ID: 1165243089

View in Genome Browser
Species Human (GRCh38)
Location 19:34482403-34482425
Sequence CGTTTCCAGCCTCGGCTCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243082_1165243089 6 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243073_1165243089 25 Left 1165243073 19:34482355-34482377 CCCGCGTCCCGGTCCCGGGCCGC 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243083_1165243089 3 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243077_1165243089 17 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243076_1165243089 18 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243080_1165243089 12 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243074_1165243089 24 Left 1165243074 19:34482356-34482378 CCGCGTCCCGGTCCCGGGCCGCC 0: 1
1: 0
2: 5
3: 29
4: 341
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1165243081_1165243089 11 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243089 Original CRISPR CGTTTCCAGCCTCGGCTCCC GGG Exonic
900192663 1:1358084-1358106 CTGTTCCAGCCCCCGCTCCCAGG - Intronic
901647636 1:10725143-10725165 CGTATCCATCCAGGGCTCCCTGG - Intronic
901888259 1:12239508-12239530 AGTTTTCAGCCTCTGCTCACAGG - Intronic
902397707 1:16141576-16141598 CGTTCCCAGCCCAGGCTCTCAGG + Intronic
902995051 1:20217966-20217988 CGCTTCCAGCTTCTGCTTCCTGG - Intergenic
903056855 1:20642002-20642024 CGTTTCCACCCTCGGGCCCCTGG - Intronic
906159324 1:43636015-43636037 CCTTTCCAGCCTCCCCTCTCTGG + Intergenic
907196582 1:52692144-52692166 TGTCTCCAGCCCTGGCTCCCTGG + Intronic
907502024 1:54887595-54887617 GGTTTCCATCCTCCGCGCCCGGG - Intergenic
910610985 1:89141861-89141883 CCTGTCCAGCCTCTTCTCCCAGG + Intronic
910614966 1:89187329-89187351 CCTGTCCAGCCTCCTCTCCCAGG + Intronic
910900793 1:92118559-92118581 CATTTCCAGACTCTGCTCTCTGG + Intronic
915564644 1:156706718-156706740 GGTTTCCGGCCTCGGGTCCCAGG - Intergenic
919756197 1:201067595-201067617 CCTTCCCAGACTCGGCACCCAGG + Intronic
919772434 1:201171147-201171169 TCCTTCCAGGCTCGGCTCCCGGG - Intronic
920274368 1:204793080-204793102 CTTTTTCAGCCTCCTCTCCCTGG + Intergenic
922351746 1:224739719-224739741 GCCTTCCAGCCTCCGCTCCCAGG - Exonic
922870500 1:228898548-228898570 GGTCAGCAGCCTCGGCTCCCAGG + Intergenic
1063656124 10:7990889-7990911 AGTTTCCAGCCTCAGCTGCAGGG - Intronic
1065343096 10:24724040-24724062 CTTCTCCAGCGTCGGTTCCCCGG - Intergenic
1069580010 10:69559455-69559477 CGTTTCCAGCCTGGGCTTGAGGG + Intergenic
1070151550 10:73808295-73808317 CGCTTTCAGCCTGGGCTCCATGG - Exonic
1071793308 10:88979314-88979336 CCTTGCCAGCCTTGGCTCCTAGG + Intronic
1072682294 10:97516208-97516230 GCCTTCCAGCCTCAGCTCCCAGG - Intronic
1073083696 10:100875181-100875203 CGTTTCCTACCTCCGCTGCCCGG - Intergenic
1074856658 10:117479028-117479050 TGTCCCCAGCCTTGGCTCCCTGG - Intergenic
1075453222 10:122567789-122567811 CTTTTCCAGCCTCCTCTCCTGGG - Intronic
1075802065 10:125160115-125160137 CGTGTCCCCCCTCGGCGCCCGGG - Intronic
1076494219 10:130886284-130886306 GGTTTGCACCCCCGGCTCCCTGG + Intergenic
1077097200 11:804103-804125 CCTGTCCTGCCTCCGCTCCCTGG - Exonic
1077300726 11:1845857-1845879 ACTTTCCAGCCTTGGATCCCTGG - Intergenic
1077556824 11:3230001-3230023 CGATTCCAGCCTAGGTCCCCTGG - Intronic
1078324703 11:10370005-10370027 CTTTATCAGCCTGGGCTCCCAGG + Intronic
1079972983 11:27059166-27059188 CCACTCCAGCCTCGGCTCCAAGG + Intronic
1080222444 11:29921677-29921699 CTTCTCCAGTCTCGGCTCACAGG + Intergenic
1083726461 11:64631030-64631052 AGTCTCCAGCCTCTCCTCCCTGG + Intronic
1085025079 11:73231657-73231679 CTTTTCCAGCCCTGGCTTCCCGG - Intronic
1085396267 11:76208663-76208685 TGTGTCCAGCCTGGTCTCCCAGG + Intronic
1085684269 11:78607547-78607569 CGTTCCAAGCTTCAGCTCCCTGG - Intergenic
1088223247 11:107591270-107591292 CCTGTCCAGCCTCGGCGCCCGGG + Exonic
1090028215 11:123185546-123185568 CGTTTCCGGCCTCCCCTCCCTGG + Intronic
1090959443 11:131543049-131543071 CGTGTTCATCCTCAGCTCCCTGG - Intronic
1098466295 12:70790384-70790406 CCTTTCCTGCCTAGGCTTCCAGG + Intronic
1100978043 12:100142632-100142654 CGTCTCCAGCCTCGGTACCATGG - Exonic
1102789166 12:115629912-115629934 AGTTTCCACCCTCCCCTCCCCGG + Intergenic
1104989578 12:132618394-132618416 CGGTTCCTGCCGCGGCTGCCGGG - Intergenic
1105518528 13:21111655-21111677 AGTTTCCTGCCTGGCCTCCCAGG - Intergenic
1109025034 13:57145307-57145329 CGTTTCCAGCTTTGGCCACCGGG - Intronic
1109026021 13:57151877-57151899 CGTTTCCAGCTTTGGCCACCGGG - Intronic
1109027011 13:57158450-57158472 CGTTTCCAGCTTTGGCCACCGGG - Intergenic
1109028003 13:57165021-57165043 CGTTTCCAGCTTTGGCCACCGGG - Intergenic
1109028989 13:57171586-57171608 CGTTTCCAGCTTTGGCCACCGGG - Intergenic
1112084520 13:96016472-96016494 CAGTTCCAGCCTCGGCTCAAAGG + Intronic
1112733675 13:102394644-102394666 CGCTCCCAGCCTCGGCTCGCCGG - Intronic
1113795582 13:113055892-113055914 TCTCTCCAGCCTCGGCCCCCAGG - Intronic
1121623069 14:95363541-95363563 CGTCCCCAGCCTCTGCCCCCTGG - Intergenic
1122663104 14:103310975-103310997 GGTTTCCAGCCTTGGTTCCCAGG + Intergenic
1122742722 14:103881344-103881366 AGTTTGCAGCCTCAGCTTCCTGG - Intergenic
1122854895 14:104555265-104555287 CCCTCCCAGCCTGGGCTCCCTGG - Intronic
1123020605 14:105396159-105396181 GGTGTGCAGCCTCAGCTCCCTGG + Exonic
1125429329 15:39580395-39580417 CCTTTCCTGCCGCGGCTGCCAGG - Intergenic
1128725945 15:69988761-69988783 CATTCCCAGCCTCGCCCCCCAGG + Intergenic
1131291485 15:91110679-91110701 CCTTTCCAGCCCCATCTCCCAGG - Intronic
1132142348 15:99406210-99406232 CATTTCCAGCCAAGGCGCCCTGG + Intergenic
1132163676 15:99565444-99565466 CGCTCCCGGCCTGGGCTCCCGGG + Intronic
1135405061 16:22191366-22191388 CCTTTCCAGCTCCGCCTCCCGGG + Exonic
1137249599 16:46732217-46732239 CGCTGCCAGCCTCGGCGCCTGGG + Exonic
1137576217 16:49602085-49602107 CTATGCCAGCCTAGGCTCCCCGG + Intronic
1137664453 16:50241480-50241502 CTCTTCCACCCTCAGCTCCCAGG - Intergenic
1137731695 16:50694502-50694524 TGCTTCCAGCCTCAGATCCCAGG - Intronic
1137735278 16:50719164-50719186 GGTCTCCAGCCTCAGCTCCTTGG - Intronic
1138105808 16:54286695-54286717 CCTTTCCAGCCTCTGCGCCCTGG + Exonic
1141830924 16:86509802-86509824 CGTTTCCCGCCGCGCCGCCCGGG + Intergenic
1142976228 17:3646180-3646202 CCGTCCCAGCCTCTGCTCCCAGG - Intronic
1145248625 17:21285376-21285398 CATTTCTAGCTTCGGGTCCCAGG + Intronic
1146255550 17:31390116-31390138 TCTTTCCAGCCCCGGCTCCTGGG - Intergenic
1147728530 17:42582004-42582026 CCTTGCCAGCCTGGTCTCCCAGG - Exonic
1148782652 17:50130292-50130314 CCCCTCCAGCCTCGGCGCCCCGG - Intergenic
1148796885 17:50201331-50201353 CGTTTTAAGCCGCGGCCCCCGGG + Intronic
1150352017 17:64452724-64452746 CTTTTCCATCCTGGGTTCCCAGG - Intronic
1151236770 17:72726042-72726064 CATTCCCAGCCTGGTCTCCCTGG - Intronic
1151640996 17:75393926-75393948 TCTTTTCAGCCTCGGCCCCCAGG + Intronic
1152144029 17:78556945-78556967 CGGTTCCCGACTCGGCTTCCAGG + Intronic
1158443687 18:57500374-57500396 CCTTTCTAGCCTAGGCACCCAGG - Intergenic
1159007134 18:63023230-63023252 TTTTTCCAGCCTCTTCTCCCTGG + Intergenic
1159966290 18:74598490-74598512 GGTTTCCAGCAGGGGCTCCCTGG + Intronic
1160702118 19:512708-512730 CCCTGCAAGCCTCGGCTCCCGGG + Intronic
1161352536 19:3801922-3801944 CGTTCCCATCCCTGGCTCCCGGG - Intronic
1161478172 19:4497823-4497845 CGTTTCCCGGCTTAGCTCCCAGG + Intronic
1163751962 19:19083513-19083535 GATCTCCAGCCTCGGCTCTCTGG + Intronic
1164158576 19:22611511-22611533 CTTTTCCAGCCACAGCTCCAGGG - Intergenic
1164952078 19:32345510-32345532 CGGGTCCAGCCTCGGCGGCCCGG + Intergenic
1165161662 19:33820268-33820290 CGTTGCGAGCCCCGGCTTCCCGG - Intergenic
1165172778 19:33905890-33905912 CTTTTCCAGCATCGCCTGCCAGG + Intergenic
1165243089 19:34482403-34482425 CGTTTCCAGCCTCGGCTCCCGGG + Exonic
1165444981 19:35851635-35851657 CGATTCCTGCCTCCGTTCCCCGG - Exonic
925063014 2:907849-907871 CTTCTCAAGCCTCGGCACCCAGG + Intergenic
927853347 2:26513433-26513455 AGATTCCAGCCTGGGCTGCCCGG + Intronic
928171100 2:29003470-29003492 CCTGTCCCGCCTCTGCTCCCAGG + Exonic
929980102 2:46670206-46670228 TGCTTCCAGCCTCTGCACCCTGG + Intergenic
931694066 2:64859251-64859273 TATTTCCAGCCTCCTCTCCCAGG + Intergenic
933354400 2:81195505-81195527 GGTGTTCAGCCTCGGCCCCCTGG + Intergenic
934086506 2:88514324-88514346 GGATTCCAGCCTCAGCTGCCTGG - Intergenic
934862391 2:97775241-97775263 CGTTGGAGGCCTCGGCTCCCAGG - Intronic
936060955 2:109295465-109295487 CTTTCCCAGCCTCACCTCCCAGG - Intronic
937373552 2:121319556-121319578 AGTCTCCAGCCTGGGTTCCCAGG + Intergenic
937853532 2:126656463-126656485 CGACTCCAGCCCCGGTTCCCCGG + Intronic
938079675 2:128363049-128363071 CCTTTCCAGACTCAGCTCCGGGG + Intergenic
946646896 2:221846967-221846989 CTTTTCCAGCTTGGGTTCCCTGG - Intergenic
947650351 2:231781175-231781197 CGGCTCCATCCTCGGCTCCTGGG - Exonic
1168767416 20:391227-391249 CAATGCCAGCCTCAGCTCCCGGG + Intronic
1170554489 20:17504569-17504591 CCTTTCCTTCCTCGGTTCCCAGG - Intronic
1175659780 20:60802798-60802820 CATTTCCAGCCCAGGCTGCCAGG + Intergenic
1176044645 20:63086216-63086238 CGTTTCCCGCCTCTGCTTCCAGG - Intergenic
1179377537 21:40864224-40864246 CAGTGCCAGCCTCAGCTCCCAGG + Intergenic
1181820934 22:25475174-25475196 CTGTCCCAGCCTCGTCTCCCAGG + Intergenic
1184277553 22:43418820-43418842 CGTGTCCAGCCACAACTCCCTGG + Intronic
1184461817 22:44642126-44642148 CGTATCCTGGCTCTGCTCCCAGG - Intergenic
950015292 3:9750703-9750725 CCATTCCAGCCTCGACCCCCCGG + Intronic
950154529 3:10711623-10711645 CATTTCCAGCCTCCGTGCCCTGG - Intergenic
950549589 3:13658088-13658110 TGTCTCCAGCCCCGGCTACCTGG - Intergenic
953679245 3:45027195-45027217 CTCTTCTAGCCTCTGCTCCCTGG - Intronic
957318710 3:78601803-78601825 TGTTTCCAGCCTTGTGTCCCTGG + Intronic
959011302 3:101079448-101079470 CGTTTCTAACCTCAGCTCCTTGG - Intergenic
962609874 3:137066220-137066242 CATTGCCAGCCTCGGCTCTCAGG + Intergenic
962808206 3:138941490-138941512 CATCTCCAGCCTTGGCTTCCAGG + Intergenic
964418439 3:156474712-156474734 TGTTTCCTGCTTCTGCTCCCAGG + Exonic
969476303 4:7424350-7424372 TGTCTCCAGCCTGGGCTCTCTGG + Intronic
985531334 5:435449-435471 CGCTGCCAGCCTCTGCTGCCTGG - Exonic
985654014 5:1120641-1120663 TGTGTCCAGTCTGGGCTCCCAGG - Intergenic
985877764 5:2613250-2613272 CCCCTCCTGCCTCGGCTCCCAGG + Intergenic
985892914 5:2730017-2730039 AGCTTCCAGTCTTGGCTCCCAGG - Intergenic
985901825 5:2802167-2802189 CGTTTCCAGGCTTGGCTTCGAGG + Intergenic
988856262 5:35230434-35230456 GGATTTCAGCCTCCGCTCCCCGG + Exonic
991022351 5:61993067-61993089 TGTTTCCAGCCTGGTCTCACAGG + Intergenic
991054390 5:62306163-62306185 CCTCCCCAGCGTCGGCTCCCCGG + Intronic
992632699 5:78697343-78697365 CTTCTCCTGCCTTGGCTCCCAGG - Intronic
995414208 5:111890722-111890744 CGTCTCCAGCCTTGGCTCAAAGG - Intronic
997584181 5:135034787-135034809 CTTCTCCAGCCTCTTCTCCCGGG + Intronic
999600800 5:153262685-153262707 TGTTTCCAGCTTCGGCTGCTAGG - Intergenic
1000090081 5:157922587-157922609 ATTCTCCTGCCTCGGCTCCCCGG - Intergenic
1001636029 5:173211117-173211139 CATTCCCAGCCTCAGCTCCCTGG - Intergenic
1002421163 5:179149807-179149829 CGGTTCCAGCCTGTGCTCCTCGG + Intronic
1002926980 6:1610463-1610485 CGTGTCCAGCCCCAACTCCCTGG + Exonic
1004441311 6:15657833-15657855 CCTTTCCAGCTTCATCTCCCAGG + Intronic
1007997251 6:46321544-46321566 GGTTTCCAGCCTTGTCTCCATGG - Intronic
1008671162 6:53770472-53770494 CTTTCCCTGCCTCCGCTCCCAGG + Intergenic
1010022550 6:71177517-71177539 CATTTCCATCCTGGGCTCTCAGG + Intergenic
1012387138 6:98695296-98695318 CATTCCGAGCCTTGGCTCCCTGG - Intergenic
1024599006 7:50963219-50963241 GGTTTCCAGCCTTTGCTCCTGGG + Intergenic
1027669083 7:81073779-81073801 TGTTTCCATCCTCAGCTCCCAGG + Intergenic
1030750556 7:113227054-113227076 TGATTCCAGCCTCGGCTCAAAGG + Intergenic
1032096012 7:128938856-128938878 CCACTCCAGCCTCTGCTCCCAGG - Intronic
1033073668 7:138228139-138228161 GGCTACCATCCTCGGCTCCCAGG + Intergenic
1034241785 7:149616619-149616641 CCTCTCCAGCCTCGGTTACCAGG - Intergenic
1035284133 7:157795420-157795442 GGTTCCCAGCCTCAGCCCCCTGG - Intronic
1036476271 8:9096303-9096325 CAAATCCAGCCCCGGCTCCCAGG + Intronic
1036757263 8:11479490-11479512 CGCTGCAAGCCTCGCCTCCCGGG + Intergenic
1038288244 8:26225658-26225680 CCTTTCCCACCTCAGCTCCCAGG + Intergenic
1041192351 8:55366446-55366468 AGTTGCCAGACTCGGCTGCCTGG - Intronic
1049005102 8:139850016-139850038 CGGTTCCCGCATCAGCTCCCAGG + Intronic
1049215422 8:141405648-141405670 CAGCTCCACCCTCGGCTCCCTGG - Intronic
1049578731 8:143401276-143401298 CCTTGCCAGCCTCCCCTCCCCGG + Intergenic
1050954116 9:11633446-11633468 AGTTTCCAGACTCGGCTGTCTGG - Intergenic
1051194402 9:14547304-14547326 CATTTCCAGCCTCAGCTCAAAGG - Intergenic
1052192683 9:25677712-25677734 CGACTCCGGCCTCCGCTCCCGGG - Exonic
1052996164 9:34552570-34552592 TGCCTCCAGCCTCTGCTCCCGGG - Intronic
1053489688 9:38489198-38489220 CGTTAGCAGCCTCTGTTCCCTGG - Intergenic
1057896424 9:98912600-98912622 TGTTTCCAGCCTGGGCACCTGGG + Intergenic
1059269713 9:113064233-113064255 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059270847 9:113069681-113069703 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059273115 9:113080569-113080591 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1059274251 9:113086015-113086037 TGTTTCCAACCTCTGCCCCCAGG - Intergenic
1185463273 X:341992-342014 CGCATCCAGTCTCGGCTCCGGGG - Intronic
1188108299 X:26168105-26168127 CGTTTCAAGCTTTAGCTCCCAGG - Intergenic
1188870783 X:35368265-35368287 CGTTTCCAGCTTCATCACCCTGG - Intergenic
1190282748 X:48941784-48941806 CGTTTCCAGCCTCGCCTGGATGG - Intronic
1195129490 X:101839425-101839447 CCTTTCCTGCCTCGGTCCCCGGG - Intronic
1195176748 X:102320404-102320426 CCTTTCCTGCCTCGGTCCCCAGG + Intronic
1195182116 X:102366689-102366711 CCTTTCCTGCCTCGGTCCCCAGG - Intronic