ID: 1165242197

View in Genome Browser
Species Human (GRCh38)
Location 19:34477828-34477850
Sequence AGTCCCACTGTTCCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165242197_1165242204 24 Left 1165242197 19:34477828-34477850 CCCTCCTTTGGAACAGTGGGACT No data
Right 1165242204 19:34477875-34477897 TTATCCCAGCTTGCAAGAACTGG No data
1165242197_1165242202 -6 Left 1165242197 19:34477828-34477850 CCCTCCTTTGGAACAGTGGGACT No data
Right 1165242202 19:34477845-34477867 GGGACTCAGGCAGCGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165242197 Original CRISPR AGTCCCACTGTTCCAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr