ID: 1165243086

View in Genome Browser
Species Human (GRCh38)
Location 19:34482395-34482417
Sequence CGCTCCAGCGTTTCCAGCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 151}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243081_1165243086 3 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243083_1165243086 -5 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243077_1165243086 9 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243076_1165243086 10 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243082_1165243086 -2 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243080_1165243086 4 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243074_1165243086 16 Left 1165243074 19:34482356-34482378 CCGCGTCCCGGTCCCGGGCCGCC 0: 1
1: 0
2: 5
3: 29
4: 341
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243073_1165243086 17 Left 1165243073 19:34482355-34482377 CCCGCGTCCCGGTCCCGGGCCGC 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151
1165243069_1165243086 30 Left 1165243069 19:34482342-34482364 CCGGTCGCTCGGACCCGCGTCCC 0: 1
1: 0
2: 0
3: 0
4: 65
Right 1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG 0: 1
1: 0
2: 2
3: 30
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243086 Original CRISPR CGCTCCAGCGTTTCCAGCCT CGG Exonic
900476501 1:2878737-2878759 CGCTGCTGCCCTTCCAGCCTCGG - Intergenic
900746939 1:4366970-4366992 CCCTCCACAGATTCCAGCCTGGG + Intergenic
903401058 1:23049108-23049130 CGCTACTGCACTTCCAGCCTGGG + Intronic
903692198 1:25182430-25182452 CACTCCAGCCTGTCCAGCCTGGG + Intergenic
903866298 1:26400911-26400933 CACTCCAGCCTGTCCAGCCTGGG - Intergenic
905279002 1:36837052-36837074 CCCTCCAGCCTTGCCAGCCCAGG + Intronic
905542133 1:38768213-38768235 GGCTTCATGGTTTCCAGCCTGGG + Intergenic
905674124 1:39813600-39813622 CACTCCAGCCTGTCCAGCCTGGG - Intergenic
906216726 1:44045455-44045477 CACTCCAACATTTCCAGGCTTGG - Intergenic
912028006 1:105203686-105203708 CACTCCAGCCATTCCAGCCTGGG + Intergenic
912217978 1:107637587-107637609 CACTCCAGCCTCTCCAGCCTGGG + Intronic
912489515 1:110054198-110054220 CATTCCAGCTTTCCCAGCCTTGG - Exonic
912831725 1:112958716-112958738 CACTCCAGCCTGTCCAGCCTAGG + Intergenic
915474036 1:156142106-156142128 CACTACAGCCTTTACAGCCTGGG + Intergenic
1063371355 10:5524937-5524959 AGCTCCAGCGTCTCAAGCCAGGG + Exonic
1065767682 10:29046842-29046864 CACTCCAGCTTCTCCAGCTTAGG - Intergenic
1065799634 10:29340047-29340069 CCCTCAAGTGCTTCCAGCCTAGG + Intergenic
1066266008 10:33776092-33776114 CTCTCCAACTTCTCCAGCCTGGG + Intergenic
1068893844 10:62178327-62178349 TGCTCAAGTGTTTCCAGCTTTGG + Intergenic
1071695416 10:87864035-87864057 CTCTCCGGCGTTCCCAGCCCTGG - Exonic
1076133291 10:128028394-128028416 CGGCCCAGCAATTCCAGCCTGGG - Intronic
1076210962 10:128644568-128644590 CGCTCCAGTTTTTTCAACCTGGG + Intergenic
1076586816 10:131555027-131555049 CGCTGCTGGGCTTCCAGCCTGGG - Intergenic
1076613444 10:131741147-131741169 CACTCCAGCACTTCCAGCCTGGG - Intergenic
1078787552 11:14509755-14509777 CACTCCAGCCTGTCCAGCCTGGG - Intronic
1080061271 11:27959388-27959410 GGCTTCTGAGTTTCCAGCCTGGG + Intergenic
1080392865 11:31864612-31864634 CTCTCCAGCGTCTCCATCTTTGG - Intronic
1086848696 11:91783214-91783236 AGCTCCAGCAGCTCCAGCCTTGG - Intergenic
1091815223 12:3432555-3432577 CCCTCCAGCCCTTCCTGCCTGGG - Intronic
1092213325 12:6662767-6662789 TTCTCCAGGGTCTCCAGCCTCGG - Intronic
1094356210 12:29580426-29580448 AGCTCCAGCCTTTCCAGCTGAGG - Intronic
1095630444 12:44370549-44370571 CATTCCAGCCTGTCCAGCCTGGG - Intronic
1098740756 12:74171024-74171046 CGCTCCAGGGAAGCCAGCCTCGG + Intergenic
1100717417 12:97320864-97320886 CACTCCAGCCTCTCCAGCCTGGG - Intergenic
1106242662 13:27923146-27923168 CGCGCCAGCGTCCACAGCCTGGG + Intronic
1113779291 13:112966969-112966991 CCCTCCAGCCTGCCCAGCCTTGG - Intronic
1115267267 14:31513520-31513542 CACTCCAGCCTGTCCAGCCTGGG + Intronic
1117030740 14:51667098-51667120 TACTCCAGCCTGTCCAGCCTGGG + Intronic
1119567666 14:75642230-75642252 GGCTCCACTGTTTTCAGCCTGGG + Intronic
1119582942 14:75803966-75803988 AACTCCAGCTCTTCCAGCCTGGG + Intronic
1119828061 14:77674584-77674606 CACTCCAGCCACTCCAGCCTGGG - Intronic
1120038723 14:79728323-79728345 AGCTCCAGCATTTTCAGCATGGG + Intronic
1126137206 15:45403235-45403257 CGCTGCAGGGTTCCCGGCCTGGG + Exonic
1131444480 15:92485857-92485879 GGCTCCAGCCTTTCCAGTGTTGG - Intronic
1131980154 15:97987003-97987025 CCCTGCAGCATTTGCAGCCTAGG + Intergenic
1133680381 16:8115067-8115089 CGCTCCTCCCTTTCCAGACTGGG - Intergenic
1133717612 16:8464622-8464644 CACTCCAGGCTCTCCAGCCTGGG + Intergenic
1135107002 16:19658484-19658506 CGCACCACTGTCTCCAGCCTGGG + Intronic
1135297690 16:21296963-21296985 CGCGCCACCGACTCCAGCCTGGG + Intronic
1137531879 16:49283089-49283111 CGCTCCAGGCTTTCCAGCCCGGG + Intergenic
1140701281 16:77583666-77583688 TACTCCAGCCTGTCCAGCCTGGG - Intergenic
1142416059 16:89943206-89943228 CCCTCCACCTTTCCCAGCCTCGG + Intergenic
1142505448 17:360653-360675 CGCCCCACGGTTTCCAGCCTTGG - Intronic
1142919049 17:3168545-3168567 GGCACCTGCTTTTCCAGCCTGGG - Intergenic
1142976395 17:3647220-3647242 CGCTCCGGCGTTTCCTGCTCAGG + Intronic
1148269661 17:46253286-46253308 CGCTCCTCCCTTTCCAGACTGGG + Intergenic
1148485211 17:47986529-47986551 CCCACCAGCCTTTTCAGCCTGGG + Intergenic
1150290816 17:63980533-63980555 CCCTCCAGCGTCCTCAGCCTCGG - Intergenic
1150616477 17:66776352-66776374 CGCGCCACCGACTCCAGCCTGGG - Intronic
1150856525 17:68758510-68758532 CCCTCCAGCTGTTCCAGCCTTGG - Intergenic
1151692725 17:75696809-75696831 CACTCCAGCCCCTCCAGCCTGGG - Intronic
1153506064 18:5800002-5800024 TGATCCAGCATTTCCATCCTTGG - Intergenic
1154211012 18:12378032-12378054 AGGTCCAGCGTCGCCAGCCTGGG - Intergenic
1155182870 18:23363208-23363230 CACTCCAGCCTGGCCAGCCTGGG + Intronic
1156172552 18:34503867-34503889 CACTCCAGCCTGGCCAGCCTGGG - Intronic
1159841650 18:73405358-73405380 CACTCCAGTGTATCCAGCCTAGG - Intergenic
1161562512 19:4981410-4981432 TGCTCCCGCGAATCCAGCCTGGG + Intronic
1163010953 19:14425765-14425787 CCCTCCAGCCTTTGCAGTCTGGG + Intergenic
1163027372 19:14520019-14520041 AGCTCCAGCATTTCCCGGCTGGG + Intronic
1163997745 19:21067888-21067910 CACTCCAGCCACTCCAGCCTGGG + Intergenic
1164272747 19:23687349-23687371 CGCTGCAGCCTTTTCAGCCGGGG + Intergenic
1164928820 19:32155916-32155938 TACTCCAGCCTATCCAGCCTAGG - Intergenic
1165243086 19:34482395-34482417 CGCTCCAGCGTTTCCAGCCTCGG + Exonic
1166067323 19:40367537-40367559 CGCCACTGCGCTTCCAGCCTGGG + Intronic
1166099919 19:40565790-40565812 TGCTCCAGCCTGTCCAGCCAAGG + Intronic
1166382394 19:42361892-42361914 TGGTCCAGCGTCTCCAGCCTGGG + Intronic
1166503411 19:43356827-43356849 GGCACCAGGGTTTCCAGCCTTGG + Intronic
1166507043 19:43377934-43377956 GGCACCAGGGTTTCCAGCCTTGG - Intergenic
1167323740 19:48811887-48811909 CGCCACTGCATTTCCAGCCTGGG + Intergenic
1168145302 19:54416824-54416846 CGCTCCACCGGCTCCGGCCTCGG + Intronic
1168240478 19:55086613-55086635 CGCTCCAGCGTCCCCAGAATGGG - Intronic
1168659550 19:58155189-58155211 CGCTCCACCGCTTCCGCCCTCGG + Intergenic
926061500 2:9807733-9807755 CGCTCCAGGCTTTCCAGAATAGG - Intergenic
927470498 2:23372227-23372249 CCTTCCAGTGTTCCCAGCCTTGG - Intergenic
931394610 2:61875096-61875118 CGCACCATTGATTCCAGCCTGGG + Intronic
932364382 2:71138998-71139020 TGCTCCAGCGTGGGCAGCCTGGG + Intronic
932603228 2:73144701-73144723 CACTCCAGCCACTCCAGCCTGGG - Intronic
932894836 2:75629794-75629816 CGCGCCACTGCTTCCAGCCTGGG - Intergenic
935756581 2:106280942-106280964 GGCTCCAGCCTTTCCTCCCTTGG + Intergenic
938041786 2:128082238-128082260 CACTTCAGCCTCTCCAGCCTGGG - Intergenic
940079576 2:149785213-149785235 TGCTCCAGTTTTTCCAGCTTTGG + Intergenic
944364421 2:198900235-198900257 CAGTCCAGCTTTTGCAGCCTGGG + Intergenic
944412773 2:199459032-199459054 CGCTCCAGCGATGCCATCCAGGG - Intronic
945099727 2:206252845-206252867 TGCCCCAGCCTTTCCATCCTGGG + Intergenic
947563270 2:231176578-231176600 AGCTCAAGCGATTCCTGCCTCGG - Intergenic
948114459 2:235484073-235484095 CACTCCAGCCTGTCCAGCCTGGG - Intergenic
1169201965 20:3715322-3715344 CACTCCAGCCTGTCCAGCCTGGG - Intergenic
1169394761 20:5219660-5219682 CGCTCAAGCATTCTCAGCCTAGG + Intergenic
1173013473 20:39203761-39203783 CTGTCCAGCATGTCCAGCCTAGG + Intergenic
1173454119 20:43189871-43189893 CGCTCCTGCGTTCCAAGCCGAGG + Exonic
1173844005 20:46176789-46176811 CCCTCCAGAGCTCCCAGCCTCGG - Intronic
1174041397 20:47702493-47702515 AGCTGCAACCTTTCCAGCCTGGG - Intronic
1174441192 20:50556220-50556242 CACTCTAGCCTCTCCAGCCTGGG - Intronic
1177039478 21:16089539-16089561 CGCTGCAGCCTTTCCCTCCTGGG - Intergenic
1181729285 22:24832976-24832998 CGCGCCACTGTCTCCAGCCTGGG - Intronic
1181811733 22:25407310-25407332 CACTCCAGCCTCTCCAGCCTGGG - Intergenic
1182232561 22:28849597-28849619 CACTCCAGCCCCTCCAGCCTGGG - Intergenic
1183841989 22:40506198-40506220 CACTCCAGCCACTCCAGCCTGGG + Intronic
1185288624 22:50013300-50013322 GGCCCCAGAGTTCCCAGCCTCGG - Intergenic
949344563 3:3064805-3064827 CACTCCAGCCTTTCCAGCCTGGG + Intergenic
949570716 3:5290073-5290095 CACTCCTGTTTTTCCAGCCTAGG - Intergenic
950222937 3:11210349-11210371 CGTGCCAGTGTATCCAGCCTGGG + Intronic
950743619 3:15069182-15069204 CACTGCTGGGTTTCCAGCCTAGG - Intergenic
952569373 3:34695878-34695900 AGCTCTAGCATTTCCAACCTGGG - Intergenic
954009815 3:47626110-47626132 TGCCACAGCATTTCCAGCCTGGG + Intronic
954177184 3:48853747-48853769 CGCTCCACTGCCTCCAGCCTGGG + Intergenic
955770281 3:62378450-62378472 CTCTCCGGCGCTCCCAGCCTCGG - Intergenic
968920530 4:3520076-3520098 TGCCACAGCTTTTCCAGCCTGGG + Exonic
969229748 4:5821764-5821786 CGCTCCAACATCACCAGCCTCGG - Exonic
969581761 4:8069376-8069398 CACTGCAGCGTGTCCAGGCTCGG + Intronic
973310942 4:48708963-48708985 CGCGCCACCGCATCCAGCCTGGG - Intronic
974294687 4:59982227-59982249 CACTCTAGCTTGTCCAGCCTGGG - Intergenic
981003471 4:139851420-139851442 AGCTCCAGGGCTTACAGCCTTGG - Intronic
989800860 5:45537115-45537137 AGCTGCAGCATTACCAGCCTGGG - Intronic
990015197 5:51052865-51052887 CACTCCAGCCTGTCCAGCCCGGG - Intergenic
991290309 5:65027376-65027398 GGCCTCAGAGTTTCCAGCCTTGG - Intergenic
991605686 5:68398294-68398316 CCCTCCATCATTTCCAGCCTTGG - Intergenic
992122197 5:73606453-73606475 TGCTCCAGCTGTTCCAGCTTTGG + Intergenic
992437981 5:76773492-76773514 CACTCCAGCCTCTCCAGCCTGGG + Intergenic
993067676 5:83119946-83119968 CACTGCAGCCTGTCCAGCCTGGG + Intronic
993323333 5:86503323-86503345 TGCTCCACTGTCTCCAGCCTGGG - Intergenic
994217368 5:97153018-97153040 CACTCCAGCCTCTCCAACCTGGG - Intronic
995487391 5:112653161-112653183 CGCACCACTGATTCCAGCCTGGG - Intergenic
998125375 5:139616289-139616311 CACTCCAGCCTGGCCAGCCTGGG + Intronic
998428872 5:142053121-142053143 CACTCCAGCCTGGCCAGCCTAGG + Intergenic
1000512753 5:162204172-162204194 TGCTCCAGAGTTTCCAGGCTGGG + Intergenic
1001068252 5:168558191-168558213 CACTCCAGCCACTCCAGCCTGGG - Intronic
1001610636 5:172998565-172998587 CGCTCCACTGCATCCAGCCTAGG + Intronic
1005035793 6:21553928-21553950 CACTCCAGCCTGGCCAGCCTGGG - Intergenic
1015489395 6:133808541-133808563 GTCTGCAGGGTTTCCAGCCTAGG - Intergenic
1018009099 6:159651491-159651513 CACTCCAGCCTCTCCAGCCTGGG + Intergenic
1019398616 7:837212-837234 CGCCCCAGCTCTTCCAGCCACGG - Intronic
1019735326 7:2647457-2647479 CGCTCCAGGGTCTGCAGGCTGGG - Exonic
1020179387 7:5909653-5909675 CGCACCACTGCTTCCAGCCTGGG + Intronic
1020303549 7:6815207-6815229 CGCACCACTGCTTCCAGCCTGGG - Intronic
1024344137 7:48295829-48295851 TGCTGCACCGTCTCCAGCCTCGG - Exonic
1024455411 7:49600363-49600385 TGCTCAAGTTTTTCCAGCCTTGG + Intergenic
1024851514 7:53722923-53722945 CGCCACTGCGCTTCCAGCCTGGG + Intergenic
1024919447 7:54542491-54542513 CTTCCCAGCGATTCCAGCCTGGG + Exonic
1025021918 7:55486942-55486964 GGCTCCAGCATTTCCATTCTGGG - Intronic
1025124207 7:56331749-56331771 CGCCACTGCATTTCCAGCCTGGG - Intergenic
1027263830 7:76483080-76483102 CGCTCCAGCCTCTCCCACCTGGG + Exonic
1027315203 7:76981193-76981215 CGCTCCAGCCTCTCCCACCTGGG + Intergenic
1029360085 7:100081999-100082021 TGCTCCAGCGTCGCCGGCCTTGG + Intronic
1029672592 7:102044221-102044243 CACTCCAGCCTCTCCAGCCTGGG - Intronic
1033261300 7:139846032-139846054 AGATCCAGAGTTCCCAGCCTGGG - Intronic
1033377134 7:140772580-140772602 CGCTCCAGCCTGTCCAGCCTGGG + Intronic
1036465354 8:8992268-8992290 CGCTACTGCACTTCCAGCCTGGG + Intergenic
1039106336 8:33994037-33994059 CATTCCAGCCTGTCCAGCCTGGG - Intergenic
1039745223 8:40419510-40419532 CGCTTCAACGTTTTCTGCCTGGG + Intergenic
1039871703 8:41551251-41551273 CTCTCCAGTGTTTCAAGTCTTGG - Intergenic
1042521060 8:69711353-69711375 CCCTGCCGCGTTCCCAGCCTCGG + Intronic
1045270784 8:100659309-100659331 CCCTCCAGCCTCTCCAGCCTGGG + Intronic
1046956140 8:120064752-120064774 CACTCCAGCCACTCCAGCCTGGG - Intronic
1050953121 9:11622726-11622748 CACTCCAGCTTGTCCAGCCTGGG - Intergenic
1052888851 9:33677068-33677090 CTCTCCGGCGTTCCCAGCCCTGG + Intergenic
1053233967 9:36435661-36435683 CACTCCAGCCACTCCAGCCTGGG - Intronic
1056387247 9:86107257-86107279 CCCTCCACCCTTCCCAGCCTCGG - Intergenic
1057156920 9:92850615-92850637 CACTCCAGCCACTCCAGCCTGGG - Intronic
1058825575 9:108773505-108773527 CACTCCAGCCTGGCCAGCCTGGG + Intergenic
1061425533 9:130496032-130496054 TGCTCCAGGGTCTTCAGCCTGGG - Intronic
1061851466 9:133418347-133418369 CTCTCGAGCCTTTCCCGCCTTGG + Intronic
1187319276 X:18225998-18226020 CCCTCCAGGGTTTTCAGTCTGGG - Intergenic
1187444866 X:19352266-19352288 CACTCCAGCCACTCCAGCCTGGG - Intronic
1187731429 X:22259205-22259227 CGCACCACTGTATCCAGCCTGGG - Intergenic
1189119036 X:38374118-38374140 CGCGCCACTGCTTCCAGCCTGGG + Intronic
1189247440 X:39574522-39574544 CTTTCCAGCTTCTCCAGCCTTGG - Intergenic
1189333933 X:40158536-40158558 CGCTCCAGCGTTTCGAGGAGGGG - Intronic
1189442767 X:41051957-41051979 CCCTCCAGCCTCTCCAGCCTGGG + Intergenic
1190873519 X:54444337-54444359 TGCTCCAGCTTTTCCAGGATTGG - Intronic
1192430210 X:71106698-71106720 CTCTCCTGCCTGTCCAGCCTGGG - Intronic
1193166258 X:78284432-78284454 CACTCCAGCCACTCCAGCCTGGG - Intronic
1199038192 X:143078521-143078543 CGCTGCAGCATTTCCAGGCTCGG + Intergenic
1199918814 X:152374382-152374404 CACTCCAGCCTCTCCAGCCTGGG - Intronic