ID: 1165239339

View in Genome Browser
Species Human (GRCh38)
Location 19:34451910-34451932
Sequence TGTTAAACAGAGCACAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165239339 Original CRISPR TGTTAAACAGAGCACAGTAG AGG Intronic
904074903 1:27832889-27832911 TGGAAAACAAAGCACAGGAGAGG - Intronic
906437307 1:45807323-45807345 TGCTAAATAGAGCACAATAAAGG - Intronic
907414911 1:54307439-54307461 TGTTAAACACAGCATAGTAAGGG - Intronic
907644448 1:56227946-56227968 TGGTTTACTGAGCACAGTAGAGG + Intergenic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
909963415 1:81877336-81877358 TGTAAAACAAAGCACAGAAAGGG - Intronic
912589265 1:110798328-110798350 TGGTAAAGGGAGCACAGAAGCGG + Intergenic
912776054 1:112507201-112507223 TGGTAAAGAGAGCACAGTCAAGG - Intronic
913717565 1:121552950-121552972 AGTGAAATAGAGCACAGTAAAGG + Intergenic
914779268 1:150769807-150769829 TGTAAAACAGACAAAAGTAGAGG - Intergenic
915693048 1:157709870-157709892 TGTTAAATAGAGCTCAGGAAAGG + Intergenic
919273134 1:195376862-195376884 TTTCCAACAGAGCACAGTGGTGG + Intergenic
921252768 1:213312890-213312912 TGTTAAACAGAACCCACTAATGG - Intergenic
922431789 1:225561951-225561973 TGTAAAATAGAGCACAGTGAGGG - Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1063514384 10:6680496-6680518 GTTTTAACAGAGAACAGTAGTGG + Intergenic
1064978842 10:21146141-21146163 TGTTAAACAAAGTACAGAACAGG + Intronic
1065180120 10:23116395-23116417 TATTTAACAGATCACAGAAGGGG + Intronic
1065946819 10:30612320-30612342 TGTTCACCAGAACACAGCAGCGG + Intronic
1070145267 10:73769340-73769362 TGTAAAGCAGGGCACACTAGGGG - Exonic
1074066207 10:110016445-110016467 TGTTAAAAACAGCCGAGTAGTGG + Intronic
1078645785 11:13140525-13140547 AGTTAAACAGAGGACAGGAGAGG - Intergenic
1079648737 11:22899663-22899685 AGGTAAACTGAGCACAGTAGAGG - Intergenic
1080866295 11:36198441-36198463 TGGTAAAGACAGCACATTAGTGG - Intronic
1081221364 11:40467235-40467257 TTTTAAACAGAGAAAAGAAGTGG - Intronic
1082774916 11:57237402-57237424 TGTTCAGCCCAGCACAGTAGGGG - Intergenic
1083845129 11:65327255-65327277 TGTAAAACAGTGCACCGCAGGGG - Intergenic
1085530789 11:77190846-77190868 TGTCAAACAGGGCAATGTAGAGG - Exonic
1085738477 11:79059774-79059796 TTTTAAAAAGAGCACATCAGTGG - Intronic
1085916340 11:80892725-80892747 TGTTAAAAAGAGCATAATAAAGG + Intergenic
1087533443 11:99413201-99413223 TGTTAAAGAGAGCAAGGAAGAGG + Intronic
1087918974 11:103844459-103844481 TTTTATACAGAGCACGCTAGTGG - Intergenic
1089272108 11:117308509-117308531 TGTTAAGAAGAACAGAGTAGGGG - Intronic
1093893361 12:24549866-24549888 TGGTAAATAGAGCAGAGTCGAGG + Intergenic
1098496988 12:71147530-71147552 TGATAAACACAGAACACTAGAGG + Intronic
1100454404 12:94738274-94738296 TGCTAAACAGAGCAAAGCACTGG + Intergenic
1100639831 12:96471741-96471763 TGTGACACAGAGCAGAGAAGGGG + Intergenic
1101547531 12:105730545-105730567 TGTTAAACAGGGAAAATTAGAGG - Intergenic
1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG + Intergenic
1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG + Exonic
1107069761 13:36257043-36257065 TGTTAAAGACAGAACACTAGTGG - Intronic
1107764733 13:43721968-43721990 TGTTAAACAGACCACACCTGGGG + Intronic
1108121912 13:47197171-47197193 TGTTATACAGGGTACCGTAGTGG + Intergenic
1109855786 13:68126152-68126174 TTTTAAACAGAGAGCAATAGAGG + Intergenic
1110694444 13:78471735-78471757 TATTAAACAGAGAATAGCAGAGG + Intergenic
1113642617 13:111968945-111968967 TGTGAAACAGAACACAGAAATGG + Intergenic
1118054069 14:62060057-62060079 TTTTAAGAAGAGCAAAGTAGGGG - Intronic
1118506275 14:66415539-66415561 TGTTCAACACAGCTCAGTATGGG - Intergenic
1118854979 14:69613707-69613729 AGTTAAACAGAGGACAGTATTGG + Intronic
1119056847 14:71431277-71431299 TGTGGAAGAAAGCACAGTAGGGG - Intronic
1119832716 14:77717667-77717689 ATTAAAACAGAGCACAATAGGGG + Exonic
1120607775 14:86600822-86600844 TGTTAAACAGAGAAATGTAAAGG - Intergenic
1122325618 14:100879427-100879449 TGTCAAAGAGAGGACAGAAGAGG - Intergenic
1124566926 15:30824631-30824653 AGTCGAACAGTGCACAGTAGGGG - Intergenic
1124664224 15:31578512-31578534 TGTGAAACAGTGCAAAGTGGGGG - Intronic
1125034351 15:35106724-35106746 TGTGATACAGAACAGAGTAGGGG + Intergenic
1125368064 15:38940404-38940426 TTTTAAACTGAGAACTGTAGAGG - Intergenic
1129354180 15:74978181-74978203 TGAGAATCAGAGCACAGTTGTGG + Intronic
1129990546 15:79958910-79958932 TGTTAATCAGAGCTGAGTGGTGG - Intergenic
1133866149 16:9645354-9645376 TGTGAAACAGAGGATACTAGAGG + Intergenic
1138218156 16:55223914-55223936 TGTTAAACAGACCACACTTAAGG + Intergenic
1139345938 16:66303907-66303929 TGTGAAACAGTGCACAGAGGAGG - Intergenic
1140029747 16:71326115-71326137 TGGTAAAGAGATCACAGTAATGG - Intergenic
1149149968 17:53550323-53550345 TGTTAAACAGAGGCCAGGCGTGG + Intergenic
1151027730 17:70698791-70698813 TGTTAAACTTAGCAGAGAAGAGG + Intergenic
1151652748 17:75480319-75480341 GATTAAAGACAGCACAGTAGAGG - Intronic
1157939365 18:51910198-51910220 TCTGCAACAGAGCATAGTAGAGG + Intergenic
1158399405 18:57107733-57107755 TGATAAACAGAGCACTGGAAGGG + Intergenic
1160410271 18:78671017-78671039 TGATAAACGGACCACAGCAGTGG - Intergenic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
1165736486 19:38179610-38179632 TGATAAACAGAGCACAAAAAAGG - Intronic
1167970398 19:53185864-53185886 TCTTAAATAGAGCATAGAAGAGG + Intronic
1168164272 19:54535952-54535974 TGTTAATCAAACCTCAGTAGAGG + Intronic
925077013 2:1025265-1025287 TGGTAAACATAGCACAGGACGGG + Intronic
925285434 2:2712665-2712687 ACTTGAACAGAGCACAGGAGAGG - Intergenic
926303962 2:11624266-11624288 TGTAAAACAGTGCACTGTACCGG - Intronic
928332067 2:30365300-30365322 TGTTAAAGACAGACCAGTAGAGG + Intergenic
928703675 2:33924836-33924858 TGCTAAACAGATCACCGCAGTGG + Intergenic
931621419 2:64213813-64213835 TTTAACACAGAGCCCAGTAGAGG + Intergenic
931715251 2:65023733-65023755 TGTTAGAAAGAGAACAGCAGGGG - Exonic
932589215 2:73053796-73053818 TGATGAAGAGAGAACAGTAGAGG - Intronic
933551763 2:83786589-83786611 TATTAAACATAACACAGTAAAGG - Intergenic
934610070 2:95728904-95728926 TCATAAACAGAGAACAGTTGAGG + Intergenic
934790671 2:97057318-97057340 TGTTCATCAGAGCACAGGGGTGG + Intergenic
934815787 2:97325211-97325233 TGTTCATCAGAGCACAGGGGTGG - Intergenic
934821908 2:97383272-97383294 TGTTCATCAGAGCACAGGGGTGG + Intergenic
936251327 2:110870422-110870444 GGTTGAACAGAACACAGAAGTGG + Intronic
937146210 2:119647077-119647099 TGGAAAACAGACCACATTAGAGG - Intronic
940286144 2:152034736-152034758 TGTTTAAAAGAGCACTGTGGGGG - Intronic
941174965 2:162185611-162185633 ATTTAAACAAAGCAAAGTAGGGG - Intronic
942255239 2:174090584-174090606 TCTTAAAAAGAGAACAGAAGAGG + Intronic
943142182 2:183996936-183996958 TGTTAAACAGAAAAGAGCAGAGG - Intergenic
946191734 2:218011163-218011185 TGTTCAGCTGAGCACAGCAGAGG - Intergenic
946711090 2:222506479-222506501 TGATAAACACAACACAGTACTGG + Intronic
1170206005 20:13799336-13799358 TATAAAACAGAGCACAGTAACGG - Intronic
1172048551 20:32098975-32098997 GGTTGAACAGAGCAGAGTCGGGG - Intronic
1173359653 20:42330985-42331007 TGTGAAACAGAACACATTAGGGG + Intronic
1174685959 20:52455288-52455310 TGTAACACAGAGGAAAGTAGAGG + Intergenic
1174772094 20:53309831-53309853 TGTTACACAGAGCACACTAAAGG - Intronic
1178553711 21:33567245-33567267 TGTTAAATAGAGCTCAGGAAAGG + Exonic
949736973 3:7184295-7184317 TAAAAAACAGATCACAGTAGGGG - Intronic
949773848 3:7609450-7609472 TCTTGAACAGGGCAGAGTAGAGG + Intronic
955621380 3:60867956-60867978 AGAAAAGCAGAGCACAGTAGAGG + Intronic
958994855 3:100892617-100892639 TGTTCTACAGAGAACAGAAGTGG - Intronic
959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG + Intronic
968572605 4:1349938-1349960 TGTTGAACCTAGCACAGCAGGGG + Intronic
971192898 4:24444567-24444589 AGTGAAACAGAGAACAGTACAGG + Intergenic
974523451 4:63016384-63016406 TAATTGACAGAGCACAGTAGAGG + Intergenic
975164400 4:71161642-71161664 TGTCAAACACTGCTCAGTAGTGG - Intergenic
976423009 4:84867254-84867276 TCTAAAACATAGCACTGTAGGGG - Intronic
980553004 4:134364763-134364785 TGTCAAAAATAGCAGAGTAGAGG - Intergenic
981518572 4:145636339-145636361 TTTTAAACAGAGCCCAGTTCAGG - Intronic
982628750 4:157804233-157804255 TGAAAAACAGAGCAGAGCAGGGG - Intergenic
985799115 5:1991940-1991962 TGTTCAACAGAAGACAGTAAGGG - Intergenic
989960999 5:50414797-50414819 AGTGAAATAGAGCACAGTAAAGG - Intronic
992489081 5:77223593-77223615 TGACAAGCATAGCACAGTAGTGG + Intronic
992539343 5:77747594-77747616 CTTAAAACAGGGCACAGTAGGGG + Intronic
992953450 5:81883663-81883685 TGGAGGACAGAGCACAGTAGGGG + Intergenic
995956365 5:117781487-117781509 TGTAAGACAGAACACACTAGAGG - Intergenic
998389313 5:141777135-141777157 TGCTAAACACACCACAGAAGAGG + Intergenic
998666768 5:144306636-144306658 AGTCAAACAGAGCACTGAAGAGG - Intronic
998695981 5:144640104-144640126 AGAAAAACAGAGCACAGTAAGGG + Intergenic
998965108 5:147530836-147530858 TCTTAAGCTGAGCACAGTGGTGG + Intergenic
1000722906 5:164730541-164730563 AGTTCCACAGAGCACAGTGGAGG + Intergenic
1004137272 6:12979456-12979478 TGCAAAACAGAGCTCAGGAGGGG - Intronic
1004415562 6:15421048-15421070 TGTAAGGCAGAGCACAGCAGAGG - Intronic
1004478371 6:15995615-15995637 TCAGAAACACAGCACAGTAGTGG + Intergenic
1007767026 6:44166689-44166711 AGTTAAACAGAGCCCAGCTGGGG - Intronic
1011438452 6:87363060-87363082 TCATAAAAAGAGCACAGTAATGG + Intronic
1014189182 6:118473297-118473319 TGGAGAACAGAGCACAGTAAGGG + Intronic
1016298331 6:142600518-142600540 TGGGAACCAGAGCACAGTTGTGG - Intergenic
1016391980 6:143584099-143584121 TGTTTGGCACAGCACAGTAGTGG - Intronic
1017029041 6:150204875-150204897 TGGTGAACAGAGCACAGCATGGG - Intronic
1017962369 6:159233365-159233387 TGTTCAACAGAGCACAGACGCGG + Exonic
1018657009 6:166046884-166046906 TGATACACAGAACACAGTGGAGG - Intergenic
1023833967 7:44057773-44057795 TGGTACACAGAGCCCTGTAGGGG - Exonic
1023964416 7:44955343-44955365 TGATAAACAGAGCAGAGTAATGG + Intergenic
1025159821 7:56646778-56646800 TGTTTCAGAGAGCACAGTAAAGG - Intergenic
1025726894 7:64072558-64072580 TGTTTCAGAGAGCACAGTAAAGG + Intronic
1025755883 7:64340262-64340284 TGTTTCAGAGAGCACAGTAAAGG + Intronic
1028115847 7:86996650-86996672 TGCTATACAGAGAACAGAAGTGG + Intronic
1028752716 7:94399384-94399406 TGTTAAAAAGAGGACTGTGGTGG - Intronic
1030235358 7:107253949-107253971 TGAAAAATAGAGCACAGTAAAGG - Intronic
1030672640 7:112353985-112354007 TGTAGAACAGAGAACAGTAGTGG - Intergenic
1030758881 7:113325568-113325590 TGTAAATCATAGCACAATAGTGG + Intergenic
1033236306 7:139640512-139640534 GGTTAAACAGAGCATCATAGGGG + Intronic
1035138037 7:156726958-156726980 TGTTGAAGAGTGGACAGTAGTGG - Intronic
1037522047 8:19689342-19689364 TGTTGACCAGAGCTCAGTTGGGG - Intronic
1041558216 8:59183865-59183887 CGGGAAACAGAGCACAGGAGTGG + Intergenic
1043415975 8:80049909-80049931 TATTAAAAAGTGCAGAGTAGTGG + Intronic
1045121575 8:99043220-99043242 TGGTAAACAGAGCACATTGATGG - Intronic
1045128886 8:99125872-99125894 TGTTATAAAGAGCACAGAAATGG + Intronic
1045381914 8:101635719-101635741 TCTTAAACAGAAAACAGTGGAGG - Intronic
1045749213 8:105461638-105461660 TGCTAAAAAGATCACAGAAGAGG - Intronic
1047069364 8:121325760-121325782 TGATAATCAGAACACAGAAGAGG + Intergenic
1047509282 8:125504085-125504107 TGCCAAAAAGAGCACAGAAGCGG + Intergenic
1051697631 9:19786659-19786681 AGATACACAGAGCACAGGAGAGG - Exonic
1052422365 9:28259657-28259679 TGTTAAAAGGAGACCAGTAGAGG + Intronic
1055012129 9:71578643-71578665 TGAAAACCAGATCACAGTAGTGG - Intergenic
1057233741 9:93342177-93342199 TGTTAAACAAAACAAAGAAGAGG + Intronic
1057624824 9:96667774-96667796 AGGTAAACAAAGCACAGTTGAGG + Intergenic
1059312073 9:113395466-113395488 TGTGTGACAGAGCACTGTAGGGG - Intronic
1191939312 X:66461162-66461184 TGGCAAACAGAGCATAGTAATGG + Intergenic
1193208146 X:78773207-78773229 AGTTAAACACAGCACAGGAATGG + Intergenic
1197970674 X:132111856-132111878 TTATAAACAGAGCTCAGTCGAGG - Intronic