245875 10:13667296-13667318 CAAGGGGCACAAATGGACAGTGG + Intronic
1064975057 10:21105380-21105402 CAATGAGAACACATGGACCCAGG - Intronic
1065428011 10:25625880-25625902 CAATGAGAACAGATGGACACAGG + Intergenic
1065582907 10:27189569-27189591 CAATGAGAACACATGGACATAGG + Intergenic
1065606565 10:27424188-27424210 CAATGAGAACACATGGACATAGG + Intergenic
1065841585 10:29705681-29705703 CAAGGAGAACACATGGACATAGG - Intronic
1066502570 10:36008305-36008327 CAATGAGAACACATGGACATAGG - Intergenic
1066619779 10:37334382-37334404 CAATGAGAACACATGGACCCAGG - Intronic
1067786304 10:49251422-49251444 CAATGAGAACACATGGACCCAGG + Intergenic
1067912967 10:50365627-50365649 CAAGGAGAACACATGGACACAGG - Intronic
1067965727 10:50910465-50910487 CAATGAGAACACATGGACCCAGG - Intergenic
1068023161 10:51609784-51609806 CAATGAGAACACATGGACATAGG + Intronic
1068050268 10:51941647-51941669 CAATGAGAACAGATGGACACAGG - Intronic
1068111561 10:52686557-52686579 CAATGAGGACAGATGGACACAGG + Intergenic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1068152100 10:53145578-53145600 CAATGAGAACACATGGACATAGG - Intergenic
1068369015 10:56090047-56090069 CAATGAGAACACATGGACCCAGG + Intergenic
1068390622 10:56391693-56391715 CAATGAGAACACATGGACCCAGG + Intergenic
1068490855 10:57721961-57721983 CAATGAGAACATATGGACCCAGG + Intergenic
1068635888 10:59347721-59347743 CAATGAGAACACATGGACATAGG - Intronic
1068731622 10:60364490-60364512 CAATGAGAACACATGGACCCAGG + Intronic
1069167898 10:65186708-65186730 CAATGAGAACACATGGACATAGG - Intergenic
1069340147 10:67400114-67400136 CAATGAGAACACATGGACATAGG - Intronic
1070348637 10:75570338-75570360 CTAGGAGCTCTGCTGGACCTGGG + Intronic
1070369324 10:75766837-75766859 CAAGGAGAACACATGGACACAGG - Intronic
1070479075 10:76863571-76863593 CAATGAGAACACATGGACATGGG - Intergenic
1070734489 10:78854171-78854193 CAATGAGAACACATGGACTTAGG + Intergenic
1070908695 10:80098597-80098619 CAATGAGAACACATGGACATAGG + Intergenic
1070958372 10:80480727-80480749 CAAGGAGAACACATGGACACAGG + Intronic
1071141376 10:82513150-82513172 CAATGAGAACATATGGACATAGG - Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071364079 10:84881043-84881065 CAAGGAGAACACATGGACACAGG - Intergenic
1071412367 10:85409353-85409375 CAAGGAGAGCACATGGACATAGG - Intergenic
1071413272 10:85417790-85417812 CAATGAGAACACATGGACATAGG + Intergenic
1072365571 10:94705308-94705330 CAAGGAGAACACATGGACCCAGG + Intronic
1072410782 10:95200294-95200316 CAATGAGCACACATGGACACAGG + Intronic
1072576434 10:96704808-96704830 TAATGTGCACAGAAGGACCTGGG - Intronic
1073096698 10:100984332-100984354 TGAGGAGCACCGATGGGCCTGGG - Exonic
1073639281 10:105233603-105233625 CAATGAGAACACATGGACATAGG - Intronic
1074524043 10:114249217-114249239 CAATGAGAACATATGGACATGGG - Intronic
1075390450 10:122087382-122087404 GAAGGGGCACACGTGGACCTTGG - Exonic
1075679077 10:124319585-124319607 CAATGAGAACACATGGACATAGG - Intergenic
1075916557 10:126173053-126173075 CAATGAGAACACATGGACATAGG + Intronic
1075939655 10:126379488-126379510 CAATGAGAACACATGGACATAGG + Intronic
1076749115 10:132533416-132533438 CAAGGAGCAGAGAGGGAGATGGG - Intergenic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1076933014 10:133546341-133546363 CAGTGAGGAGAGATGGACCTGGG - Intronic
1077266581 11:1653727-1653749 CACGGAGCCCAGATGGGCCTGGG + Intergenic
1077313810 11:1906737-1906759 CCGGGAGCTCACATGGACCTAGG - Intergenic
1077428532 11:2500821-2500843 CAAGGAGAACACATGGACACAGG + Intronic
1077509455 11:2948990-2949012 CAAGTAGCAAAGATGTAACTTGG - Intronic
1077933688 11:6760169-6760191 CAATGAGAACACATGGACATAGG - Intergenic
1078111967 11:8402412-8402434 CAATGAGAACAGATGGACACAGG + Intronic
1078312966 11:10264778-10264800 CAATGAGAACACATGGACATAGG - Intronic
1078635871 11:13049513-13049535 CAAGGAGAACACATGGACACAGG - Intergenic
1079226939 11:18614936-18614958 CAAGCAGCTCAGGTGGCCCTGGG - Exonic
1079317088 11:19417916-19417938 AAACGAGAACACATGGACCTGGG + Intronic
1079534302 11:21492692-21492714 CAATGAGAACACATGGACATAGG + Intronic
1079863564 11:25705944-25705966 CAATGAGAACACATGGACATAGG - Intergenic
1079959211 11:26902080-26902102 CAATGAGAACACATGGACATGGG + Intergenic
1080079958 11:28205300-28205322 CAAGGAGAACACATGGACACAGG - Intronic
1080118470 11:28647213-28647235 CAATGAGAACACATGGACATAGG + Intergenic
1080238036 11:30094410-30094432 CAATGAGAACACATGGACATAGG - Intergenic
1080316030 11:30949802-30949824 CAATGAGAACAGATGGACACAGG + Intronic
1080328961 11:31113483-31113505 CAAGGAGAACACATGGACACAGG - Intronic
1081020243 11:37937276-37937298 CAATGAGAACACATGGACCCAGG - Intergenic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1081261283 11:40964564-40964586 CAATGAGAACACATGGACCCAGG - Intronic
1081363797 11:42211084-42211106 CAATGAGAACACATGGACATAGG + Intergenic
1082102648 11:48185956-48185978 CAATGAGAACACATGGACATGGG - Intergenic
1082142049 11:48620402-48620424 CAATGAGAACACATGGACCTGGG + Intergenic
1082569211 11:54717221-54717243 CAATGAGAACACATGGACCTGGG + Intergenic
1082616506 11:55367643-55367665 CAAGGAGAACACATGGACACAGG - Intergenic
1082688856 11:56275308-56275330 CAATGAGAACACATGGACATAGG - Intergenic
1082713250 11:56580690-56580712 CAATGAGAACACATGGACATAGG + Intergenic
1083086487 11:60153150-60153172 CAATGAGAACACATGGACATAGG - Intergenic
1083860098 11:65415779-65415801 CAAGGGGCACAGATAAAGCTGGG + Intergenic
1084940995 11:72613285-72613307 CCAAGAGCACAGCCGGACCTTGG - Intronic
1084992978 11:72946343-72946365 CAATGAGAACACATGGACATAGG + Intronic
1085248537 11:75125255-75125277 CAATGAGAACACATGGACCCAGG + Intronic
1085683243 11:78597632-78597654 CAAGGAGAACACATGGACACAGG - Intergenic
1086220952 11:84442475-84442497 CAATGAGAACACATGGACCCAGG + Intronic
1086333428 11:85776443-85776465 CAATGAGAACAGATGGACACAGG - Intronic
1086334415 11:85785322-85785344 CAAGCAACACAGCTGGACCCAGG + Intronic
1086631845 11:89028975-89028997 CAATGAGAACACATGGACATGGG - Intronic
1086664640 11:89465178-89465200 CAATGAGAACACATGGACATAGG - Intronic
1086787948 11:90995461-90995483 CAAGGAGAACACATGGACACAGG - Intergenic
1087103933 11:94392270-94392292 CAATGAGAACACATGGACCTAGG + Intronic
1087572181 11:99942721-99942743 CAATGAGAACACATGGACATAGG - Intronic
1087671031 11:101107009-101107031 CAATGAGAACACATGGACTTAGG + Intronic
1087904747 11:103682559-103682581 CAAGAAGCACGGAAGGAGCTGGG + Intergenic
1089002425 11:115063118-115063140 CAATGAGAACACATGGACATAGG - Intergenic
1090690864 11:129179741-129179763 CAATGAGAACACATGGACATAGG + Intronic
1090752178 11:129756717-129756739 CAATGAGAACACATGGACATAGG + Intergenic
1091014835 11:132040588-132040610 GAAGGATCACAGGGGGACCTGGG - Intronic
1091035122 11:132225906-132225928 CAATGAGAACACATGGACATAGG - Intronic
1091269487 11:134296639-134296661 CAATGAGAACACATGGACATAGG + Intronic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1091975087 12:4817891-4817913 CAAGGAGCGCAGACAGACCCTGG + Intronic
1092440161 12:8494199-8494221 CAATGAGAACATATGGACATAGG - Intergenic
1092498923 12:9026454-9026476 CATGGAGCTGAGAAGGACCTAGG - Intergenic
1092646717 12:10582461-10582483 CAATGAGAATACATGGACCTAGG + Intergenic
1093184290 12:16002177-16002199 CAATGAGAACACATGGACATAGG - Intronic
1093217164 12:16377340-16377362 CAAGGAGAACACATGGACACAGG - Intronic
1093330692 12:17834395-17834417 CAATGAGAACACATGGACATAGG + Intergenic
1093350265 12:18091391-18091413 CAATGAGAACACATGGACATGGG - Intronic
1093514198 12:19966522-19966544 CAATGAGAACACATGGACATAGG - Intergenic
1093579902 12:20774887-20774909 CAATGAGAACACATGGACCCAGG + Intergenic
1094092237 12:26663039-26663061 CAGGGAACCCAGATGGATCTAGG - Intronic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1094453672 12:30608360-30608382 CAAGGAGAACACATGGACACAGG + Intergenic
1094739276 12:33270036-33270058 CAATGAGAACACATGGACATAGG - Intergenic
1094745301 12:33337660-33337682 CAATGAGAACACATGGACATAGG + Intergenic
1094767184 12:33610430-33610452 CAATGAGAACACATGGACATAGG - Intergenic
1094789789 12:33898902-33898924 CAATGAGAACAGATGGACACAGG + Intergenic
1094862375 12:34482242-34482264 CAATGAGAACACATGGACCCTGG + Intergenic
1095104302 12:38213119-38213141 CAATGAGAACAGATGGACACAGG + Intergenic
1095238041 12:39822113-39822135 CAATGAGAACACATGGACATAGG - Intronic
1095482818 12:42653225-42653247 CAAGGAGAACACATGGACACAGG - Intergenic
1095608356 12:44097662-44097684 CAACGAGAACACATGGACATAGG + Intronic
1095647339 12:44563110-44563132 CAATGAGCACACATGGACACAGG + Intronic
1095652897 12:44634366-44634388 CAATGAGCACACATGGACACAGG - Intronic
1095779333 12:46041869-46041891 CAATGAGAACACATGGACATAGG + Intergenic
1096598044 12:52709696-52709718 GCAGGAGCACAGAGGCACCTGGG - Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1097467975 12:59951528-59951550 CAAGGAGAACACATGGACATAGG + Intergenic
1097922972 12:65096812-65096834 CAATGAGAACACATGGACATAGG + Intronic
1097948272 12:65397802-65397824 CAATGAGAACACATGGACATAGG - Intronic
1098151321 12:67549908-67549930 CAAGGAGAACACATGGACAGAGG - Intergenic
1098374337 12:69797717-69797739 CAAGGAGAACACATGGACACAGG - Intronic
1098600535 12:72326346-72326368 CAATGAGAACAGATGGACACAGG + Intronic
1098660285 12:73085003-73085025 CAATGAGAACACATGGACATAGG + Intergenic
1098677295 12:73305858-73305880 CAATGAGAACACATGGACCCAGG + Intergenic
1098709259 12:73734541-73734563 CAATGAGAACATATGGACATAGG + Intergenic
1098782153 12:74700838-74700860 CAATGAGAACACATGGACATAGG + Intergenic
1098785565 12:74749683-74749705 CAATGAGAACACATGGACATAGG + Intergenic
1099239583 12:80123227-80123249 CAAGGAGAACACATGGACACAGG - Intergenic
1099435676 12:82642573-82642595 CAATGAGTACACATGGACATAGG + Intergenic
1099575989 12:84382310-84382332 CAATGAGAACACATGGACATGGG - Intergenic
1100226982 12:92568031-92568053 CAATGAGAACACATGGACATAGG + Intergenic
1100931707 12:99617585-99617607 CAATGAGAACACATGGACCTGGG + Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101305228 12:103521477-103521499 CAAGGAGAATACATGGACATAGG + Intergenic
1101406448 12:104433234-104433256 AAAGAAAGACAGATGGACCTGGG + Intergenic
1103168625 12:118793316-118793338 CAATGAGAACACATGGACATAGG - Intergenic
1103314956 12:120045716-120045738 CAATGAGAACACATGGACATAGG + Intronic
1104096336 12:125561318-125561340 CAATGAGAACACATGGACATAGG + Intronic
1104431387 12:128719089-128719111 CAATGAGAACACATGGACATAGG - Intergenic
1104433593 12:128737614-128737636 CAAGGAGTACAGGTGGCCTTTGG - Intergenic
1105244621 13:18637875-18637897 CAATGAGAACACATGGACATAGG + Intergenic
1105355303 13:19654275-19654297 CAAGGAGAACACATGGACCCAGG + Intronic
1105415367 13:20207241-20207263 CAATGAGAACACATGGACATAGG + Intergenic
1105644957 13:22307138-22307160 CAATGAGAACACATGGACATGGG - Intergenic
1106346003 13:28878528-28878550 CAAGGAGAACACATGGACACAGG - Intronic
1106430135 13:29673205-29673227 CAATGAGAACAGATGGACACAGG + Intergenic
1106629735 13:31458697-31458719 CAAGGAGAACACATGGACACAGG + Intergenic
1106649806 13:31678219-31678241 CAATGAGAACACATGGACATGGG + Intergenic
1107118362 13:36771381-36771403 CAATGAGAACACATGGACATAGG - Intergenic
1107155564 13:37163304-37163326 CAATGAGAACACATGGACATAGG + Intergenic
1107550931 13:41474548-41474570 CAATGAGAACACATGGACATAGG - Intergenic
1107603093 13:42033117-42033139 CAATGAGCACACATGGACACAGG + Intergenic
1107805443 13:44149548-44149570 CAATGAGAACACATGGACATAGG + Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1108700237 13:52937537-52937559 AAAAGAGCCCAGATGGACCTTGG + Intergenic
1108762540 13:53587168-53587190 CAATGAGAACACATGGACATAGG + Intergenic
1108811145 13:54224817-54224839 CAAGGAGAACACATGGACACAGG + Intergenic
1109253267 13:60046921-60046943 CAACGAGAACACATGGACATAGG + Intronic
1109427127 13:62179566-62179588 CAATGAGAACACATGGACATAGG + Intergenic
1109462082 13:62674129-62674151 CAATGAGAACACATGGACATGGG + Intergenic
1109804334 13:67418363-67418385 CAATGAGAACACATGGACCCAGG - Intergenic
1109871638 13:68341046-68341068 CAATGAGAACACATGGACCCAGG + Intergenic
1110119309 13:71864429-71864451 CAAGGAGACCAGAAGGACATTGG - Intronic
1110140026 13:72116994-72117016 CAATGAGAACACATGGACATAGG + Intergenic
1110390267 13:74965384-74965406 CAATGAGAACAGATGGACACAGG + Intergenic
1110899896 13:80809173-80809195 CAAGGAGAACACATGGACACAGG - Intergenic
1111066792 13:83104690-83104712 CAAGCAGCATAGATGAATCTGGG - Intergenic
1111168625 13:84496225-84496247 CAAGGAGAACACATGGACACAGG + Intergenic
1112305694 13:98271605-98271627 CAATGAGAACACATGGACCCAGG - Intronic
1112691856 13:101905499-101905521 CAATGAGAACACATGGACATGGG + Intronic
1112692251 13:101910040-101910062 CAAGGAGAACACATGGACACAGG + Intronic
1112785809 13:102950839-102950861 CAAGGAGAACACATGGACACAGG - Intergenic
1113110504 13:106818163-106818185 CAAGGAGAACAGGTGGACACAGG - Intergenic
1114396407 14:22366656-22366678 CAAGGAGAACACATGGACACAGG + Intergenic
1114560122 14:23583839-23583861 CAAGGAGAACACATGGACACAGG - Intergenic
1114753279 14:25229537-25229559 CAATGAGAACACATGGACGTAGG - Intergenic
1114930657 14:27463686-27463708 AAAGGAACACAGATGAACTTTGG + Intergenic
1114939586 14:27591687-27591709 CAATGAGAACACATGGACATGGG + Intergenic
1115042477 14:28948428-28948450 CAAGGAGAACACATGGACACAGG - Intergenic
1115062355 14:29208483-29208505 CAATGAGAACACATGGACATAGG - Intergenic
1115072021 14:29334949-29334971 CAAGGAGAACACATGGACACAGG + Intergenic
1115280942 14:31662514-31662536 CAATGAGAACAGATGGACACAGG - Intronic
1115345726 14:32341526-32341548 CAAAGAGCACACAGGGTCCTTGG + Intronic
1115908045 14:38223102-38223124 CAATGAGAACACATGGACATAGG - Intergenic
1116063525 14:39953990-39954012 CAATGAGAACAGATGGACACAGG + Intergenic
1116073903 14:40085774-40085796 CAATGAGAACACATGGACATAGG - Intergenic
1116209720 14:41919887-41919909 CAATGAGAACACATGGACATAGG - Intergenic
1116289662 14:43017332-43017354 CAATGAGAACAGATGGACACAGG + Intergenic
1116343522 14:43757202-43757224 CAAGGAGAACACATGGACACAGG + Intergenic
1116384583 14:44314853-44314875 CAATGAGAACAGATGGACACAGG + Intergenic
1116511300 14:45750181-45750203 CAATGAGAACAGATGGACACAGG - Intergenic
1116580944 14:46640707-46640729 CAATGAGAACAGATGGACACAGG + Intergenic
1116643646 14:47498146-47498168 GAAGGAGCAGAGATGAAACTAGG + Intronic
1116714705 14:48412561-48412583 CAATGAGAACACATGGACCCAGG - Intergenic
1116735550 14:48686204-48686226 CAATGAGAACACATGGACGTAGG - Intergenic
1116985943 14:51220519-51220541 CAATGAGAACACATGGACATGGG - Intergenic
1117655985 14:57957236-57957258 CAATGAGAACACATGGACATAGG + Intronic
1117756385 14:58978717-58978739 CAAGGAGAAAAGATATACCTTGG - Intergenic
1118450640 14:65898277-65898299 CAATGAGAACACATGGACATAGG + Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1118867492 14:69714814-69714836 CAAGGAGGAGAGATGTACGTGGG + Exonic
1118927618 14:70207090-70207112 CATGGAGCACTGATGAACCTGGG - Intergenic
1118939657 14:70321233-70321255 CAATGAGAACACATGGACATAGG - Intergenic
1119884343 14:78127939-78127961 CAAGGACCTCAGAGGGGCCTAGG + Intergenic
1120091833 14:80341324-80341346 CAATGAGAACACATGGACATGGG + Intronic
1120131344 14:80810982-80811004 CAAGGAGAACACATGGACATAGG - Intronic
1121808649 14:96857592-96857614 GAAGGAGCAAGGATGGGCCTAGG + Intronic
1122434101 14:101680941-101680963 CAATGAGAACACATGGACATAGG - Intergenic
1122739758 14:103865431-103865453 CAATGAGAACACATGGACCCAGG + Intergenic
1122841500 14:104466385-104466407 TAAGGAACACAGATGGATCTTGG - Intergenic
1123428696 15:20195121-20195143 CAATGAGAACACATGGACATAGG - Intergenic
1123502978 15:20908187-20908209 CAATGAGAACACATGGACCCAGG + Intergenic
1123560224 15:21481852-21481874 CAATGAGAACACATGGACCCAGG + Intergenic
1123596465 15:21919153-21919175 CAATGAGAACACATGGACCCAGG + Intergenic
1123952315 15:25292769-25292791 CAATGAGAACACATGGACCCAGG + Intergenic
1124125188 15:26932893-26932915 CAATGAGAACAGATGGACACAGG + Intronic
1124717693 15:32081081-32081103 CAATGAGAACACATGGACATGGG + Intronic
1125207842 15:37175243-37175265 CAATGAGAACACATGGACATAGG + Intergenic
1125261592 15:37831864-37831886 CAATGAGAACACATGGACATAGG - Intergenic
1125289097 15:38125957-38125979 CAATGAGAACACATGGACCCAGG + Intergenic
1125290087 15:38136863-38136885 CAACGAGCACACATGGACACGGG - Intergenic
1125443737 15:39731002-39731024 CAAGTAACAAAGATGGACTTTGG - Intronic
1125470023 15:39993420-39993442 CAAAGAGAACAGATTGACCAGGG + Intronic
1125490082 15:40140778-40140800 CAATGAGAACACATGGACATAGG + Intergenic
1126242234 15:46458518-46458540 CAAGGAGAACACATGGACACAGG + Intergenic
1126243597 15:46475181-46475203 CAAGGAGAACACATGGACACAGG + Intergenic
1126259903 15:46677079-46677101 CAAGAAGAAAAGATGGACCAGGG + Intergenic
1126523930 15:49629030-49629052 CAAGGAGAACACATGGACACAGG - Intronic
1126559937 15:50032228-50032250 CAATGAGAACACATGGACATAGG - Intronic
1126855806 15:52838307-52838329 CAATGAGAACAGATGGACACAGG - Intergenic
1127030594 15:54857365-54857387 CAATGAGAACACATGGACATGGG + Intergenic
1127571152 15:60243098-60243120 CAATGAGAACACATGGACATAGG + Intergenic
1128857900 15:71035540-71035562 CAATGAGAACACATGGACATAGG - Intronic
1129127319 15:73453916-73453938 CAATGAGAACACATGGACATGGG + Intronic
1129147163 15:73658903-73658925 CAAGGAGCAGAAGTGGAACTTGG - Intergenic
1129507404 15:76093332-76093354 CAATGAGAACACATGGACATAGG - Intronic
1129525594 15:76211896-76211918 CAAGGAACACCGATGGAATTAGG - Intronic
1129854952 15:78816970-78816992 GAAGGAGCACTGAGGGACCAGGG - Intronic
1130187994 15:81703353-81703375 CAATGAGAACACATGGACCCAGG + Intergenic
1130316758 15:82802875-82802897 CCAGGGTCACAGAAGGACCTAGG - Intronic
1130665191 15:85863569-85863591 CAATGAGAACACATGGACATAGG + Intergenic
1130820035 15:87485381-87485403 CAAGGAGAACACATGGACACAGG - Intergenic
1130932658 15:88440798-88440820 CAATGAGAACAGATGGACATAGG - Intergenic
1131591726 15:93756580-93756602 CAATGAGAACACATGGACATAGG + Intergenic
1131715229 15:95102607-95102629 CGATGAGAACACATGGACCTAGG + Intergenic
1132373579 15:101313795-101313817 CAGGGAGCAGAGGTGGGCCTAGG - Intronic
1132421885 15:101677003-101677025 CAATGAGAACAGATGGACACAGG - Intronic
1202949820 15_KI270727v1_random:23608-23630 CAATGAGAACACATGGACCCAGG + Intergenic
1202968573 15_KI270727v1_random:209016-209038 CAATGAGAACACATGGACCCAGG + Intergenic
1132694508 16:1195872-1195894 CAAGGAGCCCAGGTGGTCCAGGG - Intronic
1133358917 16:5158084-5158106 GAAGGAGCAGAGAGGGACATGGG - Intergenic
1133588082 16:7215102-7215124 CAATGAGAACACATGGACGTAGG - Intronic
1133959100 16:10476700-10476722 CAATGAGAACACATGGACATAGG - Intronic
1134174525 16:11995023-11995045 CAAGGAGCACAGGTGGTCTCAGG - Intronic
1134300632 16:12987541-12987563 CAATGAGAACACATGGACATGGG + Intronic
1135870284 16:26143557-26143579 CAAGGAGAACACATGGACACAGG + Intergenic
1136344645 16:29666834-29666856 CCAGGAGCACACATGGGCCAGGG + Exonic
1136855625 16:33654629-33654651 CAATGAGAACACATGGACATAGG + Intergenic
1137334444 16:47533835-47533857 CCAAGAGCACAGAGAGACCTGGG + Intronic
1137528880 16:49263558-49263580 CAATGAGAACACATGGACATAGG - Intergenic
1137954330 16:52813873-52813895 CAATGAGAACACATGGACTTAGG + Intergenic
1138491964 16:57382271-57382293 CAGGAAGCACAGAGGGCCCTGGG + Exonic
1138810919 16:60149490-60149512 CAATGAGAACACATGGACATAGG + Intergenic
1138830923 16:60373787-60373809 CAATGAGAACACATGGACATAGG - Intergenic
1138916875 16:61475243-61475265 CAATGAGAACACATGGACATAGG + Intergenic
1138920734 16:61525506-61525528 CAAGGAGAACACATGGACACAGG - Intergenic
1139219359 16:65164321-65164343 AAAGGAGCACAGAAGGAATTTGG - Intergenic
1140618361 16:76695139-76695161 CAATGAGAACACATGGACATGGG + Intergenic
1140693413 16:77507480-77507502 CAATGAGAACACATGGACATAGG + Intergenic
1141291621 16:82723098-82723120 AATGGAGAACAGGTGGACCTGGG + Intronic
1141910961 16:87058035-87058057 CAGGGAGCACCGGTGGCCCTGGG - Intergenic
1142205216 16:88779718-88779740 CCAGGAGCACAGAGGCTCCTTGG - Intronic
1203117211 16_KI270728v1_random:1503110-1503132 CAATGAGAACACATGGACATAGG + Intergenic
1143825340 17:9601209-9601231 CAATGAGAACACATGGACCCGGG + Intronic
1143880321 17:10024887-10024909 CGATGGGTACAGATGGACCTGGG - Intronic
1144077392 17:11731593-11731615 CAAAGAGAACACATGGACATAGG - Intronic
1144130469 17:12241900-12241922 CAATGAGAACACATGGACATAGG - Intergenic
1144150891 17:12444626-12444648 CAATGAGAACACATGGACATAGG + Intergenic
1146971111 17:37073193-37073215 CAATGAGAACACATGGACCCAGG + Intergenic
1147501466 17:40968120-40968142 CAATGAGCACACATGGACACAGG - Intergenic
1147525934 17:41223157-41223179 CAATGAGCACACATGGACACAGG + Intronic
1149031271 17:52085299-52085321 CAGGGAGCATGGATGGACATAGG - Intronic
1149128671 17:53268431-53268453 CAAGGAGAACACATGGACATGGG + Intergenic
1149228358 17:54502040-54502062 CAATGAGAACACATGGACATAGG - Intergenic
1149327138 17:55543509-55543531 CAATGAGAACACATGGACATAGG - Intergenic
1149728888 17:58924771-58924793 CAAGGAGAACACATGGACACAGG - Intronic
1150626536 17:66845239-66845261 CAATGAGAACACATGGACGTAGG + Intronic
1150845737 17:68656169-68656191 CAATGAGAACACATGGACATAGG + Intergenic
1150856476 17:68758159-68758181 CAATGAGAACAGATGGACACAGG + Intergenic
1151028812 17:70711165-70711187 CAATGAGAACACATGGACATAGG - Intergenic
1151095895 17:71497818-71497840 CAGGGCTCACAGATGGACCCTGG + Intergenic
1151256112 17:72878013-72878035 CAATGAGAACACATGGACCCAGG - Intronic
1151437380 17:74106310-74106332 CAATGAGAACACATGGACATGGG + Intergenic
1151551280 17:74823858-74823880 CAAGGTGCACAGTTGGATCGAGG + Intronic
1153077826 18:1185649-1185671 CAATGAGAACAGATGGACACAGG + Intergenic
1153112531 18:1609202-1609224 CAATGAGAACACATGGACATAGG - Intergenic
1153209152 18:2740127-2740149 CAATGAGAACACATGGACCCAGG - Intronic
1153474850 18:5488361-5488383 CAATGAGAACACATGGACGTAGG + Intronic
1154061302 18:11063228-11063250 CAATGAGAACACATGGACATAGG + Intronic
1154079550 18:11242892-11242914 TAAGGAGCACAGAGGGAAATCGG + Intergenic
1154373327 18:13786247-13786269 CAATGAGAACACATGGACATAGG - Intergenic
1154478194 18:14788588-14788610 CAATGAGAACACATGGACATGGG - Intronic
1155175234 18:23296040-23296062 CAATGAGAACACATGGACATAGG + Exonic
1155848304 18:30736896-30736918 CAATGAGAACACATGGACATAGG + Intergenic
1155888628 18:31238968-31238990 CAATGAGAACACATGGACATAGG - Intergenic
1156166206 18:34424155-34424177 CAAGGAGAACAAATGGACACAGG - Intergenic
1156700386 18:39818083-39818105 CAATGAGAACAGATGGACACAGG + Intergenic
1156724748 18:40114276-40114298 CAATGAGAACACATGGACATAGG - Intergenic
1156728284 18:40157461-40157483 CAATGAGAACACATGGACCCAGG - Intergenic
1157072953 18:44431074-44431096 CAATGAGAACACATGGACCCTGG - Intergenic
1157184892 18:45530893-45530915 CAATGAGAACACATGGACATAGG - Intronic
1157414679 18:47492031-47492053 CAATGAGAACACATGGACATAGG - Intergenic
1158086608 18:53658507-53658529 CAATGAGAACACATGGACATAGG - Intergenic
1158099168 18:53810134-53810156 CAATGAGAACACATGGACCCAGG + Intergenic
1158119822 18:54036658-54036680 CAATGAGAACACATGGACATAGG - Intergenic
1158174031 18:54633854-54633876 CAATGAGAACACATGGACCCAGG + Intergenic
1159175020 18:64821265-64821287 CAATGAGAACACATGGACCCAGG - Intergenic
1159226586 18:65545428-65545450 CAATGAGAACACATGGACCAGGG + Intergenic
1159291834 18:66433594-66433616 CAAGGAGAACACATGGACACAGG + Intergenic
1159364181 18:67444928-67444950 CAATGAGAACACATGGACATGGG - Intergenic
1159737868 18:72124818-72124840 CAAGGAGAACACATGGACACAGG + Intergenic
1160423392 18:78764699-78764721 CACGGAGCACAGACGGCCTTGGG + Intergenic
1160423405 18:78764742-78764764 CACGGAGCACAGACGGCCTTGGG + Intergenic
1160579460 18:79875328-79875350 CACGGAGCACAGGCGGCCCTGGG + Intronic
1160929504 19:1563546-1563568 CACGGAGCACAGATTCACCCAGG + Intronic
1161234145 19:3189759-3189781 CCAGGAGAACAGATGGCCTTGGG - Intronic
1163941263 19:20496393-20496415 CAATGAGGACACATGGACATAGG + Intergenic
1163975423 19:20846936-20846958 CAATGAGAACACATGGACATAGG + Intronic
1164376950 19:27695633-27695655 CAATGAGAACAGATGGACACAGG - Intergenic
1164390923 19:27820521-27820543 CAATGAGAACACATGGACATAGG + Intergenic
1164495041 19:28753025-28753047 CAATGAGAACACATGGACATAGG + Intergenic
1164653949 19:29906991-29907013 CAATGAGAACACATGGACATAGG + Intergenic
1164682393 19:30144663-30144685 CAAGCAGCACAGTTGAACTTGGG - Intergenic
1164933400 19:32192565-32192587 CAATGAGAACACATGGACCCAGG - Intergenic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
926092798 2:10061450-10061472 CAAGCAGCACTTCTGGACCTGGG + Intronic
926366122 2:12134294-12134316 CAATGAGAACACATGGACATGGG - Intergenic
926431693 2:12793652-12793674 CAAGGAGAACACATGGACACAGG + Intergenic
926440023 2:12878578-12878600 CAATGAGAACACATGGACCCAGG - Intergenic
926943439 2:18162414-18162436 CAATGAGAACACATGGACATGGG - Intronic
926982410 2:18585542-18585564 CAAGGAGCTCTGAAGGCCCTGGG - Intronic
927131165 2:20061937-20061959 CAAGGGGCACAGAGGGACAGAGG + Intergenic
927567913 2:24130006-24130028 CAATGAGAACACATGGACCCAGG - Intronic
927915639 2:26934366-26934388 CAAGGAGGACAGAGGGACATGGG - Intronic
928177278 2:29043276-29043298 CAAACAGCAGAGATGTACCTGGG + Intronic
928327327 2:30329803-30329825 CAAGGAGAACACATGGACACAGG - Intergenic
928480514 2:31678287-31678309 CAACGAGAACAGATGGACACAGG - Intergenic
929064211 2:37956849-37956871 CAATGAGAACACATGGACATAGG - Intronic
929539355 2:42808489-42808511 CAAGCAGCAGAGTTGGCCCTCGG - Intergenic
929545947 2:42855343-42855365 CAACTGGCCCAGATGGACCTGGG + Intergenic
930107638 2:47652641-47652663 CATGGAGCAGAGCTGGAGCTAGG - Intergenic
930222762 2:48761774-48761796 CAATGAGAACACATGGACATAGG - Intronic
930323858 2:49888126-49888148 CAACGAGAACACATGGACATAGG + Intergenic
930977462 2:57480750-57480772 CAAGGAGAACACATGGACACTGG - Intergenic
931086328 2:58834768-58834790 GAAGGAGCACAGAAGGAAGTGGG - Intergenic
931146753 2:59527753-59527775 AAAGGAGCACAGATGGAATGAGG - Intergenic
931930913 2:67132273-67132295 CAATGAGAACACATGGACCCAGG - Intergenic
932874554 2:75436948-75436970 CAAGGAGAACACATGGACACAGG + Intergenic
933557447 2:83848649-83848671 CAATGAGAACACATGGACATAGG - Intergenic
934617601 2:95784404-95784426 CAATGAGAACACATGGACCCAGG + Intergenic
934643292 2:96040155-96040177 CAATGAGAACACATGGACCCAGG - Intergenic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
935601479 2:104926893-104926915 CAATGAGAACACATGGACATAGG + Intergenic
935607799 2:104987980-104988002 CAATGAGAACAGATGGACATAGG + Intergenic
936181811 2:110273713-110273735 CAATGAGAACACACGGACCTAGG - Intergenic
936230756 2:110697966-110697988 CAATGAGAACACACGGACCTAGG + Intergenic
936368897 2:111886023-111886045 CAATGAGAACACATGGACCCAGG + Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936593635 2:113827196-113827218 CAATGAGAACACATGGACATAGG + Intergenic
936667516 2:114613915-114613937 CAATGAGAACACATGGACCCAGG + Intronic
936777985 2:115996828-115996850 CAAGGAGAACACATGGACACAGG - Intergenic
936808274 2:116363775-116363797 CAAGGAGAACACATGGACACAGG + Intergenic
936889318 2:117350617-117350639 CACGGAGCACAGCTAGACTTTGG - Intergenic
937464457 2:122119133-122119155 CAATGAGAACACATGGACATGGG - Intergenic
937585801 2:123548045-123548067 CAATGAGAACACATGGACATAGG - Intergenic
938627711 2:133129289-133129311 CAATGAGCACACATGGACACAGG - Intronic
940401345 2:153251664-153251686 CAATGAGAACACATGGACCCAGG - Intergenic
940475999 2:154163176-154163198 CAATGAGAACACATGGACCCAGG - Intronic
940486824 2:154306344-154306366 CAATGAGAACACATGGACATAGG - Intronic
940560780 2:155293085-155293107 CAATGAGAACACATGGACATAGG + Intergenic
940615491 2:156044076-156044098 CAATGAGAACACATGGACATGGG - Intergenic
940977539 2:159962830-159962852 CAATGAGAACACATGGACATAGG + Intronic
941067027 2:160914770-160914792 CAAGGAGAACACATGGACACAGG - Intergenic
941287221 2:163629501-163629523 TAAGGAGCAAAGATGGAGCGGGG + Intronic
941418396 2:165251145-165251167 CAAGTAGCAAAGATGGACTCAGG + Intronic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
941763500 2:169270553-169270575 CAATGAGCACACATGGACACAGG + Intronic
942202688 2:173587626-173587648 CAATGAGAACACATGGACATAGG - Intergenic
942642978 2:178079335-178079357 CAATGAGAACACATGGACATGGG - Intronic
942709641 2:178818472-178818494 CAATGAGAACAGATGGACACAGG - Intronic
942733803 2:179087579-179087601 CAAGGAGAACACATGGACACAGG - Intergenic
942766492 2:179463547-179463569 CAATGAGAACACATGGACATGGG - Intronic
942915436 2:181300356-181300378 CAATGAGAACAGATGGACACAGG + Intergenic
943262369 2:185682568-185682590 CAAGGAGAACACATGGACACAGG - Intergenic
943914652 2:193614555-193614577 CAATGAGAACACATGGACATAGG - Intergenic
943939887 2:193979165-193979187 CAAGGAGAACACATGGACATGGG + Intergenic
943962250 2:194280649-194280671 CAAGGAGAACACATGGACACAGG - Intergenic
943980592 2:194544783-194544805 CAATGAGAACACATGGACATAGG + Intergenic
944094148 2:195947487-195947509 CAATGAGCACACATGGACACAGG - Intronic
944268425 2:197754083-197754105 CAATGAGAACACATGGACATAGG + Intronic
944355617 2:198784173-198784195 CAATGAGAACACATGGACATGGG - Intergenic
945355754 2:208837506-208837528 CAATGAGAACAGATGGACACAGG + Intronic
945532956 2:210978975-210978997 CAAGGAGAACACATGGACACAGG - Intergenic
945760564 2:213908968-213908990 CAATGAGAACACATGGACATAGG - Intronic
945971442 2:216235337-216235359 TCAGCAGCACAGGTGGACCTGGG + Intergenic
946180147 2:217944029-217944051 CAAGGAGCAGAGCTGGTCCCAGG + Exonic
946199967 2:218065671-218065693 CAAGGAGCAGAGCTGGCCCCAGG + Intronic
946300796 2:218822909-218822931 CATGGAGCACAGATGGCCCTGGG + Exonic
947024493 2:225721533-225721555 CAATGAGAACACATGGACATAGG - Intergenic
947043752 2:225953487-225953509 CAATGAGAACACATGGACCCAGG + Intergenic
947143043 2:227037279-227037301 CAATGAGAACACATGGACATAGG - Intronic
947365206 2:229387273-229387295 CAATGAGAACACATGGACATAGG + Intronic
947471786 2:230407790-230407812 CAACGAGAACACATGGACATAGG + Intergenic
948195060 2:236089388-236089410 CAAGGACCTCAGCTTGACCTGGG - Intronic
948245216 2:236476945-236476967 CAAGGAGAACACATGGACACAGG - Intronic
1169289725 20:4338717-4338739 CAATGAGAACACATGGACCCAGG - Intergenic
1169803648 20:9536848-9536870 CAATGAGAACACATGGACATAGG + Intergenic
1169828317 20:9794124-9794146 CAATGAGAACACATGGACATAGG + Intronic
1170842814 20:19938020-19938042 AAAGGAGGGCAGATGGACCATGG - Intronic
1170979043 20:21193802-21193824 CAATGAGAACACATGGACCCAGG + Intronic
1171309391 20:24134444-24134466 CAAGGGGTGCAGATGGAGCTTGG + Intergenic
1173277675 20:41598648-41598670 CCTGGAGGACAGATGGCCCTTGG - Intronic
1173367998 20:42405386-42405408 CAATGAGAACAGGTGGACCCAGG - Intronic
1173491268 20:43484328-43484350 CAAGAGGCAAAGATGGACCAGGG + Intergenic
1173556284 20:43968341-43968363 AAGGTGGCACAGATGGACCTGGG + Intronic
1174552891 20:51374379-51374401 CAAGGAAAACAGATGGCCCCAGG - Intergenic
1174853632 20:54021677-54021699 CAATGAGAACAGATGGACACAGG + Intronic
1174922968 20:54724472-54724494 CAATGAGAACACATGGACATGGG - Intergenic
1174999090 20:55606622-55606644 CAATGAGAACACATGGACATAGG - Intergenic
1175046352 20:56109518-56109540 CAATGAGAACACATGGACATAGG + Intergenic
1175334260 20:58184900-58184922 CAAGGAGTACAGGTGGCCTTTGG + Intergenic
1175402353 20:58707750-58707772 CATGGAGCCCAGATGTCCCTGGG + Intronic
1175521146 20:59603712-59603734 CAAGGACCACAGAGACACCTGGG - Intronic
1176099955 20:63360426-63360448 CCTGGAGCACAGATGGACCTAGG - Intronic
1176151290 20:63592430-63592452 CCAGCAGCACAGAAGGGCCTAGG + Intronic
1176451670 21:6867846-6867868 CAATGAGAACACATGGACATAGG + Intergenic
1177281664 21:18989063-18989085 CAATGAGAACACATGGACATAGG - Intergenic
1177304684 21:19298086-19298108 CAATGAGAACACATGGACCCAGG + Intergenic
1177503036 21:21983692-21983714 CAATGAGAACACATGGACATAGG + Intergenic
1177731621 21:25034439-25034461 CAATGAGAACAGATGGACACAGG - Intergenic
1177851978 21:26359606-26359628 CAAAGAGAACACATGGACCCAGG + Intergenic
1178184189 21:30200683-30200705 CAATGAGAACAGATGGACACAGG - Intergenic
1178372646 21:32038869-32038891 CAATGAGAACACATGGACATGGG - Intronic
1178714568 21:34952173-34952195 CAAGGAGAACACATGGACATAGG + Intronic
1178752157 21:35315356-35315378 CAATGAGAACACATGGACATAGG + Intronic
1179371105 21:40806907-40806929 CAATGAGAACACATGGACATGGG + Intronic
1179569936 21:42272823-42272845 GAAGGAGCAGAGAGGGGCCTGGG - Intronic
1180785030 22:18542408-18542430 CAAGGAGCACACATCCCCCTTGG - Intergenic
1180909745 22:19441070-19441092 AAAGGAGTACAGATGTAACTGGG - Intronic
1180967285 22:19797270-19797292 CCAGGGCCACAGACGGACCTGGG - Intronic
1181128613 22:20716441-20716463 CAAGGAGCACACATCCCCCTTGG - Intronic
1181241933 22:21481762-21481784 CAAGGAGCACACATCCCCCTTGG - Intergenic
1181326331 22:22051157-22051179 CAAGGAGAACACATGGACACAGG - Intergenic
1181786931 22:25234019-25234041 CAATGAGAACACATGGACATAGG + Intergenic
1182269318 22:29143760-29143782 CAGAGAGCACGGATGGCCCTTGG - Intronic
1182820145 22:33208765-33208787 CAAGGAGAACACATGGACACAGG - Intronic
1183186420 22:36294006-36294028 CAGAGAGCACACATGCACCTGGG + Intronic
1183534140 22:38386045-38386067 CAATGAGAACACATGGACCCAGG + Intronic
1184319373 22:43728107-43728129 CAATGAGAACACATGGACATAGG - Intronic
1184590308 22:45477581-45477603 CAAGGAGCAGGGAGGGCCCTTGG - Intergenic
1184829205 22:46973200-46973222 CAGGGAGCACTTAGGGACCTGGG + Intronic
949453858 3:4217311-4217333 CAATGAGAACACATGGACATAGG + Intronic
949612782 3:5719968-5719990 CAATGAGAACACATGGACATAGG + Intergenic
950561439 3:13730592-13730614 CAATGAGAACACATGGACATAGG - Intergenic
950701526 3:14753285-14753307 CAATGAGAACACATGGACATAGG + Intronic
950739696 3:15040482-15040504 CATGGAACACAGATGCCCCTGGG + Intronic
950871206 3:16231090-16231112 CAATGAGAACACATGGACATAGG + Intronic
951172419 3:19557200-19557222 CAATGAGAACACATGGACATGGG - Intergenic
951774488 3:26294442-26294464 CAATGAGAACACATGGACATGGG - Intergenic
952182307 3:30930726-30930748 CAAGGAGAACACATGGACACAGG + Intergenic
952677290 3:36048508-36048530 CAAGAAGAACACATGGACATAGG - Intergenic
952717943 3:36500392-36500414 CAATGAGAACACATGGACCCAGG + Intronic
953304359 3:41813101-41813123 CAATGAGAACACATGGACCCAGG + Intronic
953460002 3:43074366-43074388 CAAGAACCACAAATGGAGCTGGG - Intergenic
953935430 3:47037697-47037719 CATGAAGCTGAGATGGACCTGGG - Exonic
954103691 3:48397847-48397869 TAAGAAGCAAAGAAGGACCTGGG + Intronic
954143216 3:48621084-48621106 CAAGGGGCAGTGATGGAGCTGGG + Intronic
954484209 3:50831422-50831444 CAATGAGAACACATGGACATAGG - Intronic
955891099 3:63651120-63651142 CAATGAGAACACATGGACATAGG + Intergenic
955902399 3:63771077-63771099 CAATGAGGACACATGGACATAGG - Intergenic
956047720 3:65214150-65214172 CAATGAGAACACATGGACATAGG - Intergenic
956156787 3:66306700-66306722 CAATGAGAACACATGGACCCAGG - Intronic
956220739 3:66900076-66900098 CAATGAGAACACATGGACATGGG + Intergenic
957357606 3:79112704-79112726 CAATGAGAACACATGGACATAGG + Intronic
957475395 3:80715686-80715708 CAAGGAGAACACATGGACACAGG + Intergenic
957688612 3:83538018-83538040 CAAGGAGAACACATGGACACAGG + Intergenic
957745307 3:84333313-84333335 CAATGAGAACACATGGACCCAGG - Intergenic
957851442 3:85812743-85812765 CAAGGAGAACACATGGACACAGG - Intronic
958031763 3:88119332-88119354 CAATGAGAACACATGGACATAGG + Intronic
958066954 3:88555912-88555934 CAATGAGAACACATGGACCCAGG - Intergenic
958067407 3:88561092-88561114 CAATGAGAACACATGGACCCAGG + Intergenic
958455605 3:94327212-94327234 CAATGAGAACACATGGACATAGG - Intergenic
958512734 3:95069294-95069316 CAATGAGAACACATGGACATAGG + Intergenic
958607028 3:96372241-96372263 CAATGAGAACACATGGACATAGG - Intergenic
958621569 3:96569499-96569521 CAATGAGAACACATGGACATAGG - Intergenic
958854081 3:99363341-99363363 CAAGGAGAACACATGGACACAGG + Intergenic
958916057 3:100051550-100051572 CAATGAGAACACATGGACATAGG - Intronic
958952661 3:100433262-100433284 CAATGAGAACACATGGACATAGG - Intronic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959345805 3:105192997-105193019 CAATGAGAACACATGGACATAGG + Intergenic
959349207 3:105239338-105239360 CAATGAGAACACATGGACATGGG - Intergenic
959618920 3:108379262-108379284 CAAGGAGAACACATGGACACAGG + Intergenic
959744903 3:109765072-109765094 CAAGGAGAACACATGGACACAGG + Intergenic
959829692 3:110845643-110845665 CAACGAGAACAGATGGACACAGG + Intergenic
959843408 3:111004536-111004558 CAATGAGAACACATGGACCCTGG + Intergenic
959880669 3:111441332-111441354 CAATGAGAACACATGGACATAGG - Intronic
959919803 3:111858250-111858272 CAATGAGAACATATGGACCCAGG + Intronic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960230088 3:115215896-115215918 CAATGAGAACACATGGACCCAGG - Intergenic
960357591 3:116672831-116672853 CAATGAGAACACATGGACGTAGG + Intronic
960392866 3:117100505-117100527 CAATGAGAACACATGGACCCAGG - Intronic
960401953 3:117210888-117210910 CAAGGAGAACACATGGACACAGG + Intergenic
960749606 3:120932994-120933016 CAATGAGAACACATGGACATAGG + Intronic
960771531 3:121197698-121197720 CAATGAGAACACATGGACCCAGG - Intronic
960782961 3:121340525-121340547 CAATGAGAACATATGGACATGGG - Intronic
960920190 3:122738810-122738832 CAATGAGAACACATGGACATAGG + Intergenic
961583951 3:127906956-127906978 CAATGAGCACACATGGACACAGG + Intergenic
961782484 3:129328786-129328808 CAAGCAGCACAGTCAGACCTGGG + Intergenic
961997627 3:131262857-131262879 CAATGAGAACACATGGACTTAGG - Intronic
962466890 3:135668827-135668849 CAATGAGAACACATGGACCCAGG - Intergenic
962576175 3:136756971-136756993 TAGGGAGAACAAATGGACCTTGG - Intergenic
962689863 3:137884183-137884205 CAAGGAGAACACATGGACACAGG - Intergenic
962710999 3:138086054-138086076 CAATGAGAACACATGGACCCAGG + Intronic
962969849 3:140389332-140389354 CAATGAGAACACATGGACATGGG - Intronic
963376900 3:144478970-144478992 CAAGGAGAACACATGGACACAGG + Intergenic
963681497 3:148383524-148383546 CAATGAGAACACATGGACATAGG - Intergenic
964031848 3:152147434-152147456 CAATGAGCACACATGGACACAGG + Intergenic
964266064 3:154896862-154896884 CAATGAGAACATATGGACATAGG + Intergenic
964709169 3:159653534-159653556 CAATGAGAACACATGGACCCAGG + Intronic
964841795 3:161002031-161002053 CAATGAGAACACATGGACATAGG - Intronic
965043286 3:163539002-163539024 CAACGAGGACAGATTGAGCTGGG - Intergenic
965091516 3:164169232-164169254 CAATGAGAACACATGGACATTGG - Intergenic
965098120 3:164260322-164260344 CAAGGAGAACACATGGACACAGG + Intergenic
965269182 3:166590277-166590299 CAATGAGAACACATGGACATAGG + Intergenic
965277283 3:166701672-166701694 CAATGAGAACACATGGACATGGG - Intergenic
965489511 3:169319371-169319393 CAATGAGAACACATGGACATGGG + Intronic
966573975 3:181478376-181478398 CAATGAGAACACATGGACCCAGG - Intergenic
966679029 3:182620528-182620550 GAAGGAGCCCAGATGGCCCCAGG - Intergenic
966898579 3:184464242-184464264 TAGGAAGAACAGATGGACCTAGG - Intronic
967316400 3:188154798-188154820 CAAGGAACTCAGTTGAACCTGGG + Intronic
967507619 3:190270805-190270827 CAAGGAGAACACATGGACACAGG - Intergenic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
969068506 4:4510950-4510972 CAAGGAGAACACATGGACACAGG + Intronic
969872869 4:10115917-10115939 GAAGGAGCAGACAAGGACCTGGG + Intronic
969904435 4:10381045-10381067 CCAGAAGCACAGATGGACAAGGG - Intergenic
970085383 4:12340391-12340413 CAATGAGAACACATGGACATAGG + Intergenic
970302816 4:14699691-14699713 CAATGAGAACACATGGACATAGG + Intergenic
970875735 4:20867827-20867849 CAATGAGAACACATGGACATAGG + Intronic
971435806 4:26622041-26622063 CAATGAGAACAGATGGACACAGG + Intronic
971651624 4:29283041-29283063 CAAGGAGAACACATGGACACAGG + Intergenic
971966072 4:33557685-33557707 CAATGAGAACACATGGACCCAGG - Intergenic
973097591 4:46222406-46222428 CAAGGAGAACACATGGACACAGG - Intergenic
973629623 4:52807945-52807967 CAATGAGAACACATGGACATAGG + Intergenic
973838023 4:54830705-54830727 CAATGAGAACACATGGACATAGG + Intergenic
973870823 4:55164469-55164491 CAATGAGAACACATGGACCCTGG - Intergenic
974034162 4:56802695-56802717 CAAGGAGAACACATGGACACAGG - Intergenic
974094092 4:57343646-57343668 CAATGAGAATACATGGACCTAGG + Intergenic
974105739 4:57467599-57467621 CAAGGAGAACACATGGACACAGG - Intergenic
974280463 4:59785239-59785261 CAAGGAGAACACATGGACACAGG + Intergenic
974342979 4:60638156-60638178 AAAGGAGGACAGATGGCCATGGG + Intergenic
974481394 4:62448314-62448336 CAATGAGAACACATGGACCCAGG + Intergenic
974759284 4:66254466-66254488 CAATGAGAACAGATGGACACAGG - Intergenic
975306618 4:72856710-72856732 CAAGGAGAACAAATGGACTCAGG + Intergenic
975384818 4:73744798-73744820 CAAGGAGAACACATGGACACAGG - Intergenic
975392314 4:73834383-73834405 CAAGGAGAACACATGGACACAGG - Intergenic
975536436 4:75456072-75456094 CAAGGAGAACACATGGACACAGG - Intergenic
975803600 4:78089226-78089248 CAATGAGAACACATGGACATAGG + Intronic
975805983 4:78113021-78113043 CAATGAGAACACATGGACATAGG - Intronic
975842803 4:78493602-78493624 CAATGAGAACACATGGACCCAGG + Intronic
976049484 4:80994669-80994691 CAATGAGAACAGATGGACACAGG - Intergenic
976058790 4:81101513-81101535 CAATGAGAACACATGGACCCAGG + Intronic
976093903 4:81487306-81487328 CAATGAGAACACATGGACCCAGG - Intronic
976330277 4:83823592-83823614 CAATGAGAACACATGGACCCAGG - Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
976664404 4:87574684-87574706 CAAGGAGAACACATGGACACAGG + Intergenic
976819271 4:89186568-89186590 CAATGAGAACACATGGACATAGG - Intergenic
976830604 4:89309481-89309503 CAATGAGAACACATGGACATAGG + Intergenic
976995418 4:91426082-91426104 CAATGAGAACACATGGACATAGG - Intronic
977455491 4:97254798-97254820 CAATGAGAACACATGGACATAGG - Intronic
978068286 4:104433499-104433521 CAAGGAGAACACATGGACACAGG - Intergenic
978091466 4:104721993-104722015 CAATGAGAACACATGGACATAGG + Intergenic
978185483 4:105852308-105852330 CAATGAGAACACATGGACATGGG - Intronic
978236367 4:106465759-106465781 CAATGAGGACACATGGACATAGG - Intergenic
978770610 4:112452571-112452593 GAAGGAGCAAACTTGGACCTAGG + Intergenic
979037927 4:115748886-115748908 CAATGAGAACACATGGACATAGG - Intergenic
979458263 4:120950997-120951019 CAATGAGAACAGATGGACACAGG + Intergenic
979592730 4:122498851-122498873 CAATGAGAACACATGGACATAGG + Intergenic
979742893 4:124173591-124173613 CAATGAGAACACATGGACATAGG + Intergenic
979777059 4:124603198-124603220 CAAGGAGAACACATGGACACAGG + Intergenic
980415778 4:132485904-132485926 CAATGAGAACACATGGACATAGG + Intergenic
980524831 4:133976150-133976172 CAATGAGAACATATGGACCCAGG - Intergenic
980549927 4:134321476-134321498 CAATGAGAACACATGGACATAGG + Intergenic
981002612 4:139842168-139842190 CACGGAGTACAGATCAACCTGGG + Intronic
981132101 4:141168741-141168763 CAAGGAGAACACATGGACACAGG + Intronic
981325783 4:143445987-143446009 CAATGAGAACAGATGGACACAGG - Intronic
982507125 4:156233374-156233396 CAATGAGAACACATGGACATAGG - Intergenic
982859312 4:160428928-160428950 CAATGAGAACACATGGACATAGG - Intergenic
982961000 4:161836251-161836273 CAATGAGAACAGATGGACACAGG + Intronic
983166765 4:164487331-164487353 CAATGAGAACAGATGGACATAGG + Intergenic
983746626 4:171208536-171208558 CAATGAGAACAGATGGACTCAGG - Intergenic
983965458 4:173804139-173804161 CAATGAGAACACATGGACCCAGG - Intergenic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
985706405 5:1403692-1403714 TACGGAGCTCAGATGGCCCTAGG - Intronic
986485882 5:8236400-8236422 CAATGAGAACAGATGGACACAGG - Intergenic
986585392 5:9311540-9311562 CAAGGAGAACACATGGACACAGG + Intronic
986771811 5:10980845-10980867 CAATGAGAACACATGGACATAGG + Intronic
987423693 5:17749794-17749816 CAATGAGAACAGATGGACACAGG - Intergenic
987521617 5:18993080-18993102 CAATGAGAACACATGGACATAGG - Intergenic
987625295 5:20390931-20390953 CAATGAGAACACATGGACCCAGG + Intronic
987800861 5:22695033-22695055 CAACGAGGACAGATGGACACAGG - Intronic
987953170 5:24702556-24702578 CAATGAGAACAGATGGACACAGG - Intergenic
988152621 5:27405678-27405700 CAATGAGAACATTTGGACCTGGG + Intergenic
988530749 5:32025170-32025192 CAAGGAGCTCATATTGATCTGGG + Intronic
989305926 5:39955927-39955949 CAATGAGAACACATGGACATAGG + Intergenic
989694350 5:44182404-44182426 CAATGAGAACATATGGACCCAGG - Intergenic
990059589 5:51630843-51630865 CAATGAGAACATATGGACCCAGG + Intergenic
990107413 5:52281350-52281372 CAATGAGAACAGATGGACACAGG + Intergenic
990611369 5:57460094-57460116 CAATGAGAACACATGGACATAGG - Intergenic
990912455 5:60866226-60866248 CAATGAGAACACATGGACATAGG + Intergenic
991046230 5:62225537-62225559 CAATGAGAACACATGGACATAGG - Intergenic
991363760 5:65847080-65847102 CAATGAGAACACATGGACATAGG - Intronic
991383396 5:66057745-66057767 CAATGAGAACAGATGGACACAGG - Intronic
991426216 5:66494768-66494790 CAAGGAGCAGGGATGGACTGGGG + Intergenic
991962048 5:72054892-72054914 CAATGAGAACACATGGACATAGG + Intergenic
992163165 5:74022016-74022038 CAATGAGAACACATGGATCTGGG - Intergenic
992329526 5:75701517-75701539 CAAGGAGAACACATGGACACAGG + Intronic
992514136 5:77474232-77474254 CAATGAGAACACATGGACCCAGG + Intronic
993029935 5:82694392-82694414 CAGAGATTACAGATGGACCTTGG - Intergenic
993171712 5:84428560-84428582 CAATGAGAACACATGGACATAGG - Intergenic
993201573 5:84822885-84822907 CAATGAGAACACATGGACATAGG + Intergenic
993552296 5:89288563-89288585 CAAGGAGAACACTTGGACATAGG - Intergenic
993553603 5:89307184-89307206 CAATGAGAACACATGGACATAGG - Intergenic
993555523 5:89331781-89331803 CAATGAGAACACATGGACATAGG - Intergenic
993612297 5:90070224-90070246 CAATGAGAACACATGGACATAGG + Intergenic
993690022 5:90988834-90988856 CAATGAGAACACATGGACATAGG - Intronic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994132060 5:96241256-96241278 CAATGAGAACATATGGACATAGG - Intergenic
994142279 5:96355224-96355246 CAAGGAGAACACATGGACACAGG - Intergenic
994162938 5:96577027-96577049 CAATGAGAACACATGGACATAGG - Intronic
994280547 5:97897350-97897372 CAATGAGAACAGATGGACACAGG - Intergenic
994308147 5:98233504-98233526 CAATGAGAACACATGGACATAGG - Intergenic
995017969 5:107333366-107333388 CAATGAGAACACATGGACATAGG - Intergenic
995093395 5:108207523-108207545 CAATGAGAACACATGGACATAGG - Intronic
995252477 5:110009408-110009430 CAATGAGAACACATGGACCCAGG - Intergenic
995274538 5:110263075-110263097 CCAGGAATACAGAAGGACCTTGG + Intergenic
995337267 5:111014003-111014025 CAATGAGAACACATGGACATAGG - Intergenic
995603233 5:113821774-113821796 CAATGAGAACACATGGACATAGG + Intergenic
996293894 5:121889321-121889343 CAAGGAGAACACATGGACACAGG + Intergenic
996366863 5:122711273-122711295 CAATGAGAACACATGGACATAGG + Intergenic
996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG + Intronic
996997053 5:129710166-129710188 CAATGAGAACACATGGACCAGGG - Intronic
997082586 5:130758246-130758268 CAATGAGAACACATGGACATAGG + Intergenic
997094549 5:130896192-130896214 CAACGAGAACACATGGACATAGG + Intergenic
997253412 5:132409121-132409143 CAAGGACCAAACCTGGACCTTGG + Intergenic
997544540 5:134694874-134694896 CAAGGTGCACATAAGCACCTTGG - Intronic
997555786 5:134797458-134797480 CTAGGAGCTCAGTTAGACCTTGG + Intronic
997584387 5:135035774-135035796 CAAGGAGCTCAGCTGACCCTGGG - Intronic
997908366 5:137843343-137843365 CAATGAGAACACATGGACATAGG + Intergenic
998752375 5:145336909-145336931 CAATGAGAACACATGGACCCAGG + Intergenic
998827774 5:146121773-146121795 CAATGAGAACACATGGACATAGG + Intronic
999022152 5:148178329-148178351 CAATGAGAACATATGGACATGGG - Intergenic
999647165 5:153729181-153729203 CAATGAGAACACATGGACATAGG + Intronic
999818960 5:155205488-155205510 CAATGAGAACACATGGACATAGG + Intergenic
999949718 5:156635832-156635854 CAATGAGAACACATGGACATAGG + Intronic
999995042 5:157084173-157084195 CAATGAGAACACATGGACATAGG - Intergenic
1000291188 5:159872969-159872991 CAATGAGAACACATGGACATAGG - Intergenic
1000534396 5:162462092-162462114 CAATGAGAACACATGGACATAGG - Intergenic
1000705841 5:164510932-164510954 CAAGGAGAACACATGGACACAGG + Intergenic
1000773185 5:165383231-165383253 CAATGAGAACACATGGACATAGG - Intergenic
1000819442 5:165965395-165965417 CAATGAGCACACATGGACACAGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001721262 5:173859065-173859087 CAAGGAGCTCAGAGAGACCTTGG - Intergenic
1001864994 5:175096200-175096222 CAATGAGAACACATGGACATAGG + Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002756134 6:161976-161998 CAATGAGAACACATGGACATAGG + Intergenic
1003396281 6:5755383-5755405 CAATGAGAACACATGGACCCAGG - Intronic
1004738799 6:18435819-18435841 CAATGAGAACACATGGACCCAGG + Intronic
1004745646 6:18506778-18506800 CAATGAGCACACATGGACACAGG + Intergenic
1004840321 6:19576700-19576722 CAATGAGAACACATGGACATAGG + Intergenic
1005214357 6:23508118-23508140 CAAGGAGAACACATGGACACAGG + Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005247579 6:23905971-23905993 CAATGAGAACACATGGACATAGG - Intergenic
1005399949 6:25421817-25421839 CAATGAGAACAGATGGACACAGG + Intronic
1005723613 6:28627177-28627199 CAATGAGAACACATGGACATAGG + Intergenic
1005772813 6:29092874-29092896 CAATGAGCACACATGGACACAGG - Intergenic
1005773756 6:29105958-29105980 CAATGAGAACAGTTGGACCTGGG - Intergenic
1006741961 6:36315325-36315347 CAAGGAGAACACATGGACACAGG - Intergenic
1006749751 6:36369448-36369470 CCAGGGGCAGAGAGGGACCTGGG - Intronic
1007925687 6:45647665-45647687 CAAGGAGCACAGGAGGCCCTGGG - Intronic
1008350909 6:50489137-50489159 CAATGAGAACACATGGACATGGG + Intergenic
1008400582 6:51058056-51058078 CAAGGAGAACACATGGACACAGG - Intergenic
1008574961 6:52851236-52851258 CAAGGAGAACACATGGACACAGG - Intronic
1008626051 6:53317591-53317613 CAATGAGAACACATGGACATAGG + Intronic
1008745258 6:54662087-54662109 CAATGAGAACACATGGACATAGG + Intergenic
1008817512 6:55586588-55586610 CAAGGAGAACACATGGACACAGG - Intergenic
1008864482 6:56193113-56193135 CAATGAGAACACATGGACCCAGG + Intronic
1009038478 6:58147540-58147562 CAATGAGAACACATGGACATAGG - Intergenic
1009214268 6:60901192-60901214 CAATGAGAACACATGGACATAGG - Intergenic
1009446976 6:63754386-63754408 CAATGAGAACACATGGACATAGG - Intronic
1009799516 6:68517690-68517712 CAATGAGAACAAATGGACATAGG - Intergenic
1009807874 6:68625879-68625901 CAAGGAGAACACATGGACACAGG - Intergenic
1009819757 6:68785350-68785372 CAAAGAGAACACATGGACATAGG - Intronic
1010462047 6:76124706-76124728 CAATGAGAACACATGGACATAGG - Intergenic
1010508405 6:76688063-76688085 CAATGAGAACACATGGACATAGG - Intergenic
1010601520 6:77833829-77833851 CAATGAGAACACATGGACCCAGG - Intronic
1010616708 6:78021727-78021749 CAATGAGAACAGATGGACACAGG + Intergenic
1010666912 6:78641708-78641730 CAACGAGAACACATGGACATAGG - Intergenic
1010907226 6:81506082-81506104 CAATGAGAACACATGGACCCAGG - Intronic
1010908341 6:81520924-81520946 CAATGAGAACACATGGACCCAGG - Intronic
1010948789 6:82010057-82010079 CAATGAGAACACATGGACCCAGG - Intergenic
1011329722 6:86190181-86190203 CAAGGAGAACACATGGACACAGG - Intergenic
1011543816 6:88463204-88463226 GAAGGAGCACAGATGGTTCTGGG + Intergenic
1011851139 6:91630121-91630143 CAATGAGAACACATGGACCCAGG - Intergenic
1011994234 6:93565297-93565319 CAAGGAGAACACATGGACACAGG - Intergenic
1012050369 6:94334732-94334754 CAATGAGAACACATGGACATAGG + Intergenic
1012156556 6:95826238-95826260 CAATGAGAACACATGGACCCAGG - Intergenic
1012284723 6:97374881-97374903 CAAGGAGAACACATGGACACAGG - Intergenic
1012342721 6:98147634-98147656 CAATGAGAACACATGGACATTGG - Intergenic
1012483373 6:99692455-99692477 CAATGAGAACAGATGGACACAGG + Intergenic
1012486759 6:99730287-99730309 CAATGAGAACAGATGGACACAGG - Intergenic
1012766121 6:103368907-103368929 CAATGAGAACACATGGACATAGG - Intergenic
1013484642 6:110585137-110585159 CAATGAGAACACATGGACATAGG + Intergenic
1013693858 6:112677218-112677240 CAATGAGAACACATGGACATAGG + Intergenic
1013708850 6:112873547-112873569 CAATGAGAACAGATGGACACAGG + Intergenic
1014185832 6:118433114-118433136 CAATGAGAACAGATGGAAATAGG + Intergenic
1014274962 6:119377349-119377371 CAATGAGAACAGATGGACACAGG + Intergenic
1014537599 6:122634155-122634177 CAATGAGAACACATGGACATAGG + Intronic
1014580408 6:123129826-123129848 CAAGGAGAACACATGGACACAGG + Intergenic
1014846336 6:126281949-126281971 CAATGAGAACACATGGACATAGG - Intergenic
1015001906 6:128227915-128227937 CAATGAGAACACATGGACATAGG + Intronic
1015776044 6:136815272-136815294 CAATGAGAACAGATGGACACAGG - Intergenic
1016275456 6:142346822-142346844 CAATGAGAACACATGGACATAGG + Intronic
1016487800 6:144562398-144562420 CAATGAGAACACATGGACCCAGG - Intronic
1016873941 6:148846394-148846416 CAATGAGAACACATGGACGTAGG + Intronic
1016890963 6:149006280-149006302 CAATGAGAACACATGGACATAGG - Intronic
1017047437 6:150360282-150360304 CAATGAGAACACATGGACCCAGG - Intergenic
1017294273 6:152776100-152776122 CAACGAGAACACATGGACATAGG + Intergenic
1017428990 6:154351929-154351951 CAATGAGAACACATGGACATAGG + Intronic
1017615650 6:156243961-156243983 CATGGACCACAGATGGGCATGGG - Intergenic
1018094252 6:160371376-160371398 CAATGAGAACACATGGACATAGG - Intronic
1018109047 6:160517858-160517880 CAATGAGAACACATGGACATGGG + Intergenic
1018993293 6:168691380-168691402 CAAGGAGAACACATGGACGCAGG + Intergenic
1019935390 7:4252251-4252273 CAATGAGCACACATGGACACAGG - Intronic
1020519054 7:9163572-9163594 CAATGAGAACAGATGGACACAGG - Intergenic
1020636497 7:10701804-10701826 CAATGAGAACACATGGACATAGG + Intergenic
1020658990 7:10960284-10960306 CAAGGAGAACACATGGACACAGG - Intergenic
1020758775 7:12241445-12241467 CAATGAGAACAGATGGACACAGG - Exonic
1020973958 7:14982503-14982525 CAATGAGAACACATGGACATAGG - Intergenic
1021472628 7:21023127-21023149 CCAGAAGAAAAGATGGACCTAGG - Intergenic
1021557334 7:21933600-21933622 CAATGAGAACACATGGACATGGG + Intronic
1021769381 7:23983683-23983705 CAATGAGAACACATGGACATGGG + Intergenic
1022027186 7:26459546-26459568 CAAGGAGCAAAGCTGTGCCTGGG - Intergenic
1022463731 7:30637001-30637023 CAATGAGAACAGATGGACACAGG - Intergenic
1022553763 7:31270558-31270580 CAATGAGAACACATGGACATAGG - Intergenic
1022694992 7:32696158-32696180 CAATGAGAACACATGGACGTGGG - Intergenic
1022885437 7:34638797-34638819 CAATGAGAACAGATGGACACAGG + Intergenic
1023550651 7:41366850-41366872 CAATGAGAACACATGGACATAGG + Intergenic
1023992037 7:45134247-45134269 CAAGGAGCATGGATGGTCCTAGG + Intergenic
1024590582 7:50879366-50879388 CAACGAGAACACATGGACATAGG + Intergenic
1024893031 7:54225103-54225125 CAATGAGAACACATGGACCCAGG + Intergenic
1024900887 7:54317284-54317306 CAATGAGAACACATGGACCCAGG - Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1026938956 7:74275596-74275618 CCAGGGGCACAGCTGGTCCTTGG + Intergenic
1027336983 7:77161584-77161606 CAATGAGAACACATGGACCCAGG + Intronic
1027359035 7:77389477-77389499 CAATGAGAACACATGGACATAGG - Intronic
1027615781 7:80422350-80422372 CAATGAGAACACATGGACCCGGG + Intronic
1027843886 7:83347535-83347557 CAAGGAGAACACATGGACACAGG + Intergenic
1027910205 7:84240799-84240821 CAATGAGAACACATGGACCCAGG - Intronic
1027935262 7:84593868-84593890 CAAGGAGAACACATGGACACAGG + Intergenic
1028513021 7:91645590-91645612 CAAGGAGAATACATGGACCCAGG - Intergenic
1028524168 7:91764975-91764997 CAAGGAGAACACATGGACCCCGG + Intronic
1028576638 7:92359265-92359287 CAAGGAGAACACATGGACACAGG - Intronic
1028760972 7:94496269-94496291 CAATGAGAACACATGGACATAGG - Intergenic
1028992391 7:97063087-97063109 CAATGAGAACACATGGACATAGG + Intergenic
1029040967 7:97574309-97574331 CAATGAGAACACATGGACATGGG - Intergenic
1029052414 7:97702696-97702718 CAAGGAGAACACATGGACACAGG + Intergenic
1029944915 7:104522334-104522356 CAATGAGAACACATGGACATAGG + Intronic
1030243202 7:107352256-107352278 CAAGGAGAACACATGGACACAGG + Intronic
1030945301 7:115711948-115711970 CAATGAGAACACATGGACATAGG + Intergenic
1031235825 7:119174866-119174888 CAATGAGAACACATGGACATGGG - Intergenic
1031552336 7:123130511-123130533 CAAGGAGAACACATGGAACCAGG + Intronic
1033017802 7:137689902-137689924 CAAGGAGCCCAGAGCGACTTTGG - Exonic
1033505805 7:141998450-141998472 CAATGAGAACACATGGACATGGG - Intronic
1033543027 7:142374818-142374840 CAATGAGAACACATGGACATAGG + Intergenic
1033628922 7:143138619-143138641 AGAGGAGCACAGATGGGGCTTGG + Intronic
1034084174 7:148308770-148308792 CAATGAGAACACATGGACATAGG - Intronic
1034108957 7:148517572-148517594 CAATGAGAACACATGGACCCAGG - Intergenic
1034704970 7:153133179-153133201 CAATGAGAACACATGGACATAGG - Intergenic
1034742240 7:153487042-153487064 CAATGAGAACATATGGACATAGG - Intergenic
1034818628 7:154196642-154196664 CAGGGAGCCCAGGTGGTCCTTGG - Intronic
1034879811 7:154754923-154754945 CAATGAGAACACATGGACCCAGG + Intronic
1035113211 7:156502127-156502149 CAAGGAGAACACATGGACACAGG + Intergenic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1036013966 8:4759608-4759630 CAATGAGAACACATGGACGTAGG - Intronic
1036216059 8:6880807-6880829 CAATGAGAACACATGGACATAGG - Intergenic
1036707838 8:11058634-11058656 CAATGAGAACAGATGGACACCGG + Intronic
1037195314 8:16181596-16181618 CAATGAGAACACATGGACCCAGG + Intronic
1037308849 8:17533958-17533980 CAATGAGAACACATGGACATAGG - Intronic
1037643967 8:20773489-20773511 CCATGTGCACAGCTGGACCTGGG + Intergenic
1037884996 8:22591300-22591322 CACTGAGCACAGATGGCCCCAGG + Intronic
1038020064 8:23545191-23545213 CAAAGGTCAGAGATGGACCTGGG + Intronic
1038167163 8:25097078-25097100 CAATGAGAACACATGGACCCCGG + Intergenic
1038347616 8:26746893-26746915 CAAGGAGCACAAAGGGAGATAGG - Intergenic
1039005443 8:33031543-33031565 CAAGGAGAACACATGGACACAGG + Intergenic
1039014494 8:33130845-33130867 CTAGGAGCACAGATGAACCCAGG + Intergenic
1039024884 8:33247251-33247273 CAATGAGAACACATGGACATGGG - Intergenic
1039126836 8:34213022-34213044 CAATGAGAACACATGGACATGGG + Intergenic
1039193077 8:34999099-34999121 CAATGAGAACACATGGACATAGG + Intergenic
1039245391 8:35602917-35602939 CAATGAGCACAAATGGACACAGG - Intronic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039734591 8:40317659-40317681 CAAGGAGAACACATGGACACAGG + Intergenic
1040368028 8:46740084-46740106 CAAGGAGAACACATGGACACAGG - Intergenic
1040369228 8:46752310-46752332 CAATGAGCACACATGGACACAGG - Intergenic
1040403200 8:47073917-47073939 CAATGAGAACACATGGACTTAGG + Intergenic
1040426876 8:47297651-47297673 CAATGAGAACAGATGGACACAGG - Intronic
1041129916 8:54687504-54687526 CAATGAGAACACATGGACATAGG - Intergenic
1041130917 8:54698835-54698857 CAATGAGAACACATGGACATAGG + Intergenic
1041424885 8:57709322-57709344 CAATGAGAACACATGGACGTGGG + Intergenic
1041575254 8:59386895-59386917 CAATGAGAACACATGGACATAGG + Intergenic
1041891067 8:62869369-62869391 CAATGAGAACACATGGACCCCGG - Intronic
1041999782 8:64108153-64108175 CAATGAGAACACATGGACATAGG + Intergenic
1042045335 8:64644954-64644976 CAAGGAGAACACATGGACACAGG - Intronic
1042074741 8:64979819-64979841 CAATGAGAACATATGGACATAGG - Intergenic
1042627712 8:70777150-70777172 CAATGAGAACACATGGACATAGG - Intronic
1042688860 8:71473996-71474018 CAATGAGAACAGATGGACACAGG + Intronic
1042834019 8:73061691-73061713 CAATGAGAACACCTGGACCTAGG + Intergenic
1042843088 8:73144417-73144439 CAATGAGAACACATGGACCCAGG + Intergenic
1043064448 8:75549803-75549825 CAATGAGAACACATGGACATAGG - Intronic
1043066337 8:75575796-75575818 CAACGAGAACACATGGACCCAGG - Intergenic
1043200549 8:77364329-77364351 CAATGAGAACACATGGACATAGG + Intergenic
1043202089 8:77382898-77382920 CAATGAGAACACATGGACATAGG - Intergenic
1043767188 8:84151024-84151046 CAATGAGAACACATGGACATAGG - Intergenic
1043828352 8:84957149-84957171 CAATGAGAACACATGGACATAGG + Intergenic
1043834787 8:85033830-85033852 CAATGAGAACACATGGACATAGG + Intergenic
1044041684 8:87377346-87377368 CAAGGAGAACACATGGACACAGG - Intronic
1044080757 8:87879969-87879991 CAATGAGAACACATGGACATAGG - Intergenic
1044135470 8:88580014-88580036 CAATGAGAACACATGGACATGGG + Intergenic
1044140700 8:88647916-88647938 CAATGAGAACACATGGACATAGG + Intergenic
1044170894 8:89050229-89050251 CAGAGAGCTCAGGTGGACCTGGG + Intergenic
1044200580 8:89430613-89430635 CAATGAGAACACATGGACCCAGG + Intergenic
1044315315 8:90743788-90743810 CAAGGAGAACACATGGACACAGG - Intronic
1044454845 8:92381614-92381636 CAATGAGAACACATGGACCCAGG - Intergenic
1044508064 8:93043655-93043677 CAATGAGAACACATGGACATAGG - Intergenic
1045145349 8:99337310-99337332 CAATGAGAACACATGGACATAGG + Intronic
1045165598 8:99601193-99601215 CAAGGAGAACACATGGACACGGG - Intronic
1045212621 8:100114220-100114242 CAATGAGAACACATGGACATAGG + Intronic
1045362272 8:101443843-101443865 CAAGGAGAACACATGGACACAGG + Intergenic
1045979870 8:108172200-108172222 CAATGAGCACACATGGACACAGG + Intergenic
1046095545 8:109555177-109555199 CAATGAGAACACATGGACATAGG - Intronic
1046117204 8:109798698-109798720 CAATGAGAACACATGGACTTGGG - Intergenic
1046119677 8:109829721-109829743 CAATGAGAACACATGGACCCAGG + Intergenic
1046122581 8:109864565-109864587 CAATGAGAACACATGGACCCAGG + Intergenic
1046838516 8:118830168-118830190 CAAGGAGAACACATGGACACAGG + Intergenic
1046966967 8:120178270-120178292 CAATGAGAACACATGGACATAGG - Intronic
1047146278 8:122203000-122203022 CAATGAGAACACATGGACCCAGG + Intergenic
1047179186 8:122570978-122571000 CAAGGAGAACACATGGACACAGG - Intergenic
1047593038 8:126347381-126347403 CAATGAGAACACATGGACATAGG + Intergenic
1047649237 8:126901681-126901703 CAATGAGAACACATGGACATGGG + Intergenic
1047881261 8:129196233-129196255 CAATGAGAACACATGGACGTGGG - Intergenic
1048190314 8:132282411-132282433 CAAGGGGGACAGATGGGACTGGG - Intronic
1050392131 9:5155272-5155294 CAATGAGAACACATGGACATTGG + Intronic
1050637955 9:7632451-7632473 CAATGAGAACACATGGACATAGG + Intergenic
1050710924 9:8462302-8462324 GAAGAAGAGCAGATGGACCTGGG - Intronic
1050922587 9:11223860-11223882 CAATGAGAACACATGGACCCAGG + Intergenic
1051374531 9:16389859-16389881 GAAGGCCCACAGTTGGACCTGGG + Intergenic
1052023278 9:23548616-23548638 CAATGAGAACAGATGGACACAGG + Intergenic
1052165929 9:25327668-25327690 CAAGGAGAACACATGGACACAGG - Intergenic
1052697639 9:31898599-31898621 CAATGAGAACACATGGACATGGG - Intergenic
1052893726 9:33728002-33728024 CAATGAGAACACATGGACATAGG + Intergenic
1053054914 9:34988495-34988517 CCTCGAGCACAGATGGGCCTGGG + Intergenic
1053182031 9:35980793-35980815 CAAAGAGAAAAGATGAACCTGGG - Intergenic
1053274709 9:36774415-36774437 CAATGAGAACATATGGACATAGG - Intergenic
1054794902 9:69291721-69291743 CAACGAGAACACATGGACATAGG + Intergenic
1055006403 9:71512239-71512261 CAATGAGAACACATGGACATAGG - Intergenic
1055218418 9:73896796-73896818 CAATGAGAACACATGGACATAGG - Intergenic
1055543132 9:77336150-77336172 CAAGGAGAACACATGGACACAGG + Intronic
1055629597 9:78210144-78210166 CAATGAGAACACATGGACCCAGG - Intergenic
1055726944 9:79240663-79240685 CTAGGATCAGAGAAGGACCTGGG + Intergenic
1055851931 9:80642290-80642312 CAATGAGAACACATGGACCCAGG + Intergenic
1055895493 9:81169775-81169797 CAATGAGAACACATGGACATAGG - Intergenic
1056015814 9:82386372-82386394 CAATGAGAACACATGGACATAGG - Intergenic
1056572222 9:87825708-87825730 CAAGGAGCACTGTTGGAGATGGG - Intergenic
1056576378 9:87858495-87858517 CAGGGAGCACTGTTGGAACTGGG + Intergenic
1056621442 9:88217956-88217978 CAAGGCGGACAGATGGAGCCTGG + Intergenic
1056885922 9:90443773-90443795 CAAGAAGCAGAGAGGGGCCTGGG - Intergenic
1058098389 9:100889342-100889364 CAATGAGAACACATGGACATAGG - Intergenic
1058266516 9:102905676-102905698 CAATGAGAACACATGGACATAGG + Intergenic
1058819776 9:108719378-108719400 CAATGAGAACACATGGACATAGG + Intergenic
1059111577 9:111562792-111562814 CAATGAGAACACATGGACATAGG - Intronic
1059346715 9:113633982-113634004 GCAGGAGCACAGATGGTCCCTGG + Intergenic
1059600146 9:115768279-115768301 CAATGAGAACACATGGACCCAGG - Intergenic
1059851147 9:118341707-118341729 CAATGAGGACACATGGACATAGG - Intergenic
1059971461 9:119673002-119673024 CAATGAGAACAGATGGACACAGG - Intergenic
1059996953 9:119920052-119920074 CAATGAGAACACATGGACCCAGG - Intergenic
1060329212 9:122650196-122650218 CAAGGAGAACAAATGAACATAGG + Intergenic
1060626595 9:125118744-125118766 CAAGGAGAACACATGGACACAGG - Intronic
1061012811 9:127965470-127965492 CCAGGAGCACAGCTGGAACCTGG - Intronic
1062189511 9:135240610-135240632 GATGGAGCAGAGATGGACATTGG - Intergenic
1203517512 Un_GL000213v1:16671-16693 CAATGAGAACACATGGACATAGG - Intergenic
1185461221 X:333559-333581 GAGGGAGCACAGCTGGGCCTGGG + Intergenic
1185518562 X:719167-719189 CAATGAGAACACATGGACCCAGG - Intergenic
1185547599 X:957820-957842 CAATGAGAACACATGGACATAGG - Intergenic
1185556053 X:1022161-1022183 CAATGAGAACAGATGGACACAGG + Intergenic
1186347492 X:8709060-8709082 CAATGAGAACACATGGACATAGG + Intronic
1186394509 X:9194566-9194588 CAAGGAGAACACATGGACATAGG + Intergenic
1186629673 X:11335415-11335437 CAATGAGAACACATGGACATAGG - Intronic
1186654318 X:11596369-11596391 CAATGAGAACACATGGACATAGG + Intronic
1186750582 X:12617831-12617853 CAAGAAACACAAATGGATCTGGG - Intronic
1186984671 X:14999199-14999221 CAAGGAGAACACATGGACACAGG - Intergenic
1187297772 X:18018946-18018968 CAATGAGAACACATGGACATGGG + Intergenic
1187605707 X:20880513-20880535 CAAGGAGGACACATGGACACAGG + Intergenic
1187756343 X:22531377-22531399 CAATGAGAACACATGGACATAGG + Intergenic
1187785497 X:22881066-22881088 CAATGAGAACACATGGACATAGG + Intergenic
1187814296 X:23214523-23214545 CAATGAGAACACATGGACGTAGG + Intergenic
1187962288 X:24578285-24578307 CAATGAGAACACATGGACATAGG + Intronic
1188074443 X:25758011-25758033 CAATGAGAACACATGGACATAGG - Intergenic
1188174858 X:26976828-26976850 CAATGAGAACACATGGACCCAGG + Intergenic
1188288714 X:28362285-28362307 CAATGAGAACACATGGACATAGG - Intergenic
1188534819 X:31184911-31184933 CAATGAGAACACATGGACATAGG + Intronic
1188896921 X:35680223-35680245 CAATGAGAACACATGGACATAGG - Intergenic
1189162645 X:38826122-38826144 CAATGAGAACACATGGACATAGG - Intergenic
1189938304 X:46093059-46093081 CAATGAGAACACATGGACATAGG + Intergenic
1189990761 X:46591911-46591933 CAATGAGAACAGATGGACATAGG - Intronic
1190412630 X:50152009-50152031 CAAAGAGAACAGATGGACACAGG + Intergenic
1190920592 X:54848029-54848051 CAATGAGAACACATGGACATAGG + Intergenic
1190923959 X:54884670-54884692 CAATGAGAACACATGGACATAGG - Intergenic
1190994108 X:55587782-55587804 CAAGGAGAACACATGGACACAGG - Intergenic
1191001535 X:55664612-55664634 CAAGGAGAACACATGGACACGGG - Intergenic
1191040285 X:56070609-56070631 CAATGAGAACACATGGACCCAGG + Intergenic
1191040675 X:56076002-56076024 CAATGAGAACACATGGACATAGG - Intergenic
1191216742 X:57940232-57940254 CAATGAGAACAGATGGACACAGG - Intergenic
1191751904 X:64551813-64551835 CAATGAGAACACATGGACCCAGG - Intergenic
1191798695 X:65053301-65053323 CAATGAGAACACATGGACATGGG - Intergenic
1191960793 X:66699587-66699609 CAATGAGAACACATGGACATGGG + Intergenic
1192120691 X:68452640-68452662 CTAGGACCACAGATGCACTTAGG - Intergenic
1192374702 X:70548215-70548237 CAATGAGAACACATGGACATAGG + Intronic
1192675368 X:73190540-73190562 CAATGAGAACAGATGGACACAGG + Intergenic
1192713007 X:73611213-73611235 CAATGAGAACACATGGACATAGG - Intronic
1192718930 X:73671963-73671985 CAATGAGAACACATGGACATAGG - Intronic
1192893983 X:75420751-75420773 CAATGAGAACACATGGACATAGG + Intronic
1192921790 X:75714431-75714453 CAATGAGAACACATGGACATGGG - Intergenic
1192983276 X:76369625-76369647 CAATGAGAACACATGGACATAGG + Intergenic
1193075707 X:77353459-77353481 CAATGAGAACACATGGACATAGG + Intergenic
1193096536 X:77555652-77555674 CAATGAGAACATATGGACATGGG + Intronic
1193523921 X:82565710-82565732 CAATGAGGACACATGGACATAGG - Intergenic
1193619747 X:83737411-83737433 CAATGAGAACACATGGACATAGG - Intergenic
1193704876 X:84809236-84809258 CAAAGAGAACACATGGACATAGG - Intergenic
1193777786 X:85665005-85665027 CAATGAGAACACATGGACATAGG + Intergenic
1193938702 X:87653926-87653948 CAAGGAGAACACATGGACACAGG + Intronic
1194263456 X:91727310-91727332 CAATGAGAACACATGGACCCAGG - Intergenic
1194563649 X:95454213-95454235 GCAGGAGCATAGATGGATCTGGG - Intergenic
1194571403 X:95558443-95558465 CAAGGAGAACACATGGAACAGGG - Intergenic
1194643001 X:96425792-96425814 CAATGAGAACATATGGGCCTAGG - Intergenic
1194789988 X:98136030-98136052 CAATGAGAACACATGGACATAGG - Intergenic
1194911549 X:99650924-99650946 CAATGAGAACACATGGACGTAGG - Intergenic
1195425508 X:104725078-104725100 CAATGAGAACACATGGACATAGG - Intronic
1195475570 X:105281220-105281242 CAATGAGAACACATGGACATAGG + Intronic
1195504809 X:105644804-105644826 CAATGAGAACACATGGACATAGG - Intronic
1195956234 X:110333770-110333792 CAATGAGAACACATGGACATGGG + Intronic
1196199229 X:112866978-112867000 CAATGAGGACACATGGACATAGG + Intergenic
1196236316 X:113284907-113284929 CAAGGAGAACACATGGACACAGG + Intergenic
1196269270 X:113692134-113692156 CAATGAGAACAGATGGACACAGG - Intergenic
1196409234 X:115398737-115398759 CAAGGAGAACACATGGACACAGG + Intergenic
1196435318 X:115668897-115668919 CAATGAGAACACATGGACATAGG - Intergenic
1197067992 X:122257050-122257072 CAAGGAGAACACATGGACACAGG + Intergenic
1197104220 X:122694452-122694474 CAATGAGAACACATGGACATAGG - Intergenic
1197284671 X:124582078-124582100 CAATGAGAACACATGGACATGGG - Intronic
1197433001 X:126389060-126389082 CAAGGAGAACACATGGACACAGG + Intergenic
1197449337 X:126592519-126592541 CAATGAGAACACATGGACCCAGG - Intergenic
1197550778 X:127890003-127890025 CAAGGAGAACACATGGACACAGG + Intergenic
1197630013 X:128847667-128847689 CAAGGAGAACACATGGACACAGG + Intergenic
1197659700 X:129156802-129156824 CAAGGAGAACACATGGACACAGG - Intergenic
1197946645 X:131846367-131846389 CAATGAGAACACATGGACATAGG + Intergenic
1197973376 X:132138544-132138566 CAATGAGAACACATGGACATAGG + Intergenic
1197991290 X:132320362-132320384 CAATGAGAACACATGGACATAGG + Intergenic
1198072823 X:133166386-133166408 CAATGAGAACACATGGACATTGG + Intergenic
1198163559 X:134031163-134031185 CAATGAGAACACATGGACATAGG - Intergenic
1198397694 X:136237919-136237941 CAAGGAGAACACATGGACACAGG - Intronic
1198881363 X:141284627-141284649 CAAGGAGAACACATGGACACAGG - Intergenic
1199684172 X:150251417-150251439 CAATGAGAACAGTTGGACCCAGG + Intergenic
1199822696 X:151465005-151465027 CTAGGAGCACAGGTGGCACTGGG + Intergenic
1199923450 X:152435542-152435564 CAATGAGAACACATGGACATAGG + Intronic
1200016884 X:153171656-153171678 CAAGGAGAACACATGGACACAGG + Intergenic
1200360312 X:155598499-155598521 CAATGAGAACACATGGACGTAGG + Intronic
1200363410 X:155635080-155635102 CAATGAGAACACATGGACATGGG - Intronic
1200712460 Y:6499765-6499787 CAATGAGAACATATGGACATAGG - Intergenic
1200877669 Y:8175437-8175459 CAAGGAGAACACATGGACACAGG - Intergenic
1201016921 Y:9613845-9613867 CAAGGAGAACACATGGACACAGG - Intergenic
1201021453 Y:9662192-9662214 CAATGAGAACATATGGACATAGG + Intergenic
1201358328 Y:13119133-13119155 CAAAGAGAACAGATGGACACAGG - Intergenic
1201405454 Y:13645313-13645335 CAAGAAGCACATAAGGGCCTGGG + Intergenic
1201512035 Y:14774952-14774974 CAAGGAGAACACATGGACACAGG + Intronic
1201537184 Y:15063301-15063323 CAATGAGAACACATGGACATAGG - Intergenic
1201543443 Y:15133895-15133917 CAATGAGAACACATGGACCCAGG - Intergenic
1201599446 Y:15712221-15712243 CAATGAGAACACATGGACCCAGG - Intergenic
1201644739 Y:16218055-16218077 CAATGAGAACACATGGACATAGG - Intergenic
1201658076 Y:16367267-16367289 CAATGAGAACACATGGACATAGG + Intergenic
1201709089 Y:16969851-16969873 CAAGGAGAACATATGGACACAGG - Intergenic
1201991956 Y:20036860-20036882 CAATGAGAACAGATGGACACAGG + Intergenic
1202054054 Y:20810714-20810736 CAAGGAGAACACATGGACACAGG + Intergenic
1202591811 Y:26492967-26492989 CAATGAGAACACATGGACCCAGG - Intergenic