ID: 1165243088

View in Genome Browser
Species Human (GRCh38)
Location 19:34482402-34482424
Sequence GCGTTTCCAGCCTCGGCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243074_1165243088 23 Left 1165243074 19:34482356-34482378 CCGCGTCCCGGTCCCGGGCCGCC 0: 1
1: 0
2: 5
3: 29
4: 341
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243083_1165243088 2 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243073_1165243088 24 Left 1165243073 19:34482355-34482377 CCCGCGTCCCGGTCCCGGGCCGC 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243076_1165243088 17 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243081_1165243088 10 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243077_1165243088 16 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243080_1165243088 11 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1165243082_1165243088 5 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243088 Original CRISPR GCGTTTCCAGCCTCGGCTCC CGG Exonic
900013720 1:135636-135658 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
900043790 1:491619-491641 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
900065227 1:726622-726644 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
900321747 1:2087921-2087943 GCGTTCCCAGCCTCGAAGCCAGG - Intronic
900334911 1:2157890-2157912 ACGTTCCCAGCCCCAGCTCCGGG + Intronic
900383556 1:2398168-2398190 GTGTGTCCATCCTCGGCTGCAGG - Intronic
903281315 1:22251508-22251530 GCGTCTCCAGTATCAGCTCCAGG - Intergenic
903777941 1:25805218-25805240 CCGATTCCAGCCTCTGCTCCCGG + Exonic
905824538 1:41018321-41018343 GGGTTTCCTGCCTCGGCTGCAGG - Intronic
907859270 1:58335586-58335608 CCGTTTCCACCCTGGCCTCCAGG - Intronic
912101323 1:106209670-106209692 GTGTTTCCACCCTCCCCTCCTGG - Intergenic
912717289 1:111991062-111991084 GTGTCTCCAGCCTCGGTGCCCGG + Intergenic
914777041 1:150746820-150746842 GCCTTGCCAGCCTCACCTCCTGG - Intronic
916076376 1:161202156-161202178 GCGTTTCCTCCCACAGCTCCTGG - Exonic
1063656125 10:7990890-7990912 AAGTTTCCAGCCTCAGCTGCAGG - Intronic
1064547382 10:16464475-16464497 GTGTTTCCTGACTCGTCTCCTGG + Intronic
1065325511 10:24547747-24547769 GAGTTTCCACCCTCAGTTCCTGG + Exonic
1069580009 10:69559454-69559476 CCGTTTCCAGCCTGGGCTTGAGG + Intergenic
1069996412 10:72344699-72344721 GCTTTTCCAGCCTCTGCTGTGGG + Intronic
1075453223 10:122567790-122567812 ACTTTTCCAGCCTCCTCTCCTGG - Intronic
1076113843 10:127881581-127881603 CCGATTCCAGCCCCAGCTCCAGG + Intronic
1076970064 11:127850-127872 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1077139064 11:1015596-1015618 GCGTTTCCACTCTCCTCTCCTGG - Intronic
1078087976 11:8245861-8245883 ATGGTTCCAGCCTCTGCTCCTGG + Intronic
1087063294 11:94003868-94003890 AGGTTTCCAGCCTAGGCTCCTGG + Intergenic
1088223245 11:107591269-107591291 CCCTGTCCAGCCTCGGCGCCCGG + Exonic
1089536023 11:119161258-119161280 GCGCTCCCAGCCTGGGCTCTGGG + Exonic
1089559349 11:119335979-119336001 GCGGCTCCAGACTCGGCGCCAGG - Exonic
1092241996 12:6840987-6841009 GGGTTTCCAGCTCCGGTTCCTGG - Exonic
1098908308 12:76183591-76183613 GCATTCTCAGCCTTGGCTCCTGG + Intergenic
1101902913 12:108804546-108804568 GCTTTTCCATGCACGGCTCCAGG - Intronic
1103724882 12:122992577-122992599 GCCGTTCCAGCAGCGGCTCCAGG + Exonic
1104609270 12:130215294-130215316 GGGGTTCCATCCTTGGCTCCCGG + Intergenic
1104758514 12:131283405-131283427 GCATTCCCAGCCTCTGCTCTTGG - Intergenic
1104915274 12:132261177-132261199 GCATTTCCAGCCTTGGGTCTTGG - Intronic
1106474709 13:30088755-30088777 GAGTTTCCAGCCTTGGGGCCTGG + Intergenic
1112334085 13:98499619-98499641 GGGTTTCCAGTCTCTGCACCTGG - Intronic
1112698298 13:101975197-101975219 GTGTTTCCAGCCTCTTCTCATGG + Intronic
1113104406 13:106757743-106757765 GAGTTTCTAGCCTCAGCTCCGGG + Intergenic
1120771630 14:88385889-88385911 GCGCTCCCAGCCTCGGGTCCGGG + Intronic
1122021302 14:98840095-98840117 GGGTTTCCAGCCTGGGATGCCGG + Intergenic
1122834601 14:104424607-104424629 GCCCTTCCAGGCTGGGCTCCAGG - Intergenic
1123491326 15:20784499-20784521 GCCCTTCCAGCCTCCGCTGCGGG + Intergenic
1123547828 15:21353590-21353612 GCCCTTCCAGCCTCCGCTGCGGG + Intergenic
1124238067 15:28006360-28006382 CCCTTTCCAACCTCGCCTCCTGG - Intronic
1202956158 15_KI270727v1_random:80820-80842 GCCCTTCCAGCCTCCGCTGCGGG + Intergenic
1132566779 16:627210-627232 GTGTTCCCAGGCTGGGCTCCTGG - Intronic
1132928367 16:2445312-2445334 GCCTCTCCAGCCTTGGTTCCAGG + Intronic
1132934518 16:2473956-2473978 GCGCCCCCAGCCGCGGCTCCAGG - Exonic
1135826044 16:25729837-25729859 GAGCTTCCAGCCTCGGGTACAGG + Intronic
1136245586 16:28974156-28974178 GCGTCTCCACCCGCCGCTCCTGG - Intergenic
1137249598 16:46732216-46732238 ACGCTGCCAGCCTCGGCGCCTGG + Exonic
1138230315 16:55331522-55331544 GCGTTTCCAACGCCGGGTCCCGG + Intergenic
1141830923 16:86509801-86509823 GCGTTTCCCGCCGCGCCGCCCGG + Intergenic
1142223595 16:88866754-88866776 GAGCTTCCAGCCTTGGCTCCCGG + Intergenic
1142450613 16:90171282-90171304 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1142456949 17:62409-62431 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1144781554 17:17810748-17810770 GCGCTCCCAGGCTGGGCTCCAGG - Exonic
1145921524 17:28613644-28613666 GCTCTTCCAGCCTCGGGCCCAGG + Exonic
1146255551 17:31390117-31390139 TTCTTTCCAGCCCCGGCTCCTGG - Intergenic
1147667728 17:42159444-42159466 GCCTCTCCAGCCTGGGCTCATGG + Intronic
1149894854 17:60421749-60421771 GCGTTTCCGCCCTCGGCCTCGGG + Intronic
1150128386 17:62653114-62653136 TCGCCTCCAGCCTCTGCTCCGGG - Intronic
1150131133 17:62669902-62669924 ACGTTTCAAGCTTCTGCTCCTGG - Intronic
1150168531 17:62966805-62966827 GCCTCCACAGCCTCGGCTCCGGG + Intergenic
1150692360 17:67377447-67377469 GCGCCTCCAACCTCGGCTCGCGG - Intronic
1150791178 17:68201101-68201123 CCGTTTCCTGCCCAGGCTCCCGG + Intergenic
1153673305 18:7432965-7432987 GCGTTGCCTGCAGCGGCTCCAGG - Intergenic
1153714923 18:7838546-7838568 GTGTCTCCACCCTCAGCTCCAGG - Intronic
1157597923 18:48875095-48875117 GCGATCCCAGCCTCTGTTCCTGG - Intergenic
1160646862 19:197768-197790 GCCTCTCCAGGCTCAGCTCCTGG - Intergenic
1160913948 19:1487907-1487929 GTGGTGCCAGCCTCGGCACCTGG + Intronic
1161015184 19:1979784-1979806 GCCCTCCCAGCCTCAGCTCCGGG + Exonic
1162999786 19:14359661-14359683 GCACTCCCAGCCTCAGCTCCAGG - Intergenic
1164048611 19:21564446-21564468 GCATTTCCAGCCTGGGCAACAGG + Intergenic
1164158577 19:22611512-22611534 TCTTTTCCAGCCACAGCTCCAGG - Intergenic
1165144208 19:33721169-33721191 GGGTTTCCAGCCATGGCTGCGGG - Intronic
1165181290 19:33973148-33973170 ACGGTTCCAGCATCTGCTCCTGG - Intergenic
1165243088 19:34482402-34482424 GCGTTTCCAGCCTCGGCTCCCGG + Exonic
1165859138 19:38898178-38898200 GAGTTTCCAGCCTCAAGTCCAGG - Intronic
1166060745 19:40323871-40323893 GCCTTTCCAGCCTCAGTTCCTGG - Intronic
925131744 2:1498511-1498533 GGGTTTCCAGCCCAGGCTGCTGG - Intronic
925339750 2:3127881-3127903 GGGTTGCCAGCCAGGGCTCCAGG - Intergenic
927707380 2:25304855-25304877 GCTTTTCCAGCCTCCTATCCTGG + Intronic
929960239 2:46490768-46490790 GCATTTCCTCCCTCTGCTCCTGG + Intronic
937122219 2:119448820-119448842 GCTTTTCCAGCCACCTCTCCTGG + Intronic
938079673 2:128363048-128363070 TCCTTTCCAGACTCAGCTCCGGG + Intergenic
938698393 2:133854899-133854921 GGCTTTCCAGTCTCTGCTCCAGG - Intergenic
938956942 2:136307624-136307646 CCTTTTCCAGCCTCAGATCCAGG + Intergenic
942116892 2:172736325-172736347 GCGACTCCAGGCTCCGCTCCTGG + Intronic
947650352 2:231781176-231781198 GCGGCTCCATCCTCGGCTCCTGG - Exonic
948802367 2:240438670-240438692 GCCTTCCCAGCCTCTGCCCCAGG + Intronic
948950824 2:241250202-241250224 GCATTTCCAGCTTCTGGTCCAGG - Intronic
1168767415 20:391226-391248 GCAATGCCAGCCTCAGCTCCCGG + Intronic
1172098546 20:32472615-32472637 GGGTTTCCAGCCTAGAGTCCTGG - Intronic
1172972101 20:38881200-38881222 GAGTCTCCACCCTCAGCTCCAGG + Intronic
1173550418 20:43929370-43929392 GCATTTCCAGCCTCTGTTCCAGG + Intronic
1175777065 20:61660087-61660109 GTGTTTCCATCCTTAGCTCCGGG - Intronic
1184337324 22:43861715-43861737 TCCTTTCCAGCCTGGGCTCCGGG - Intronic
1185052551 22:48561453-48561475 GTGTTTCCAGCCTCGTTTCGTGG + Intronic
955230923 3:57098127-57098149 GCGTGTGCTGCCCCGGCTCCTGG + Exonic
958052838 3:88369964-88369986 GCTTTTTCAGCCTAGGCCCCTGG - Intergenic
965520267 3:169663166-169663188 CCGGTTCCAGTCTCTGCTCCCGG - Intronic
967106088 3:186256110-186256132 GCTTTTCCTTCCTTGGCTCCCGG + Intronic
968290292 3:197533642-197533664 GTCTCTCCAGCCCCGGCTCCTGG + Intronic
968370819 3:198221754-198221776 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
969035253 4:4248246-4248268 GCGCTTCCGGCGTCCGCTCCGGG + Intergenic
969623273 4:8289652-8289674 GCGTTTCCCACCTCAGCTCATGG - Intronic
969638606 4:8383542-8383564 GCTTTTCCCGCCCAGGCTCCTGG - Intronic
972784661 4:42315408-42315430 CCGTGTGCAGCCCCGGCTCCTGG + Intergenic
974105306 4:57463141-57463163 GCCTTTCCAGCCTCTGCTTTGGG - Intergenic
975647315 4:76558022-76558044 GTGTTTCCAAACTGGGCTCCTGG - Intronic
977911462 4:102541911-102541933 GCGTTTCCAGGTTCCTCTCCAGG - Intronic
978624012 4:110664150-110664172 ACATATCCAGCCTCAGCTCCTGG - Intergenic
997471054 5:134117092-134117114 GGCTTTCCAGCCTAGGCTTCTGG - Intronic
1001928336 5:175655591-175655613 GCCTCTCCAGCCTTGTCTCCTGG + Intergenic
1002442343 5:179270948-179270970 GCCTGTCCAGCCTTAGCTCCAGG - Intronic
1002508638 5:179698571-179698593 GCGTCCCAAGTCTCGGCTCCAGG + Intronic
1002596181 5:180325037-180325059 GCCTTTCCATCCTGTGCTCCAGG - Intronic
1002730053 5:181327310-181327332 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1003528317 6:6916884-6916906 GCGTCTGCAGCCTCCCCTCCTGG + Intergenic
1006091752 6:31632505-31632527 ACCCTTCCAGCCTCCGCTCCTGG + Exonic
1006108523 6:31730399-31730421 GCGTTTGCAGCCCCGTCGCCAGG - Intronic
1011893590 6:92196831-92196853 GTGTTTCCAGCCTTGGCACCTGG + Intergenic
1012541497 6:100367004-100367026 GATTCTCCTGCCTCGGCTCCTGG + Intergenic
1012695868 6:102383182-102383204 GATTTTCCAGCCTCAGCTTCCGG + Intergenic
1013158975 6:107522974-107522996 GCGTTTCCCACCTCAGTTCCTGG - Intronic
1015929432 6:138342691-138342713 TCCTTTACAGCCTTGGCTCCTGG + Exonic
1019026093 6:168964196-168964218 GCCTTTCCTGACCCGGCTCCTGG + Intergenic
1019425670 7:975458-975480 GAGCTTCCAGCCGCGGCCCCCGG - Exonic
1019902257 7:4030096-4030118 GCGCGTCAAGCATCGGCTCCGGG + Intronic
1022714936 7:32891236-32891258 GCGTTTCCGGCCCCGGCACCGGG - Intronic
1022734465 7:33062924-33062946 CCGCCTCCAGCCTGGGCTCCGGG - Intergenic
1024599005 7:50963218-50963240 AGGTTTCCAGCCTTTGCTCCTGG + Intergenic
1026589856 7:71685194-71685216 GTGATTCCAGCCTCTGCACCTGG - Intronic
1028582661 7:92423345-92423367 TCTTTCCCAGCCTCTGCTCCTGG - Intergenic
1028796566 7:94908862-94908884 CCGTCTCCAAACTCGGCTCCTGG - Intronic
1034316254 7:150136154-150136176 GTGTTTCCACCCTGGGATCCAGG - Intergenic
1034790604 7:153964507-153964529 GTGTTTCCACCCTGGGATCCAGG + Intronic
1035611071 8:964817-964839 GCGCTGCCAGGCTCGGATCCTGG + Intergenic
1035746175 8:1963342-1963364 GCGTGTCCAGGCCGGGCTCCAGG - Intergenic
1037769339 8:21789537-21789559 GCTTTGTCGGCCTCGGCTCCTGG - Intronic
1039033969 8:33338804-33338826 GCTTTTCCTGCCACTGCTCCAGG - Intergenic
1040285116 8:46095533-46095555 GCGTTTCCAACATGGGCTTCTGG - Intergenic
1043451484 8:80371775-80371797 GATTTTCCTGCCTCAGCTCCCGG - Intergenic
1048373950 8:133805390-133805412 GCTCTCCCAGCCACGGCTCCTGG - Intergenic
1054766814 9:69048970-69048992 CCATTTCCAGCCTCGGCTTCCGG + Intronic
1056381861 9:86063140-86063162 GCTTTTCAAGCCCCCGCTCCTGG - Intronic
1056793486 9:89640799-89640821 CCCTCTCCAGCCCCGGCTCCTGG + Intergenic
1056793968 9:89644247-89644269 GGGTTTCCAGCCTCTGCTGCAGG + Intergenic
1057034159 9:91799603-91799625 GTGTTTCCTGCCTTGGCTCAGGG - Intronic
1057850848 9:98565723-98565745 CCTCTTCCAGCCTCGGTTCCTGG - Intronic
1057896423 9:98912599-98912621 ATGTTTCCAGCCTGGGCACCTGG + Intergenic
1060978620 9:127779712-127779734 GGGTTGCCAGCCTGGGGTCCAGG - Intergenic
1062054559 9:134464091-134464113 GGGTTTGCAGCCTCGGCTCCTGG + Intergenic
1062754468 9:138279824-138279846 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1203578372 Un_KI270745v1:23984-24006 GCCTCTCCAGGCTCAGCTCCTGG + Intergenic
1185463274 X:341993-342015 CCGCATCCAGTCTCGGCTCCGGG - Intronic
1195442143 X:104910275-104910297 GCATTTCCATCCTAGGCACCGGG - Intronic
1198397171 X:136231780-136231802 GTGCTTCCAGGCTCGCCTCCGGG + Exonic