ID: 1165243077

View in Genome Browser
Species Human (GRCh38)
Location 19:34482363-34482385
Sequence CACCGAAGGCGGCCCGGGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243077_1165243089 17 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243077_1165243090 18 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243077_1165243088 16 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243077_1165243086 9 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243077_1165243092 23 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243077_1165243094 27 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243077 Original CRISPR CACCGAAGGCGGCCCGGGAC CGG (reversed) Exonic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
901196936 1:7445517-7445539 CACCCAAGGTGACCCTGGACGGG + Intronic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
1063010067 10:2012735-2012757 CAGCAAAGGCAGCCCAGGACAGG - Intergenic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG + Intronic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1076244510 10:128936023-128936045 CACTGAAGGCAGCCTGGGTCGGG - Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG + Intergenic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1127709741 15:61584714-61584736 CACCAAAGGCGGCCCTGGCATGG - Intergenic
1127913063 15:63434420-63434442 CACCGCAGGCGTCCCTGGCCTGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132867223 16:2099516-2099538 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG + Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134451869 16:14368641-14368663 CAGGGAAGGCGTCCCAGGACGGG - Intergenic
1134523772 16:14929776-14929798 CACCGACGGAGGCCTGGGGCTGG - Intronic
1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG + Intronic
1134548351 16:15127342-15127364 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG + Intronic
1134711363 16:16328261-16328283 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG + Intergenic
1134719213 16:16371564-16371586 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG + Intergenic
1134947428 16:18336506-18336528 CACCAAAGGCTGCTCGGGAAGGG - Intronic
1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134954688 16:18376608-18376630 CACCAAAGGCTGCTCGGGAAGGG - Intergenic
1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1147979271 17:44264830-44264852 CACCTAAGGTGGCCCCAGACTGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG + Exonic
1160729133 19:632801-632823 CCCCCACGGCGGCCCGGGAGAGG - Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
926142721 2:10377824-10377846 CACCGAGGGGGGCCAGGCACGGG + Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
940005808 2:149008504-149008526 CACCGTGGGAGGACCGGGACTGG + Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
942824852 2:180163314-180163336 AACAGAAGGCGGCCCAGGAATGG - Intergenic
946483145 2:220075695-220075717 CACAGAAGTTGGCCTGGGACAGG - Intergenic
1172006693 20:31823016-31823038 CACCCATGGCGGGGCGGGACCGG - Intronic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1184356215 22:43981142-43981164 CACCGAAGGCGAGCAGGGCCCGG - Intronic
952159643 3:30680940-30680962 CACCAAAGGGGGCCCTGAACAGG - Intronic
954375977 3:50194326-50194348 CTCCTCAGGCCGCCCGGGACAGG - Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
954696582 3:52430538-52430560 CAGCAAAGGTGGCCAGGGACTGG + Intergenic
962865803 3:139447300-139447322 CACAGGAGGCGGCCCCTGACAGG - Intergenic
967826491 3:193881707-193881729 CACAGAAGGTGGCCCAGGGCAGG - Intergenic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
981118182 4:141016755-141016777 GAGCCAAGGCGGCCAGGGACAGG - Intronic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG + Intergenic
1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG + Intronic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1025733808 7:64129413-64129435 GACCGATGGTGGCCAGGGACTGG + Intronic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1033288665 7:140062954-140062976 AACCGAAAGCGGCCCCGGGCCGG + Exonic
1034501217 7:151452183-151452205 CAGCTCAGGCGGCCCGGCACCGG + Intergenic
1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1047642418 8:126834623-126834645 CACCGTACCCGGCCCGGAACTGG - Intergenic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG + Intergenic
1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG + Intronic
1057490769 9:95517623-95517645 CACCCAAGGCCGCCTGGCACAGG - Intergenic
1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG + Intronic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1062636696 9:137495204-137495226 CACCGGAGGCTGTCAGGGACAGG - Intronic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190261743 X:48801991-48802013 GACCGAAGGCGGCTAGGGACTGG + Exonic