ID: 1165243090

View in Genome Browser
Species Human (GRCh38)
Location 19:34482404-34482426
Sequence GTTTCCAGCCTCGGCTCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243073_1165243090 26 Left 1165243073 19:34482355-34482377 CCCGCGTCCCGGTCCCGGGCCGC 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243082_1165243090 7 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243083_1165243090 4 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243074_1165243090 25 Left 1165243074 19:34482356-34482378 CCGCGTCCCGGTCCCGGGCCGCC 0: 1
1: 0
2: 5
3: 29
4: 341
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243080_1165243090 13 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243081_1165243090 12 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243076_1165243090 19 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156
1165243077_1165243090 18 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243090 Original CRISPR GTTTCCAGCCTCGGCTCCCG GGG Exonic
900147469 1:1164722-1164744 GACTCCCGGCTCGGCTCCCGCGG + Intergenic
900210984 1:1455782-1455804 GCTTCCAGGCTGGGCTGCCGAGG - Exonic
900216805 1:1486101-1486123 GCTTCCAGGCTGGGCTGCCGGGG - Exonic
900223890 1:1523830-1523852 GCTTCCAGGCTGGGCTGCCGGGG - Exonic
900984613 1:6066146-6066168 AGTCCCAGCCTGGGCTCCCGAGG + Intronic
901031414 1:6309123-6309145 GTCTCCAGCCTCGGCAGCAGAGG + Intronic
901618294 1:10559886-10559908 GTTTTCAGTCTCGCCTCCCCTGG + Intronic
901888258 1:12239507-12239529 GTTTTCAGCCTCTGCTCACAGGG - Intronic
903056854 1:20642001-20642023 GTTTCCACCCTCGGGCCCCTGGG - Intronic
903071293 1:20728072-20728094 CTTTGCAGCCTCCCCTCCCGTGG - Exonic
903986895 1:27234979-27235001 GGTCCCCGCCTCGGCGCCCGCGG - Intronic
905900071 1:41575505-41575527 GTTTCCATCGTCTGCTTCCGTGG - Intronic
907526306 1:55056168-55056190 CTCCCCAGCCTCAGCTCCCGAGG + Exonic
915616906 1:157045984-157046006 TTTCCCTGCCTCGGTTCCCGCGG + Intergenic
918067589 1:181111920-181111942 TCTTCCAGCCTCTGCTCCTGTGG + Intergenic
920338352 1:205259721-205259743 CTTCCCAGCCCTGGCTCCCGTGG - Intronic
920846837 1:209600648-209600670 GTATCCAGCATAGGCTCCTGAGG - Intronic
921255391 1:213334059-213334081 GTTTCCAGCCACTGCCCCCTTGG - Intergenic
922870501 1:228898549-228898571 GTCAGCAGCCTCGGCTCCCAGGG + Intergenic
1068124168 10:52817503-52817525 TTTTCCAGCCTGGGATCCCAAGG + Intergenic
1068999589 10:63248411-63248433 TTCTCCTGCCTCGGCTTCCGGGG - Intronic
1075802064 10:125160114-125160136 GTGTCCCCCCTCGGCGCCCGGGG - Intronic
1076761617 10:132608669-132608691 GTGGCCAGGCTCGGCTCCAGGGG + Intronic
1077917909 11:6622971-6622993 ACCTCCAGCCTCAGCTCCCGTGG + Exonic
1078333983 11:10450039-10450061 GTTTCCAGAGTTGGCACCCGCGG - Intronic
1078699779 11:13669062-13669084 GTTTGCAGCCGCGGAGCCCGGGG + Intronic
1085396268 11:76208664-76208686 GTGTCCAGCCTGGTCTCCCAGGG + Intronic
1088462038 11:110092831-110092853 TTTGCCAACCTCGGCTCCAGAGG + Intergenic
1089058322 11:115606022-115606044 ATTTTCATCCTCGCCTCCCGGGG - Intergenic
1090028216 11:123185547-123185569 GTTTCCGGCCTCCCCTCCCTGGG + Intronic
1091584484 12:1808252-1808274 GTTTCCAGCCCCTGCTCCAGAGG - Intronic
1093958645 12:25250440-25250462 GCCTCCAGCCGCGGCTCTCGGGG + Intronic
1094470359 12:30796533-30796555 GCTTCCAGCCCCGGCTCTGGTGG + Intergenic
1103987906 12:124779743-124779765 GTTTCCAGCCCCAGCCACCGGGG - Intronic
1104809704 12:131612731-131612753 CTCTGCAGCCTCGGCTGCCGTGG - Intergenic
1104989577 12:132618393-132618415 GGTTCCTGCCGCGGCTGCCGGGG - Intergenic
1112733674 13:102394643-102394665 GCTCCCAGCCTCGGCTCGCCGGG - Intronic
1113795581 13:113055891-113055913 CTCTCCAGCCTCGGCCCCCAGGG - Intronic
1113864650 13:113512956-113512978 CTTTCCAGTCTCGGCCCCTGGGG - Intronic
1121411102 14:93748775-93748797 GTTCTCAGGCTCGGCTCCTGAGG + Intronic
1121649076 14:95543678-95543700 GTTTCCACCCTCATCTCCCAAGG - Intronic
1122742721 14:103881343-103881365 GTTTGCAGCCTCAGCTTCCTGGG - Intergenic
1123020606 14:105396160-105396182 GTGTGCAGCCTCAGCTCCCTGGG + Exonic
1123666062 15:22610124-22610146 GATTCCAGCCTCGGTTCCACTGG - Intergenic
1124319885 15:28704537-28704559 GATTCCAGCCTCGGTTCCACTGG - Intronic
1124482626 15:30090893-30090915 GATTCCAGCCTCGGTTCCACTGG + Intronic
1124520951 15:30406325-30406347 GATTCCAGCCTCGGTTCCACTGG - Intronic
1124537711 15:30559894-30559916 GATTCCAGCCTCGGTTCCACTGG + Intronic
1124564130 15:30799391-30799413 GATTCCAGCCTCGGTTCCACTGG + Intergenic
1124754446 15:32395339-32395361 GATTCCAGCCTCGGTTCCACTGG - Intronic
1124760945 15:32447692-32447714 GATTCCAGCCTCGGTTCCACTGG - Intronic
1124777689 15:32601371-32601393 GATTCCAGCCTCGGTTCCACTGG + Intronic
1129653954 15:77510540-77510562 GTTTCCAGCCTGACCTCCTGGGG + Intergenic
1131393689 15:92069806-92069828 GTTCTCAGCCACAGCTCCCGGGG - Intronic
1132163677 15:99565445-99565467 GCTCCCGGCCTGGGCTCCCGGGG + Intronic
1132289082 15:100686698-100686720 GGTCCCAGCCTCGGCTCATGTGG - Intergenic
1132432772 15:101774323-101774345 GATTCCAGCCTCGGTTCCACTGG - Intergenic
1136494600 16:30634593-30634615 GTCTCCAGTCTCGGAACCCGCGG - Intergenic
1137249600 16:46732218-46732240 GCTGCCAGCCTCGGCGCCTGGGG + Exonic
1137731694 16:50694501-50694523 GCTTCCAGCCTCAGATCCCAGGG - Intronic
1138105809 16:54286696-54286718 CTTTCCAGCCTCTGCGCCCTGGG + Exonic
1144515451 17:15914595-15914617 GTCTACAGCCTCAGCTCCTGTGG + Intergenic
1145765616 17:27456606-27456628 GCTCCCAGCCTCGGCCGCCGCGG + Intergenic
1146379675 17:32319530-32319552 CCTTCCAGCCTTGGCTCCCCAGG - Intronic
1146393605 17:32444476-32444498 GTTTCCGGCGTCGGCGGCCGCGG + Exonic
1147019266 17:37518202-37518224 GTTTGCAGCGAAGGCTCCCGGGG + Exonic
1147248971 17:39141274-39141296 TTTTCCTGCCTTGGCTCCCAAGG + Intronic
1147909512 17:43847179-43847201 GTTCCCAGCGTCTGCTCCCACGG + Exonic
1148002502 17:44398029-44398051 CTTTCCAGCCTCAGCTGCCCTGG - Exonic
1150104847 17:62455147-62455169 TTCTCCTGCCTCGGCTCCCCCGG - Intergenic
1152476146 17:80519562-80519584 CTTTCCTGGCTCGGCTCCAGTGG - Intergenic
1152778452 17:82216035-82216057 CCTTCCAGCCTCGGCACCCTTGG + Intergenic
1153566839 18:6427321-6427343 GTTCCCAGCTTAGGCTCCCAAGG + Intergenic
1156687005 18:39662125-39662147 GTTTCCAGCCTTGCCTGCTGGGG - Intergenic
1160386430 18:78499769-78499791 GACTGCAGCCTCGGCACCCGTGG + Intergenic
1160702120 19:512709-512731 CCTGCAAGCCTCGGCTCCCGGGG + Intronic
1160753691 19:747235-747257 GTACCCACCCCCGGCTCCCGGGG - Exonic
1160913950 19:1487909-1487931 GGTGCCAGCCTCGGCACCTGGGG + Intronic
1161266735 19:3367601-3367623 CCTTCCAGCCCAGGCTCCCGGGG + Intronic
1161352535 19:3801921-3801943 GTTCCCATCCCTGGCTCCCGGGG - Intronic
1163320643 19:16572560-16572582 GCTTCCGGCCTCGGCTCCGCCGG - Intronic
1165243090 19:34482404-34482426 GTTTCCAGCCTCGGCTCCCGGGG + Exonic
1166339324 19:42128156-42128178 GACTCCAGCCTGGGCTCCTGAGG - Intronic
1166520196 19:43475069-43475091 GTTTCCAGCCCAGGCATCCGGGG - Intronic
1167445943 19:49537538-49537560 CTTTCCAGCCTGGGCAACCGAGG - Intronic
1168061812 19:53897347-53897369 TTTTCCTGCCTCGGCCCCCCAGG - Intronic
925368747 2:3328553-3328575 GGTGCCAGCCTGGGCTCCCCTGG + Intronic
926220535 2:10932975-10932997 GTGTCCAGCCTGGGGTCCCCAGG - Intergenic
927852738 2:26510455-26510477 GTTTCCACTCTGGGCTCTCGGGG - Intronic
927853348 2:26513434-26513456 GATTCCAGCCTGGGCTGCCCGGG + Intronic
931694067 2:64859252-64859274 ATTTCCAGCCTCCTCTCCCAGGG + Intergenic
931869633 2:66444643-66444665 GCTCCCAGCCTTGGCCCCCGCGG + Intronic
932417307 2:71581266-71581288 GATTCCACCCTCAGCTCCCCAGG + Intronic
935634420 2:105238732-105238754 GCTTCCAGTCTCGGCTCCACTGG + Intergenic
937220818 2:120342549-120342571 ATTTACACCCTTGGCTCCCGTGG + Intergenic
938698391 2:133854897-133854919 CTTTCCAGTCTCTGCTCCAGGGG - Intergenic
939612784 2:144331433-144331455 GTTTGCAGCCCCGGCTGCCGTGG - Intronic
943370410 2:187009293-187009315 GTTTCCAGCCTGTGGTCCTGTGG + Intergenic
944707687 2:202307846-202307868 GATACCAGCCTCGGGTCCCCAGG - Intergenic
1168737092 20:149837-149859 GATGCCAGCCACGGCTCCCTAGG - Intergenic
1168757501 20:326942-326964 GGTGCCAGCCTCGGCCTCCGAGG - Exonic
1168795018 20:605586-605608 ATTTCCAGCCTGGGCTCTCTTGG + Intronic
1169138014 20:3209438-3209460 GTTTCCGGCCAGGGGTCCCGGGG - Exonic
1171459829 20:25292233-25292255 GTGTCCAGCCTGGGCCCCTGTGG + Intronic
1175477799 20:59289080-59289102 GCTCCCAGCCTCTGCTCCCAAGG + Intergenic
1176044644 20:63086215-63086237 GTTTCCCGCCTCTGCTTCCAGGG - Intergenic
1176137501 20:63530611-63530633 CTGCCCAGCCTGGGCTCCCGAGG + Intronic
1176235071 20:64050119-64050141 GTTTCCAGCATGGGCGCCCCTGG - Intronic
1176298012 21:5084698-5084720 GCTCCCAGCCTCAGCTCCAGTGG + Intergenic
1176382679 21:6121033-6121055 GCTGCCAGCCGCGGCTGCCGAGG - Intronic
1178425368 21:32474728-32474750 GTGCCCACACTCGGCTCCCGAGG + Intronic
1179740790 21:43417206-43417228 GCTGCCAGCCGCGGCTGCCGAGG + Intronic
1179859017 21:44177251-44177273 GCTCCCAGCCTCAGCTCCAGTGG - Intergenic
1183958401 22:41396304-41396326 GTCTCCAGCCTGGGCTGCCGAGG + Exonic
1184515610 22:44960192-44960214 GGATCCAGCCTTGGGTCCCGTGG - Intronic
950549588 3:13658087-13658109 GTCTCCAGCCCCGGCTACCTGGG - Intergenic
952410798 3:33048207-33048229 CTTCCCAGCCTGGGCTCCCTCGG - Intronic
952714855 3:36470441-36470463 GATTCCAGCACCGGCTCCAGTGG + Intronic
960764263 3:121108535-121108557 GTTACCAGCCTTGCATCCCGGGG + Intronic
961664148 3:128486003-128486025 GTCTCCAGCCTCATCTTCCGCGG - Exonic
963483618 3:145906909-145906931 GTTTCCACTCTGGGCTCTCGGGG - Intergenic
963822154 3:149909381-149909403 GTTTCCAGCCTTAGCCCCTGGGG + Intronic
968111802 3:196054295-196054317 TTCTCCTGCCTCGGCTCCCCAGG - Intronic
969476304 4:7424351-7424373 GTCTCCAGCCTGGGCTCTCTGGG + Intronic
970194187 4:13539967-13539989 GTTTCCCGACTCGGGTCCAGCGG + Intergenic
970601029 4:17641222-17641244 GACTCCAGCCTCGGCTGGCGTGG - Intronic
980883576 4:138739038-138739060 TCTGCCAGCCTCGGCTCCCGAGG + Intergenic
981940918 4:150280787-150280809 GCTTCCTTCCTCGCCTCCCGAGG + Intronic
982288796 4:153759945-153759967 GCTCTCACCCTCGGCTCCCGAGG - Exonic
985995358 5:3594621-3594643 GGTACCAGTCCCGGCTCCCGGGG - Intergenic
990438734 5:55822055-55822077 GTGGCCAGCCCGGGCTCCCGGGG - Intergenic
991351333 5:65722596-65722618 CTTTCCCGCCTCCGCTCCCTCGG + Intronic
999600799 5:153262684-153262706 GTTTCCAGCTTCGGCTGCTAGGG - Intergenic
1001636028 5:173211116-173211138 ATTCCCAGCCTCAGCTCCCTGGG - Intergenic
1004989257 6:21118362-21118384 GTTTGCAGACTGGGCTCCCCAGG + Intronic
1007897242 6:45375577-45375599 GCTTCCAGCCTGGGCTGCAGAGG - Intronic
1007997250 6:46321543-46321565 GTTTCCAGCCTTGTCTCCATGGG - Intronic
1011195070 6:84772972-84772994 GATTCCTGCCCGGGCTCCCGCGG - Intergenic
1012052537 6:94362309-94362331 CTTCCCAGCCTGGGCCCCCGAGG + Intergenic
1013322653 6:109009672-109009694 GTTCCCAGCCTCCGCGCCGGAGG - Intronic
1013949653 6:115764523-115764545 GTTTTCAGCCTTGGCTTCCCTGG + Intergenic
1014255696 6:119158444-119158466 GCTTCCAGCCTCCCCTCCAGAGG + Intergenic
1016029780 6:139325415-139325437 GTTGCCAGCCTCTGCTTCTGTGG + Intergenic
1018702141 6:166435807-166435829 GTCTGCAGGCTCAGCTCCCGTGG + Intronic
1018845679 6:167553618-167553640 GTCTCCAGCCACAGCTCCCACGG + Intergenic
1022837432 7:34131284-34131306 CTTTGCAGCCTTGGCTGCCGAGG - Intronic
1024919450 7:54542500-54542522 GATTCCAGCCTGGGCTCCGCAGG + Exonic
1027669084 7:81073780-81073802 GTTTCCATCCTCAGCTCCCAGGG + Intergenic
1029291337 7:99504514-99504536 CCTTCCAGCCTTGGCTCCCGAGG + Intergenic
1030750557 7:113227055-113227077 GATTCCAGCCTCGGCTCAAAGGG + Intergenic
1032447418 7:131996537-131996559 TCTTCCAGCCTCGGCTCCTCTGG + Intergenic
1033414548 7:141150547-141150569 GTTTCAAGCCCAGGCTCCAGAGG + Intronic
1034450234 7:151133363-151133385 GCTTCCAGCCTCTCCTCCAGAGG - Intronic
1035284132 7:157795419-157795441 GTTCCCAGCCTCAGCCCCCTGGG - Intronic
1041192350 8:55366445-55366467 GTTGCCAGACTCGGCTGCCTGGG - Intronic
1043769957 8:84184912-84184934 GTCTCCAGCTCCGGCTCGCGTGG - Exonic
1052996163 9:34552569-34552591 GCCTCCAGCCTCTGCTCCCGGGG - Intronic
1059269712 9:113064232-113064254 GTTTCCAACCTCTGCCCCCAGGG - Intergenic
1059270846 9:113069680-113069702 GTTTCCAACCTCTGCCCCCAGGG - Intergenic
1059273114 9:113080568-113080590 GTTTCCAACCTCTGCCCCCAGGG - Intergenic
1059274250 9:113086014-113086036 GTTTCCAACCTCTGCCCCCAGGG - Intergenic
1185463272 X:341991-342013 GCATCCAGTCTCGGCTCCGGGGG - Intronic
1195129489 X:101839424-101839446 CTTTCCTGCCTCGGTCCCCGGGG - Intronic
1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG + Intergenic
1200047848 X:153411957-153411979 GTTTCCAGCCACCGGTCCCGAGG + Intergenic