ID: 1165233133

View in Genome Browser
Species Human (GRCh38)
Location 19:34399889-34399911
Sequence CCTTCTTGGCAGAGTGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165233124_1165233133 -4 Left 1165233124 19:34399870-34399892 CCACTCTTCCCTTCCCTTCCCTT 0: 4
1: 144
2: 526
3: 1801
4: 5968
Right 1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 257
1165233123_1165233133 3 Left 1165233123 19:34399863-34399885 CCTCATACCACTCTTCCCTTCCC 0: 1
1: 0
2: 5
3: 66
4: 722
Right 1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 257
1165233122_1165233133 7 Left 1165233122 19:34399859-34399881 CCTTCCTCATACCACTCTTCCCT 0: 1
1: 0
2: 5
3: 54
4: 647
Right 1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165233133 Original CRISPR CCTTCTTGGCAGAGTGGAGC TGG Exonic
900511076 1:3061500-3061522 CCTTTGTGGATGAGTGGAGCAGG + Intergenic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
901409800 1:9074630-9074652 CCTTTTTGGCAGAGTGAATTGGG + Intronic
901622215 1:10597723-10597745 CCCTCTTCACACAGTGGAGCTGG - Intronic
901781567 1:11598026-11598048 CCTGCTTGCAAGAGTGGAACTGG + Intergenic
901837517 1:11934139-11934161 CCTTTTGGGGAGAGTGGAGACGG + Intergenic
901923488 1:12552118-12552140 CCAGCGTGGAAGAGTGGAGCAGG - Intergenic
903164732 1:21512172-21512194 CGTCCTTGGCAGGCTGGAGCTGG + Intronic
904417333 1:30371392-30371414 CCTTCAGGAGAGAGTGGAGCAGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905325205 1:37146878-37146900 CATTGATGGCAGAGTGGAGTGGG - Intergenic
908413951 1:63894199-63894221 CATTCTGGGCAGGATGGAGCAGG + Intronic
910806950 1:91197961-91197983 CCCCCTTGGCAGAGTTGAGTTGG + Intergenic
910860010 1:91733921-91733943 GCTTCTTGGGAGACTGAAGCAGG + Intronic
911490970 1:98565301-98565323 CCTTATTGACAAAGTGCAGCGGG + Intergenic
911830547 1:102545573-102545595 CCTTCTGGGCATACTGGAGTTGG + Intergenic
913398242 1:118396884-118396906 GCTTGTTGACAGAGTGCAGCAGG - Intergenic
914505119 1:148281999-148282021 CCTACGTGGCAGAGTGGAGGTGG - Intergenic
914507446 1:148302149-148302171 CCTACGTGGCAGAGTGGAGGTGG + Intergenic
914889028 1:151606547-151606569 ACTTCTTAGCAGACTAGAGCAGG - Intergenic
915700227 1:157785057-157785079 CCTTCTTGGGAGTCTGCAGCAGG - Intergenic
916384712 1:164254631-164254653 CCTTCTTTACATGGTGGAGCAGG - Intergenic
916483633 1:165237333-165237355 GCTACTTGGGAGAGTGAAGCAGG - Intronic
918046200 1:180942402-180942424 TCTCCTAGGCAGAGTGAAGCAGG + Intronic
918082404 1:181217778-181217800 CCTTCCTGGAAGAGAGGGGCTGG + Intergenic
918132735 1:181643789-181643811 CATTCTTGGCAGCGGGGAGATGG + Intronic
919608986 1:199721765-199721787 CATTCTGGGAAGCGTGGAGCAGG - Intergenic
919879211 1:201891241-201891263 CCTGCTTGGCAGAGTTAAGCAGG - Intronic
920805591 1:209231500-209231522 CCCTCTGGGCCGAGTGGCGCCGG - Intergenic
920963185 1:210681859-210681881 TCTTCCAGGCACAGTGGAGCTGG - Exonic
921222104 1:212980602-212980624 CCTTCCTGACAGAATGCAGCAGG - Intronic
922014907 1:221635470-221635492 GCTCCAAGGCAGAGTGGAGCTGG + Intergenic
1062868317 10:876535-876557 CCCTCTGGGCACAGTGGAACAGG + Intronic
1063025055 10:2169788-2169810 CTTTCCTGGCACAGTTGAGCAGG - Intergenic
1063774111 10:9240820-9240842 CCTTAGTGGAAGAATGGAGCTGG - Intergenic
1066164451 10:32771802-32771824 CCTGGTTAGCAGAGTGGTGCAGG + Intronic
1067040748 10:42951983-42952005 CCTTCCAGGCTGAGTGGCGCTGG + Intergenic
1070327403 10:75397450-75397472 CGTTTTGTGCAGAGTGGAGCAGG - Intergenic
1072089336 10:92111958-92111980 CCCTCTTGGCAGAGTACAGTAGG + Intronic
1072322400 10:94263400-94263422 GCTACCTGGGAGAGTGGAGCAGG + Intronic
1072346843 10:94515946-94515968 CCTCCTTGGCAGGAAGGAGCAGG + Intronic
1073311937 10:102549130-102549152 CCTTGTGGGCAGAGTGGAGGTGG + Intronic
1075317994 10:121467459-121467481 CCTTCTCGGCAGGGTGAGGCAGG + Intergenic
1077166902 11:1146375-1146397 CCATCCTGGCTGTGTGGAGCCGG + Intergenic
1078086330 11:8234857-8234879 CCTTTTTGGGAGAGTGGGGATGG - Intronic
1078183352 11:9030612-9030634 CCTGCTGGGGCGAGTGGAGCTGG + Intronic
1078360285 11:10662704-10662726 CCTTCCTGACAGAGCAGAGCCGG + Intronic
1078855971 11:15206626-15206648 CCTTCCTGGAGGACTGGAGCTGG + Intronic
1079086162 11:17446664-17446686 CTGTCTTGGCAGAATGGAGCGGG + Intronic
1081612415 11:44570554-44570576 ACTCCTTGGCAAAGTGGAGCCGG + Intronic
1083201030 11:61121203-61121225 CCTTCTTCCCAAAGTGCAGCGGG + Intronic
1083770406 11:64863930-64863952 CCTCCTTGGCAGGCTGGGGCAGG + Intronic
1084658161 11:70531415-70531437 CATGCTTGGCAGAGGTGAGCTGG + Intronic
1084760312 11:71266563-71266585 CCACATTTGCAGAGTGGAGCCGG + Intergenic
1085680280 11:78567335-78567357 CATTCTAGGCAGGATGGAGCAGG + Intronic
1087899111 11:103620892-103620914 CAGTCCTGGCAGAGTGGAGAAGG + Intergenic
1088628635 11:111752227-111752249 CCTTCCTGCCATAGTGGAGCTGG - Exonic
1088904094 11:114140951-114140973 CCTTCTTGAAACAATGGAGCTGG - Intronic
1090976494 11:131684409-131684431 GTTTCCAGGCAGAGTGGAGCAGG - Intronic
1096843747 12:54394038-54394060 CCTTCTTGGGAGAGAGGTGGGGG - Intergenic
1098790876 12:74820298-74820320 CCTTCTTGGAAGGCTGGAGGGGG + Intergenic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1102469138 12:113149742-113149764 CCTTCTGGGCCGAGCTGAGCAGG + Intergenic
1103366921 12:120390314-120390336 CCTACTTGGGAGACTGAAGCAGG - Intergenic
1103851698 12:123937552-123937574 TCTTCTTGGCGGCGTGCAGCTGG + Exonic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1108498069 13:51044501-51044523 GCTTCTTTGGAGAGCGGAGCTGG + Intergenic
1111115808 13:83775615-83775637 CCTACTTGGCAGACTGAGGCAGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1112263400 13:97899501-97899523 CCTTCCTGGAATGGTGGAGCTGG - Intergenic
1112342932 13:98567367-98567389 GCTTCTTGGCAGGGCGGAGGTGG - Intronic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1114441325 14:22750683-22750705 CCTCATTGGCAGAGTGGAACAGG + Intergenic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1119001309 14:70884482-70884504 CATTCCTGGCAGAGAAGAGCAGG + Intergenic
1119539781 14:75430262-75430284 CTTTCTTTCCAGAGTGGAGCTGG - Intronic
1119653254 14:76398550-76398572 CTTTCTTGGCAGGGTGCAGTGGG + Intronic
1119683096 14:76607433-76607455 GATTGTTGGCAGAGAGGAGCAGG - Intergenic
1120524636 14:85563525-85563547 CCTTCTTCACATGGTGGAGCAGG + Intronic
1121432502 14:93897980-93898002 GCATCTTGACAGAATGGAGCTGG + Intergenic
1121469576 14:94141602-94141624 GCTTCTTGGGAGACTGAAGCAGG - Intergenic
1122287409 14:100659859-100659881 CCTTTCTGGCACAGTAGAGCCGG - Intergenic
1122580957 14:102771302-102771324 CTTTGCTGGCTGAGTGGAGCAGG + Intergenic
1123099277 14:105785137-105785159 CCTACTTGGAAGAGTGAGGCAGG - Intergenic
1202924616 14_KI270724v1_random:12526-12548 GCTTCTTGGGAGACTGAAGCAGG + Intergenic
1123941007 15:25216679-25216701 CCTGATTGGCTGAGTGTAGCCGG + Intergenic
1124658405 15:31526457-31526479 CCTGACTGGCAGAGGGGAGCCGG + Intronic
1129111815 15:73341575-73341597 CATGCTAGGCAGTGTGGAGCCGG + Intronic
1129199637 15:73991360-73991382 GCTTCCTGGAAGAATGGAGCAGG - Intronic
1132024581 15:98394204-98394226 CCTTGTTGGCAGCCTGGAGCAGG + Intergenic
1132337360 15:101056927-101056949 GCTTCTTGGCAATCTGGAGCTGG - Exonic
1132422482 15:101684074-101684096 CATTTTTTGCACAGTGGAGCAGG - Exonic
1135172700 16:20200674-20200696 CTATCTTGGCAGTGTGGGGCTGG + Intergenic
1137765436 16:50974182-50974204 TCTTCTGGGCAGAGTGGATTGGG + Intergenic
1142202710 16:88768701-88768723 CCTTCCTGGCAGTGAGGGGCTGG + Intronic
1142698042 17:1644277-1644299 CCATCTCGGCAGGGAGGAGCAGG - Intronic
1142787487 17:2235528-2235550 GTTTCTTGACAGAGTGGCGCTGG - Intronic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143538908 17:7558149-7558171 CCTTCCTGGCTGGGAGGAGCAGG + Intronic
1143969819 17:10787485-10787507 AATTCATGGCAGAATGGAGCTGG - Intergenic
1144652864 17:17018247-17018269 CCTTCCTGGCGGGGTGGAGGGGG - Intergenic
1146666042 17:34704347-34704369 TCTTCTCTGGAGAGTGGAGCTGG - Intergenic
1146918983 17:36697183-36697205 ACCCCTTGCCAGAGTGGAGCTGG - Intergenic
1147908935 17:43843023-43843045 CCTTCTTTCCTCAGTGGAGCTGG - Intergenic
1148503539 17:48109687-48109709 CCTACTTGGGAGACTGAAGCAGG - Intronic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1148770065 17:50061365-50061387 CCTTCCTGGCTGAGTTGAGGGGG + Intronic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1149117284 17:53112579-53112601 CCTTCTTAGGAGATTGGAGGAGG - Intergenic
1152253961 17:79226685-79226707 CCTTTTTGGTAGAGTGGGGATGG + Intronic
1152936938 17:83144602-83144624 CCTTCGCGGCAGAGTGGTTCAGG + Intergenic
1153801644 18:8676155-8676177 CCTTCTTGGAAATGTGGAGATGG + Intergenic
1153814871 18:8783553-8783575 CCTCTTTGGCAAACTGGAGCTGG - Exonic
1153972510 18:10239337-10239359 CATTCTTTCCAGAGTGGACCCGG - Intergenic
1154136377 18:11783253-11783275 GCCTCTTGGAAGAGGGGAGCTGG - Intronic
1155186308 18:23389648-23389670 CCTACTCGGCAGAGTGGGGCAGG - Intronic
1155316222 18:24573722-24573744 CCTACTTGGGAGACTGAAGCAGG + Intergenic
1156849732 18:41712481-41712503 CCTTCTTTGAAGAATGGGGCAGG - Intergenic
1157139668 18:45093197-45093219 CCATCTTGGCAGAATGGAACTGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158801563 18:60916826-60916848 CTTTAGTGTCAGAGTGGAGCAGG + Intergenic
1160630667 18:80245109-80245131 CCTTCTTTGCCAAGTGGAGCTGG + Intronic
1161677898 19:5663112-5663134 GCTACTTGGGAGAGTGAAGCAGG - Intronic
1161718936 19:5892677-5892699 CCTGCTGGGCAGTGTGGACCCGG - Exonic
1162042175 19:7977675-7977697 CCTTGGTGGCAGAGTGGAGAAGG - Intronic
1164788438 19:30956336-30956358 CCTCCTTGGCTGTGTGGGGCTGG + Intergenic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165937376 19:39397627-39397649 CCTTGTTGGCACAGTCCAGCAGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926708575 2:15856603-15856625 CCATCATGGCAGAAAGGAGCAGG + Intergenic
926961414 2:18362309-18362331 CCTCCCCGGCAGAGTGGAGATGG + Intergenic
927887522 2:26727797-26727819 CCTTCTTGGCGCGGTGCAGCAGG - Exonic
931461507 2:62454184-62454206 CCTAGTCGGCAGAGTGGAGCTGG + Intergenic
933370983 2:81415259-81415281 CATTCTTGGCAGGGTGGAATGGG - Intergenic
933509971 2:83228092-83228114 CCTCCTTGGCAGAGATGAGGTGG + Intergenic
935386853 2:102509027-102509049 CACTCTTGGCAGAGTGGGGAAGG - Intronic
936585776 2:113756557-113756579 CCTCCTGGGCCGAGTGGAGTTGG - Exonic
936656407 2:114493219-114493241 CCTTATAGGAATAGTGGAGCCGG - Intronic
936947217 2:117941624-117941646 CCTGCCTGGCAGGGTGGAGCTGG - Intronic
938214966 2:129503724-129503746 CCATCTTAGCAAACTGGAGCTGG - Intergenic
938324673 2:130390682-130390704 CCTGCTTGGCAGGGAGCAGCTGG - Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
942676842 2:178435269-178435291 GCTTCTTGGGAGACTGAAGCAGG + Intronic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
945127359 2:206527371-206527393 CCTTCCTGGCTGGGTGGGGCTGG + Intronic
947155049 2:227154016-227154038 CCCTCTTGGAAGAGAGGAGGAGG - Intronic
947363626 2:229371674-229371696 TCTTTTTGGCAGAGTGGAGGTGG - Intronic
947516773 2:230812696-230812718 GCCTCTTGGCAGAGGTGAGCTGG - Intronic
947566543 2:231197887-231197909 CCTTCTTGGAAGCATGGAGGTGG + Intergenic
948494311 2:238337020-238337042 CCTTCTGGCCAGGGTGGAGAGGG + Intronic
948573096 2:238929804-238929826 CCTCGTTGGCTGATTGGAGCAGG + Intergenic
1169126625 20:3132706-3132728 GCTACTTGGGAGAGTGAAGCAGG + Intronic
1169142401 20:3233873-3233895 CCTTCTTGTCGCAGTGGAACTGG - Intronic
1170150231 20:13220838-13220860 CTTTATTGGCAAACTGGAGCTGG - Intergenic
1171048910 20:21837609-21837631 CCTTATTGGCAGAGTGCTGAAGG - Intergenic
1171486474 20:25489812-25489834 CCTGCTGGGCAGAGTGGGGGTGG - Intronic
1173193384 20:40894070-40894092 CCTTCTTCCAAGAGTGGAGAGGG + Intergenic
1173480973 20:43399098-43399120 CCTTCTTACCAGAGTGGAGGAGG + Intergenic
1174430449 20:50464565-50464587 CCTACCTGGCAGAGCGGAGGTGG + Intergenic
1174708973 20:52685186-52685208 CCTCCATGGCAGAGTGCAGTGGG + Intergenic
1175523675 20:59619006-59619028 TTTTCCTGGCACAGTGGAGCAGG + Intronic
1175605339 20:60308075-60308097 CCTTCTTGGCAGTGTGCACCAGG - Intergenic
1177124909 21:17183065-17183087 TGGTCTTGGCAGAGTGGACCAGG + Intergenic
1178546809 21:33499542-33499564 GCTACTTGGGAGAGTGAAGCAGG - Intergenic
1178918576 21:36723449-36723471 CCTCCTGGGCACAGTGCAGCTGG + Intronic
1179024054 21:37665899-37665921 GCTTCCTGGAGGAGTGGAGCTGG + Intronic
1179184757 21:39076809-39076831 ATTTCTTGGCAGAGTGGGGTTGG - Intergenic
1179530176 21:42012919-42012941 CCTGCATGTCAGAGTGGAGGTGG - Intergenic
1180093310 21:45543187-45543209 CCTTCCTGGGAGAGTGGCCCAGG - Intronic
1181170837 22:21008994-21009016 CCTTCTTGGCTGAGATGACCAGG + Intergenic
1181797626 22:25321400-25321422 CCTTCTTCTCAGAGAGGAGCTGG - Intergenic
1182475922 22:30576206-30576228 CCTTCTGGGCCGAGTCCAGCAGG + Intergenic
1182744039 22:32591853-32591875 CGTCCTGGGCAGAATGGAGCTGG - Intronic
1182867859 22:33620222-33620244 CCTTGTTGGCAGGATGAAGCTGG - Intronic
1183494527 22:38134993-38135015 CGTTCTTGGCCCAGTGGAGGGGG + Exonic
1184285428 22:43468425-43468447 ACATCTGGGAAGAGTGGAGCAGG - Intronic
1185101901 22:48845064-48845086 GCAGCTTGGCAGAGTGGACCAGG - Intronic
1185418522 22:50722396-50722418 ACTTCTTGGCAGGGTCCAGCAGG - Intergenic
950713848 3:14833747-14833769 CCCTCCTGGCACAGTGCAGCAGG + Intronic
950878260 3:16298499-16298521 CCCACTGGGCAGAGTAGAGCAGG - Intronic
951695053 3:25437682-25437704 CATTTTTGTCACAGTGGAGCGGG + Intronic
952193328 3:31046775-31046797 CCATCTGGAAAGAGTGGAGCAGG - Intergenic
953695794 3:45157747-45157769 CCTTCTTGTCATAGTGCATCAGG + Intergenic
954362271 3:50128387-50128409 CCTGCTTGGCAGAGCTGGGCTGG - Intergenic
954799433 3:53178662-53178684 CCTTCATAGCTGAGTGGGGCAGG - Intronic
956916478 3:73877211-73877233 CCTCCCTGGCAGATTGGACCAGG - Intergenic
958506137 3:94979326-94979348 CCTTCTTCACATGGTGGAGCAGG - Intergenic
959617152 3:108361317-108361339 CCTTCAAGGCAGGATGGAGCGGG - Intronic
960871581 3:122254965-122254987 CATTCTTGGCAGGGTGGATGGGG - Intronic
961057677 3:123802956-123802978 TCTGCTTGGCAGAATGGAGTGGG - Intronic
962069053 3:132014057-132014079 ACATCATGGGAGAGTGGAGCAGG - Intronic
963146554 3:142000877-142000899 CCTTCTGGACACACTGGAGCAGG + Intronic
963902266 3:150743937-150743959 CCTTCATGTCTCAGTGGAGCAGG - Intronic
964223406 3:154370505-154370527 CCTTCTTGGCATATTGGACATGG - Intronic
966110994 3:176401447-176401469 GGCTCTTGGCAGAGTGCAGCAGG - Intergenic
966671186 3:182527924-182527946 CCCTCTTAGCAGTGTGTAGCTGG + Intergenic
968607504 4:1542428-1542450 CCTGCTTGGGAGGTTGGAGCGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
970038616 4:11770446-11770468 ACTTTTTGGCAGAGTGGCGGAGG - Intergenic
970309642 4:14768526-14768548 CCTTCTTCACATGGTGGAGCAGG + Intergenic
974076281 4:57171296-57171318 CCTCATAGGGAGAGTGGAGCAGG - Intergenic
974368472 4:60984211-60984233 CCATCTTGGCAGACTAGAGAGGG - Intergenic
981320812 4:143388994-143389016 CCTTCTCTGCAGAGTGGACTGGG - Intronic
985587487 5:748434-748456 CCTTCTTGGCTTGGTGCAGCTGG - Exonic
986281251 5:6324626-6324648 CCTACTTCACAGAGTGCAGCAGG + Intergenic
987198556 5:15551553-15551575 CCTTCATGGCAGCATGGAGATGG + Intronic
988533182 5:32042845-32042867 CCATCTTGGCAGAGTTGTTCAGG + Intronic
990331966 5:54736525-54736547 CCTCCTTGGCAGCCTGCAGCTGG + Intergenic
992374887 5:76178760-76178782 CCTTTTTGGCAGATTGGATTTGG + Intronic
1000627358 5:163554309-163554331 CCCTCTGTGCAGAGTGGAGGAGG + Intergenic
1002397533 5:178969762-178969784 CAAACTGGGCAGAGTGGAGCTGG - Intergenic
1003880717 6:10477310-10477332 CTATCTTGGCAGAGTGGATAGGG - Intergenic
1006027491 6:31156880-31156902 CATTCTTGGCAGAGTTGAAAGGG + Exonic
1006237194 6:32643970-32643992 CCTTCATGCCAGAGTGGCACAGG - Intronic
1007045852 6:38773604-38773626 CGTTCTTAGCACAGAGGAGCTGG - Intronic
1010153822 6:72768305-72768327 CCTTCTTGGTGGAGTTGAGGAGG + Intronic
1015272011 6:131346076-131346098 CCTTCCTGGTAGAGAGGGGCAGG - Intergenic
1017501799 6:155032650-155032672 GCTACTTGGGAGAGTGAAGCAGG - Intronic
1017943390 6:159073520-159073542 CCTCCTTGACAGATTGGGGCTGG - Intergenic
1018380554 6:163254720-163254742 CCTTCTGGGCAGAGTGGCAATGG - Intronic
1018684560 6:166293833-166293855 TCTTCATGGCAGATTGGGGCTGG + Intergenic
1019645945 7:2129016-2129038 CCAACTGGGCAGAGTGGAGGTGG + Intronic
1022101217 7:27170070-27170092 CCTGCTTGCCAGAGTGGGGGGGG - Intronic
1025244363 7:57305227-57305249 CCTACCTGGCAGAGCGGAGGTGG - Intergenic
1025816423 7:64916431-64916453 CCTACTTGGGAGACTGAAGCAGG + Intronic
1026579442 7:71601671-71601693 GCTACTTGGGAGACTGGAGCAGG + Intronic
1027235048 7:76293151-76293173 CCTCCTTGGGTGAGTGGAGGGGG - Intergenic
1029435638 7:100562621-100562643 CCATCGTGACAGACTGGAGCGGG - Exonic
1029633894 7:101771076-101771098 GCTTCTTGGGAGACTGGGGCAGG - Intergenic
1030208277 7:106972015-106972037 GCTTCTTGGCAGACTGAGGCAGG + Intergenic
1030521827 7:110607156-110607178 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1030522888 7:110620347-110620369 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1034311127 7:150089512-150089534 CTTCCTTGGGAGAGTGGAGAGGG + Intergenic
1034329537 7:150270414-150270436 CCTTCTCGGCAGAATGGGGATGG - Intronic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1034668519 7:152839447-152839469 CCTTCTCGGCAGAATGGGGATGG + Intronic
1034795726 7:154011132-154011154 CTTCCTTGGGAGAGTGGAGAGGG - Intronic
1038478415 8:27885063-27885085 CCATCTTGGCCGAGTGGACAAGG + Intronic
1039403432 8:37292754-37292776 ATTCCTGGGCAGAGTGGAGCTGG - Intergenic
1039586600 8:38712457-38712479 CCTCCTGGGTAGGGTGGAGCCGG + Intergenic
1039755597 8:40518792-40518814 CCTTCCTGGCAGGGAGGAGAGGG - Intergenic
1042320837 8:67473950-67473972 CCTTCTTGGAAGACTTGACCAGG + Intronic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1044164764 8:88967936-88967958 CCTTCTTGGCACACTGGAGTGGG - Intergenic
1044798044 8:95924044-95924066 TCTTCTTTGCAGAGTGGACAGGG - Intergenic
1047794560 8:128241201-128241223 CTATAATGGCAGAGTGGAGCAGG - Intergenic
1049311995 8:141938260-141938282 CCCTCTCGGCAGACAGGAGCCGG - Intergenic
1049775841 8:144404279-144404301 TATACTTGGCAGAGTGGATCAGG - Intronic
1049998610 9:1052912-1052934 ACTTTTTGGCGGAGAGGAGCTGG + Intronic
1052745809 9:32440153-32440175 GCTACTTGGGAGACTGGAGCAGG + Intronic
1052862606 9:33446197-33446219 CCTTCTTGGCACAGGAGAGAGGG + Intronic
1052896233 9:33750600-33750622 CAGGCCTGGCAGAGTGGAGCGGG + Exonic
1053147633 9:35722711-35722733 CTTTCTTGGCAGAGGTGAGGTGG + Intronic
1053307795 9:36996172-36996194 CCGTCATGGCAGAGGGCAGCAGG - Intronic
1053604139 9:39640024-39640046 CCTTCAAGGCAGACTGGGGCAGG + Intergenic
1054249401 9:62702390-62702412 CCTTCAAGGCAGACTGGGGCAGG - Intergenic
1054563512 9:66736922-66736944 CCTTCAAGGCAGACTGGGGCAGG - Intergenic
1055547068 9:77389415-77389437 GCTACTTGGGAGGGTGGAGCAGG - Intronic
1055810901 9:80146700-80146722 CCTTCCTGGCTCAGTGGAGGAGG - Intergenic
1056218663 9:84429758-84429780 GCTTCTTGGGAGACTGGAGCAGG - Intergenic
1056280980 9:85041004-85041026 CCTTCTACGCAGGGTGGTGCTGG - Intergenic
1057128462 9:92637502-92637524 CCTTCCTTGCAGACAGGAGCCGG - Intronic
1057218598 9:93243581-93243603 TGTTCTTAGCAGAGTGGGGCGGG - Intronic
1057899693 9:98938852-98938874 CTTTCTTGGCACAGTGCATCTGG + Intergenic
1058871140 9:109202600-109202622 CCTTCTTGGCATGGTGGTGGTGG - Intronic
1059419178 9:114180587-114180609 CCATCTGTGCAGAGAGGAGCTGG - Intronic
1059424816 9:114214332-114214354 CCTTCATGCCAGATTGCAGCTGG + Intronic
1060192063 9:121599614-121599636 CCAGCTGGGCCGAGTGGAGCGGG - Intronic
1061108032 9:128547385-128547407 CCTACTTGGCAGAATGGGCCAGG + Intergenic
1061805553 9:133135661-133135683 ACTTCCTGGCTGGGTGGAGCTGG + Intronic
1188115729 X:26239956-26239978 CCTTCTTCACATGGTGGAGCGGG + Intergenic
1189378204 X:40482257-40482279 CGTTCTGGGCAGAATGGAACAGG + Intergenic
1190491100 X:50983366-50983388 CCTTCTAGAAAGAGTGGAGCAGG - Intergenic
1192233017 X:69278699-69278721 CCCACTTGGCAGAGGCGAGCCGG + Intergenic
1195039081 X:100997604-100997626 CCTTCTGGGTAGAGTGGCTCAGG - Intergenic
1196924443 X:120619789-120619811 CCCTCTTAGCAAAGTGGAGTGGG + Intronic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1199089306 X:143672233-143672255 CCTGCTTGGCAGAGATGCGCTGG - Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic