ID: 1165243092

View in Genome Browser
Species Human (GRCh38)
Location 19:34482409-34482431
Sequence CAGCCTCGGCTCCCGGGGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 306}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243074_1165243092 30 Left 1165243074 19:34482356-34482378 CCGCGTCCCGGTCCCGGGCCGCC 0: 1
1: 0
2: 5
3: 29
4: 341
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243077_1165243092 23 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243085_1165243092 -8 Left 1165243085 19:34482394-34482416 CCGCTCCAGCGTTTCCAGCCTCG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243076_1165243092 24 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243082_1165243092 12 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243084_1165243092 -7 Left 1165243084 19:34482393-34482415 CCCGCTCCAGCGTTTCCAGCCTC 0: 1
1: 0
2: 3
3: 25
4: 336
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243083_1165243092 9 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243081_1165243092 17 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306
1165243080_1165243092 18 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243092 Original CRISPR CAGCCTCGGCTCCCGGGGCT CGG Exonic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900206871 1:1435382-1435404 CCTGCTCGGCTCCCGCGGCTGGG + Intronic
900309776 1:2028095-2028117 CTGCCAGGGCTCCCGGGGCAGGG + Intronic
900364151 1:2303977-2303999 CAGCTTCCGCTTCCGAGGCTGGG - Exonic
900394176 1:2446385-2446407 TAGCCAGGTCTCCCGGGGCTGGG + Intronic
900619491 1:3580372-3580394 GAGCCTCCCCTCCCGGGGCTGGG - Intronic
900625557 1:3607044-3607066 CAGCTTGGGCCTCCGGGGCTTGG + Intronic
900691322 1:3982234-3982256 CAGCCTGGTCTCCTGGCGCTCGG - Intergenic
900977485 1:6026506-6026528 CAGCCTCAGCTCCCTGAGCAGGG + Intronic
901231174 1:7642386-7642408 CAGCCCCGGCTCCCAGAGCCAGG - Intronic
901303729 1:8217559-8217581 CAGACTCGGGTTCCGGGGCTGGG - Intergenic
901808957 1:11755085-11755107 CAGCCTCGGAGGCTGGGGCTGGG - Intergenic
903212164 1:21824407-21824429 CAGCCTCTGCTCTCCAGGCTGGG - Exonic
903521963 1:23957754-23957776 CAGCCTCTACTTCCTGGGCTCGG + Intergenic
903672871 1:25046788-25046810 CCGCCTCGGCTCCTGGGCCAAGG + Intergenic
904728939 1:32573511-32573533 CAGCCTCGACTTCCTGGGCTCGG + Intronic
905789957 1:40784448-40784470 AAGCCTGGCCTCCCGGGGCACGG + Intronic
907237758 1:53063177-53063199 CAGCCTCGGGGGCTGGGGCTAGG + Intronic
907357658 1:53889704-53889726 CAGCCTCACCTCGCGGGGTTAGG + Exonic
907401934 1:54229660-54229682 CAGCCACGAGTCACGGGGCTGGG + Intronic
911904346 1:103548025-103548047 CAGCCACAGCTGCCGTGGCTGGG + Intronic
914392402 1:147234200-147234222 CAGCGTGGGCTCCCAGAGCTCGG + Intronic
914919713 1:151838808-151838830 CCGCCTCGGCTCCCGGACCCGGG - Exonic
915530713 1:156500778-156500800 CGGCCTCGACTCCCGGGGGCTGG - Exonic
917725528 1:177824039-177824061 CAGCCTCGGCTACCCGGACAGGG + Intergenic
920651155 1:207838393-207838415 GGGTCTCTGCTCCCGGGGCTTGG + Intergenic
922972007 1:229750178-229750200 CAGCCTGGGCTGCTGGAGCTTGG - Intergenic
923125680 1:231032767-231032789 CAGCCTAGGCTCTCCTGGCTGGG + Intronic
924384246 1:243487726-243487748 AAGCCCCGCCTCCCCGGGCTTGG - Intronic
924415360 1:243850894-243850916 GAGCCTCCGCTCCCGGGCCTCGG - Intronic
924529288 1:244879865-244879887 CAGCCTTGGCTTCCTGGGCTCGG + Intergenic
1063084121 10:2799717-2799739 GAGCCTCTGCTCCCCGGACTTGG - Intergenic
1064059981 10:12129496-12129518 CAGCCCCGCCTCCCGGGTCCCGG + Intergenic
1065605632 10:27414399-27414421 CAGCCTCCGCTTCCGGAGCGCGG - Intergenic
1066621875 10:37363830-37363852 CAGCCTCAGCTCCTGTAGCTGGG - Intronic
1066653653 10:37681010-37681032 CAGTCCTGGCTCCCGGGGCCTGG - Intergenic
1069562623 10:69441541-69441563 CAGGCTGGGGTCCCAGGGCTGGG - Intergenic
1069590930 10:69641425-69641447 CACCCTCTGCACCCTGGGCTGGG - Intergenic
1070784797 10:79156598-79156620 CAGGCTGGGCTTCCAGGGCTGGG + Intronic
1071275763 10:84053578-84053600 CAGGCTGGGCTCCCGAGTCTGGG + Intergenic
1071335058 10:84593756-84593778 CAGGCGGGGCTCCCGGGGCCTGG - Intergenic
1071546984 10:86536573-86536595 CCGCCGCGGCTCCCGGGTCCCGG - Intergenic
1073448841 10:103597487-103597509 CTGCCTCTGCTCCAGGGACTGGG + Exonic
1075107651 10:119552403-119552425 CAGTCCCGGCTCCTGGGGCGGGG + Intergenic
1076035506 10:127196138-127196160 AAGCCTCGGCTCCGGGGACTTGG + Exonic
1076880611 10:133237596-133237618 CAGCCTCGGCCCGCGGGGTGGGG + Exonic
1077140857 11:1024264-1024286 CAGCATCGGCTCCGGGAGCGTGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077443335 11:2578757-2578779 CAGGCTGGGCTCTCGAGGCTGGG + Intronic
1077615338 11:3670001-3670023 CACCCTCCACTCCCAGGGCTGGG + Intronic
1079163351 11:18013700-18013722 CAGCCTCGGCGCTCCGGGCACGG + Intergenic
1079353695 11:19713679-19713701 CGGCATCTTCTCCCGGGGCTTGG - Exonic
1080644964 11:34181687-34181709 CAGGCCCGGCTCCCAGGGCTGGG + Intronic
1080899905 11:36479932-36479954 CAGCCTCGCCTCTCAGGGCCTGG - Intergenic
1081837447 11:46167802-46167824 CAGCCAGGCCTCCAGGGGCTTGG + Intergenic
1081997625 11:47375573-47375595 CAGCCTGGGCTCCTGGGGTCTGG - Intronic
1083430765 11:62612684-62612706 CGCTCTCGGCTCCCGGGGGTGGG + Exonic
1083572523 11:63768280-63768302 CGGGGTCGGCTCGCGGGGCTCGG - Intronic
1083684907 11:64370173-64370195 CAGCCTCGGCACCCCAGCCTGGG + Intronic
1083902916 11:65652433-65652455 CAGCCTGGGCTGCAGGGCCTTGG + Intergenic
1084010733 11:66347021-66347043 CTCCCCCGGCTCCCGGGGGTCGG + Exonic
1085175130 11:74479506-74479528 CAGCCTTGACTTCCTGGGCTCGG - Intergenic
1085395705 11:76206215-76206237 CAGCTTAGGCTCCCGGGTCTTGG + Intronic
1085520139 11:77132921-77132943 GCGGGTCGGCTCCCGGGGCTCGG + Intronic
1085663145 11:78388405-78388427 CAGCCTCAACTTCCTGGGCTTGG + Intronic
1086927077 11:92652190-92652212 AAGCCTCTGCTCCCAGGCCTTGG + Intronic
1089431301 11:118426924-118426946 CCGCCTCGGCTTCCTCGGCTGGG + Intronic
1089543718 11:119206456-119206478 CGGCAGCGGCTCCGGGGGCTCGG + Exonic
1090174164 11:124632973-124632995 CAGCCTGGGTTGCAGGGGCTGGG - Exonic
1092607593 12:10137128-10137150 CAGTCTGGGCTTCCGGAGCTCGG + Intergenic
1094031900 12:26021757-26021779 CAGCCACTGCTCTGGGGGCTGGG - Intronic
1100611809 12:96196185-96196207 CAGCCTGGGAGCCCGGCGCTGGG + Intronic
1103547098 12:121710118-121710140 TAGCATGGGCTCCCAGGGCTCGG - Intergenic
1103737441 12:123069613-123069635 CTGACTCGGCCCACGGGGCTTGG - Intronic
1103864633 12:124042198-124042220 ACGCCACAGCTCCCGGGGCTGGG + Intronic
1103981008 12:124736859-124736881 CAGCCACTGCTCCAGGGACTGGG + Intergenic
1104221325 12:126787449-126787471 CAGCCCCTGCTCCCAGAGCTCGG - Intergenic
1106379531 13:29223148-29223170 CAGCCTGGGCCCCCAGGCCTTGG - Intronic
1112507266 13:99982430-99982452 CAGCCGCGGCTTCGGGGACTCGG + Exonic
1113485077 13:110647182-110647204 CAGCAGCTGCTCCTGGGGCTGGG - Exonic
1113522124 13:110948715-110948737 CTGGCTCTGCTCCTGGGGCTAGG - Intergenic
1113767750 13:112891570-112891592 CAGCCTCGGCACACGTGTCTGGG - Intergenic
1113796167 13:113059994-113060016 CAGACTCCGCCTCCGGGGCTGGG - Intronic
1114634991 14:24182337-24182359 CAGCCGCGGCTGCCAGGGCAGGG + Exonic
1114659301 14:24334659-24334681 CAGCCCCGGGGCTCGGGGCTGGG - Exonic
1115360309 14:32493285-32493307 CAGCCTTGACTTCCAGGGCTTGG + Intronic
1115398957 14:32938035-32938057 CCGACTCGGGTCCCGGGACTTGG - Intronic
1115485608 14:33908693-33908715 CAGCCTCAGCTCCCAGAGTTTGG - Intergenic
1115648636 14:35387406-35387428 CAGCCTCAGATCCCGCGGATTGG + Intergenic
1116065697 14:39979986-39980008 CAGGCTCTGCTTCTGGGGCTGGG + Intergenic
1117392056 14:55271631-55271653 CTGCCTGCGCTCCCGGGGCGCGG + Intronic
1117910937 14:60637742-60637764 CGGCCTCTGCTCTAGGGGCTTGG - Intergenic
1118011702 14:61616409-61616431 CAGCCTGGGCTCCAGGAGCCTGG + Intronic
1118185576 14:63534698-63534720 CAGCCTCAGCCTCCTGGGCTCGG + Intronic
1118808873 14:69259860-69259882 CAGCCTCGGCTCCCACCGCTAGG - Intronic
1120969511 14:90195624-90195646 CAGCCTTGACTTCCTGGGCTTGG - Intergenic
1121307684 14:92917290-92917312 CAGCCTCGGTGTCCAGGGCTTGG + Intergenic
1122072308 14:99212708-99212730 CAGCTTCAGCTCCTGGGGGTGGG - Intronic
1122306750 14:100771306-100771328 CAGCCTGGGCCCCTGGGCCTTGG - Intergenic
1122445816 14:101767804-101767826 CAGCCTCAGCTCCCGAGCTTTGG + Intronic
1122854890 14:104555259-104555281 CAGCCTGGGCTCCCTGGGCCTGG - Intronic
1123036614 14:105474416-105474438 CAGCCTGGGCGCCCAGGGCCGGG + Intronic
1124371355 15:29106482-29106504 CAGCCTTGGATCCCAGGGCAGGG + Intronic
1125524422 15:40366013-40366035 CAGTCTCAGCTCCCTGGGCCAGG - Intronic
1126024756 15:44435142-44435164 CTGCCTCAGCCCCCGTGGCTGGG - Intronic
1127772638 15:62243684-62243706 CAGCCTCAGCCCCAGGGACTGGG - Intergenic
1128064080 15:64753730-64753752 CAGCCTCTGTGCCCGGGGTTGGG + Intronic
1128633427 15:69287576-69287598 CAGGCTCAGCTCCAGGGTCTGGG + Intergenic
1129150257 15:73684142-73684164 AACCCTCGGCTCCCGGAGCAGGG - Intronic
1129220513 15:74129275-74129297 CAGCCTCGGAACCCCGGGCCGGG + Exonic
1129237913 15:74234749-74234771 CTGCCTCAGTCCCCGGGGCTCGG - Intergenic
1129701864 15:77772898-77772920 CAGCTTCGGCTCTGGGGACTGGG + Intronic
1131092588 15:89633606-89633628 CTGCCTGGGCTCCCCTGGCTGGG + Intronic
1131177563 15:90219682-90219704 CGGCCTCTGCTCCCAGGACTGGG - Intronic
1132163681 15:99565450-99565472 CGGCCTGGGCTCCCGGGGGCTGG + Intronic
1132750335 16:1454690-1454712 CACCCTCAGCACCCGGGGCGGGG + Intronic
1132765890 16:1534018-1534040 CACCCTCTGCTCCCTGGGATGGG + Exonic
1132858003 16:2056016-2056038 CAGCCACTGCTCTCGGTGCTGGG - Intronic
1133070735 16:3245205-3245227 CAGGCTCAGCTTCCTGGGCTCGG - Intronic
1133270405 16:4608544-4608566 CGGTCTCGGCTCCAGTGGCTGGG - Intergenic
1133784602 16:8964126-8964148 CCGCCTCGGCCCCCAGGGCCCGG - Intronic
1134849814 16:17470667-17470689 CAGCCTCGACTCCGGGGCCGGGG - Exonic
1135224223 16:20641614-20641636 TAGCATGGGCTCCCAGGGCTCGG + Intronic
1138595221 16:58026076-58026098 CAGCCTCGGCGCCCAGCGCCTGG - Exonic
1139787867 16:69408459-69408481 CAGCTTCTTCTCCTGGGGCTGGG - Intronic
1140048953 16:71462411-71462433 CAGCTTCACCTCCCCGGGCTGGG - Intronic
1140051384 16:71484451-71484473 CAGCCTCCGCTCCCCGGTCCCGG + Intronic
1141149112 16:81552015-81552037 CAGCCTCGGCGGCAGGGGCAGGG + Intronic
1141603176 16:85138383-85138405 CAGCCTCCCCTCCCGGGCTTAGG + Intergenic
1141605934 16:85153210-85153232 CAGCCTCGACTTCCCTGGCTCGG - Intergenic
1141852545 16:86657273-86657295 CAGCCTCAGCCTCCTGGGCTCGG + Intergenic
1141993071 16:87621367-87621389 CAGCCGCGGATCCCAGGTCTGGG - Intronic
1142175576 16:88643512-88643534 CTGCGGCCGCTCCCGGGGCTTGG + Exonic
1142353406 16:89590019-89590041 CAGCCAGGGCTCCCTGGGCCAGG - Intronic
1142589683 17:997254-997276 CAGCCCCGGCTCCTGGAGCCTGG + Exonic
1143063330 17:4222120-4222142 CAGCCACGCCTCCCGGCGCCTGG - Intronic
1143352093 17:6296531-6296553 CAGCCTCGGGACACAGGGCTTGG - Intergenic
1143512811 17:7405436-7405458 CGGCCCCGCCCCCCGGGGCTGGG + Intronic
1144548019 17:16215551-16215573 TAGCCGCGGCTCCGCGGGCTGGG - Intronic
1144568330 17:16379090-16379112 CAGCCTCGCCTCTCTGGGCCTGG + Intergenic
1144738175 17:17566500-17566522 CAACCTCAGTTCCCGGGGCTAGG + Intronic
1144963543 17:19060867-19060889 CAGCCTTGACCCCCAGGGCTCGG - Intergenic
1144964147 17:19065173-19065195 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1144971616 17:19113659-19113681 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1144983819 17:19186971-19186993 CAGCCTTGACCCCCAGGGCTCGG - Intergenic
1144984406 17:19191268-19191290 CAGCCTTGACCCCCAGGGCTCGG + Intergenic
1145094159 17:20009826-20009848 CGGCCCCGGCTCCTGGGTCTCGG + Intronic
1146009370 17:29181001-29181023 CAGCCATGGCTCCCGGGCCCTGG - Intergenic
1146956256 17:36937924-36937946 CCGCCTGAGCTCCCGGGGCGAGG - Exonic
1146971462 17:37076042-37076064 CAGCCTCAGCCTCCAGGGCTTGG + Intergenic
1147699589 17:42384633-42384655 CAGCCTTAACCCCCGGGGCTTGG + Intronic
1148566102 17:48633889-48633911 CAGCCCCAGCCCCCGGGACTTGG + Intergenic
1148848443 17:50542209-50542231 CCGCCTCCGGACCCGGGGCTGGG + Exonic
1150168536 17:62966812-62966834 CAGCCTCGGCTCCGGGGAGAGGG + Intergenic
1151205370 17:72502531-72502553 CAGGCTCAGCTCCCTGTGCTGGG - Intergenic
1151260037 17:72908915-72908937 CAGGCTTGGCTCCCGTGCCTTGG - Intronic
1151370787 17:73645044-73645066 CAGCCCCGGCTCCGGGGACGCGG + Intergenic
1151780256 17:76240616-76240638 CAGCCGCGGCTCCCCGCGCGAGG - Intergenic
1152419468 17:80184352-80184374 CAGCCAAGGCTCTCGGGGCAGGG - Intronic
1152640277 17:81446441-81446463 CAACCCTGGCTGCCGGGGCTGGG - Intronic
1152660990 17:81541846-81541868 CAGCACTGGCTCCCTGGGCTTGG + Intronic
1152678963 17:81655950-81655972 CAGCCTCTGTCCCCGGGACTGGG + Intronic
1152744393 17:82032197-82032219 CAGGCCGGGCTCCGGGGGCTGGG - Intronic
1152913418 17:83018897-83018919 CAGCCAGGGCTCACGGGGCCAGG + Intronic
1153571582 18:6478395-6478417 GAGCCTCTGCTTCTGGGGCTGGG + Intergenic
1154070813 18:11149709-11149731 CACCCGCGGCTCCCGCGCCTGGG + Intergenic
1155461528 18:26090101-26090123 CAGCCGCGGCACGCGGGGCGGGG + Intronic
1160846312 19:1167704-1167726 CACCCACGGCTCCAGGGGGTGGG + Intronic
1161013166 19:1969850-1969872 CAGCCACGGCATCCGGAGCTCGG + Exonic
1161076979 19:2290535-2290557 CAGCCGCCGCTCCCGGATCTTGG + Exonic
1161401399 19:4067400-4067422 CGGCCTGGGCTGCCGGGGGTGGG + Intergenic
1161484827 19:4529831-4529853 CAGCCTCGCCTGCAGGGGCCTGG - Exonic
1162127512 19:8507303-8507325 CAGCCTCAGCTGACGTGGCTTGG - Intergenic
1162524101 19:11197547-11197569 CAGCCTGGGCGCCCGGCCCTCGG + Exonic
1162698626 19:12496590-12496612 CAGCCTCGACCTCCAGGGCTTGG - Intronic
1163368466 19:16889106-16889128 CCGCCTCGGCTCCAGAAGCTGGG + Exonic
1163704708 19:18805439-18805461 CAGCCTCGACCCCCTGGGCTTGG + Intergenic
1165157221 19:33796043-33796065 CCGCCGCGGCGCCCGGGGCTGGG - Intronic
1165243092 19:34482409-34482431 CAGCCTCGGCTCCCGGGGCTCGG + Exonic
1165840449 19:38786205-38786227 CAGCCTTGGCCTCCTGGGCTTGG - Intergenic
1166378819 19:42343989-42344011 CAGCGTCTGCTCCCGGGACCCGG + Exonic
1168490121 19:56802192-56802214 CAGCCTGGGCTCCTGGGGGATGG - Intronic
925509994 2:4614857-4614879 CAGCCTCGACCTCCTGGGCTCGG - Intergenic
926008166 2:9388813-9388835 CCAACTGGGCTCCCGGGGCTGGG + Intronic
928177448 2:29044485-29044507 CATCCTGGGTTCCCGGGACTCGG + Intronic
930730413 2:54723610-54723632 CAGCCGGGGCTCCGGGGGCGGGG - Intronic
931321463 2:61177659-61177681 CAGCCCCGGCTCCCGCGGCCCGG - Exonic
934573067 2:95384296-95384318 CAGCCTCGCCTCGCTGGCCTGGG - Exonic
934706174 2:96483132-96483154 CAGCCTCGCCTCCTGGCCCTGGG + Intergenic
934766838 2:96884455-96884477 CAGGCTGGGCCCCCGGGGCACGG + Intronic
938369818 2:130762135-130762157 CAGCCACGGCTGCTGGGTCTGGG - Exonic
938379197 2:130827178-130827200 CAGCCCCTGCTCCAGGAGCTGGG + Intergenic
941956768 2:171213280-171213302 CAGCCTCGACCTCCTGGGCTCGG + Intronic
942461377 2:176171108-176171130 CAGCCTCTGCTGCCAGGGGTGGG - Intronic
943072229 2:183154075-183154097 CAGCCACGGCTGCAGGGGCTGGG + Intronic
944229821 2:197381244-197381266 CAGCCTCGACCTCCTGGGCTTGG - Intergenic
944414678 2:199469690-199469712 CAGCCTAGGCGCCCCGGGCTTGG + Intronic
945891550 2:215436071-215436093 AAGCCCCGGCTCCCGGCGCTCGG - Exonic
947613308 2:231537381-231537403 CAGCCTTGACTTCCTGGGCTTGG - Intergenic
947732044 2:232436708-232436730 CAGCCTGGGCTGCAGGGGCCTGG + Intergenic
947915337 2:233828801-233828823 CACCCTCAGCTCCCGGGACCTGG - Intronic
948329224 2:237151775-237151797 GAGCCTCGGGCCCTGGGGCTGGG - Intergenic
948721540 2:239904017-239904039 CAGCCTGGGCTCCCTGGGATGGG - Intronic
1170889956 20:20368389-20368411 CGGGCTCGGCGCCGGGGGCTCGG - Exonic
1175258940 20:57662994-57663016 CAGGCTCGGCCCCAGGGGCAGGG + Intronic
1175378977 20:58549462-58549484 CTGCCGGGGCTCCCGGGGCATGG + Intergenic
1175429463 20:58891481-58891503 CGGCCTCGGCTCGAGGGGCGGGG + Intronic
1175927078 20:62476142-62476164 CAGGCCCTGCTCGCGGGGCTTGG + Intergenic
1175935555 20:62512258-62512280 CAGCCTCGGCTCACTCTGCTCGG - Intergenic
1176035390 20:63033873-63033895 AAGCCTGGGGTCACGGGGCTGGG + Intergenic
1176137505 20:63530616-63530638 CAGCCTGGGCTCCCGAGGGCAGG + Intronic
1176374421 21:6080121-6080143 CAGCCTCTGCCCCTGGGTCTGGG - Intergenic
1176417138 21:6483018-6483040 CAGCCTCGGCTTACCAGGCTTGG + Intergenic
1179670285 21:42942103-42942125 CAACCTCCGCTTCCTGGGCTGGG - Intergenic
1179692635 21:43091351-43091373 CAGCCTCGGCTTACCAGGCTTGG + Intergenic
1179749055 21:43458124-43458146 CAGCCTCTGCCCCTGGGTCTGGG + Intergenic
1179882730 21:44300266-44300288 GAGACCCGGGTCCCGGGGCTCGG - Intronic
1179921651 21:44510685-44510707 CAGCCCAGGCTCTCCGGGCTCGG - Intronic
1180055392 21:45356383-45356405 CATCCTGAGCTGCCGGGGCTGGG + Intergenic
1180614633 22:17119591-17119613 CTTCCTCGGCTGCCGGGGCCTGG - Exonic
1180620471 22:17158734-17158756 CAGGCGCGGCTCCCGGCGCGCGG + Intronic
1181000841 22:19987147-19987169 CAGGCTCGGCTCCGGCGCCTCGG + Intronic
1181573663 22:23781046-23781068 CAGCCTGGGGGCCCAGGGCTGGG - Exonic
1181590582 22:23882669-23882691 CACCCTGGGCCCCGGGGGCTTGG + Intronic
1181966331 22:26658679-26658701 CAGCCTCGGATCCGGAGCCTGGG - Intergenic
1182631510 22:31689643-31689665 CAGCCTCAACTTCCTGGGCTGGG + Intronic
1183488209 22:38101464-38101486 CAGCCTAGACTTCCTGGGCTCGG - Intronic
1184311105 22:43643539-43643561 CAGCCTTGGCTGCCAGAGCTGGG - Intronic
1184471914 22:44701202-44701224 CAGCCACAGCTCCAGGAGCTGGG - Intronic
1184478495 22:44734463-44734485 CAGCCTCATCTCCCGGGCCTTGG + Intronic
1184479620 22:44738862-44738884 CAGCCTCGGGACCCAGGCCTGGG + Intronic
1184518223 22:44976088-44976110 CAGCCTCAGCCTCCTGGGCTCGG - Intronic
1184561469 22:45265811-45265833 CAGCCTCGACCTCCAGGGCTCGG - Intergenic
1184593883 22:45502879-45502901 CAGCGTTGGCTGCCGAGGCTCGG + Exonic
1184643280 22:45883305-45883327 CTGGCTCGTCTCCCGGGCCTCGG - Intergenic
1184674277 22:46032078-46032100 CAGCCTCCTCCCCCGGGGCTGGG - Intergenic
1185236673 22:49717706-49717728 CAGCCTCGGCCTCCAGGGATGGG - Intergenic
1185278711 22:49960900-49960922 CGGCTTCGGCGCCTGGGGCTCGG + Exonic
949487158 3:4550803-4550825 CAGCCTCTACTTCCTGGGCTTGG - Intronic
950535184 3:13574461-13574483 CATGCCCGGCTCCCTGGGCTGGG - Intronic
952787580 3:37170991-37171013 CAGCCTCGACTTCCTGGGCTCGG - Intronic
954213268 3:49110195-49110217 CAGCCTCAGCTGCAGGGCCTAGG + Exonic
954761562 3:52878367-52878389 CCACCTCTGCTCCCGGGCCTAGG + Intronic
956777372 3:72576600-72576622 CAGCCTCGAATTCCTGGGCTCGG - Intergenic
958908084 3:99963690-99963712 CAGCCTCGCCTCCAGGGTCCTGG + Intronic
960663464 3:120086712-120086734 CAGCCTCTGCCTCCTGGGCTCGG - Intronic
961018247 3:123483378-123483400 CAGCCTGGGCTCCAGGAGGTGGG + Intergenic
961425214 3:126839964-126839986 CTGCCTCGGCCCCCAGGTCTTGG + Intronic
962399758 3:135048348-135048370 CAGCCTCGACCTCCTGGGCTTGG + Intronic
966696427 3:182793976-182793998 CAGCCTCGGCGGCCCGGGCTTGG - Intronic
966974198 3:185070581-185070603 CAGACTTGGCCCCAGGGGCTGGG + Intergenic
967270478 3:187728564-187728586 CAGCCTCAGCACCTGGGGCAGGG + Intronic
968286728 3:197513246-197513268 CCGCCTCGGCTTCCCGGGCTGGG - Intronic
968455017 4:693252-693274 CAGCCTGTGCACCCGGGTCTGGG - Intergenic
968484453 4:852236-852258 CTGCCTTGGCTCCTGGGGGTGGG - Intronic
968571820 4:1346312-1346334 CCGACTGGGCTCCCGGGGCTGGG - Intergenic
969297281 4:6277578-6277600 CAGCCTGGGGTCCGGGTGCTCGG - Exonic
972533136 4:39977846-39977868 AGGCCCCGGCTCCCGGGGCACGG - Exonic
974032454 4:56788042-56788064 CAGCCTCAGCCTCCTGGGCTCGG + Intergenic
978619232 4:110622506-110622528 CAGCGGCGGCTACGGGGGCTCGG - Exonic
980004711 4:127528497-127528519 CGGCCTGGGCTCCCTGTGCTTGG + Intergenic
981449584 4:144880810-144880832 CAGCCTCGGCTCACAGGACTTGG - Intergenic
982618930 4:157678679-157678701 CAGCATGGGCACCCTGGGCTTGG + Intergenic
984689235 4:182706871-182706893 CAGCCTCAACTTCCCGGGCTTGG - Intronic
986105534 5:4656054-4656076 CAGCCCTGGCTGCAGGGGCTGGG + Intergenic
986227336 5:5828217-5828239 CAGCATCCTCTCCCGAGGCTTGG - Intergenic
988238373 5:28575672-28575694 CAGCCTCTGCTGCCCAGGCTGGG + Intergenic
991057378 5:62334896-62334918 CCGCCTCGGCCCACTGGGCTTGG + Intronic
992031384 5:72725024-72725046 CAGCCTTGACTTCCCGGGCTCGG + Intergenic
992629827 5:78669348-78669370 CAGCCTTGGCCTCCTGGGCTCGG - Intronic
994175116 5:96702716-96702738 CATCCCGGGCTCCCGGGGCGGGG + Intronic
997475178 5:134138588-134138610 GAGCCTTGGCTCCCCAGGCTGGG + Intronic
998478456 5:142441339-142441361 CAGCCCTGGCTCCCTGGGCCTGG - Intergenic
1001572157 5:172736930-172736952 GAGCCTTGGCTCAGGGGGCTGGG + Intergenic
1002915315 6:1524080-1524102 CAGGCTGGGCTTCCGGAGCTCGG - Intergenic
1002939164 6:1700769-1700791 CAGCCTCAGGTCCCAGTGCTGGG - Intronic
1003170642 6:3719479-3719501 CACCCTTGGCTGCAGGGGCTTGG - Intergenic
1003873695 6:10419755-10419777 CAGCTTCGGTTCCCGGGCCAGGG - Intergenic
1004193990 6:13487749-13487771 CGGGCTGGGCTCCCGGGGCCCGG - Intergenic
1005826299 6:29633216-29633238 CCGGGGCGGCTCCCGGGGCTCGG - Intronic
1005899536 6:30205759-30205781 CAGCCTCAACTTCCCGGGCTCGG - Intronic
1006334842 6:33415095-33415117 CTCCCTCTGCTCCTGGGGCTCGG - Exonic
1006416064 6:33904574-33904596 CAGCCACCCCTCCCGGGGCTTGG + Intergenic
1006751256 6:36379132-36379154 CAGCCAGGGCTTCCGCGGCTAGG + Intronic
1007553480 6:42747031-42747053 GAGCCACGGAGCCCGGGGCTAGG - Intronic
1013632042 6:111995430-111995452 CAGCCTCAGTTCTAGGGGCTGGG + Intergenic
1017163854 6:151390525-151390547 CAGCCCCGGCGCCGGGGGCGGGG + Intronic
1017811878 6:157989678-157989700 CAGCCTCTGCTCCCAGTGCTGGG - Intronic
1018682012 6:166272125-166272147 CAGCCTGCGCTCCAAGGGCTGGG + Intergenic
1018742734 6:166743131-166743153 TGGCCTCGGCTCCAGGGTCTTGG - Intronic
1018987425 6:168648490-168648512 CGGCCTCGGCTCCCTGGGAGGGG - Intronic
1019475157 7:1241013-1241035 CATCCTCGGCCCGCGGGGCAGGG - Intergenic
1020105570 7:5420913-5420935 CAGACTCGGCTCCCAGGGCTGGG - Intronic
1020133069 7:5570334-5570356 CATCCGCGCCTCCAGGGGCTAGG - Intergenic
1020257664 7:6510926-6510948 CAGCCTCCGGTCCCAGGGCCTGG - Exonic
1020936575 7:14473190-14473212 CAGCATGGGCACCCTGGGCTTGG - Intronic
1022397188 7:29999916-29999938 CAGCCACGGCTGCAGTGGCTGGG + Intergenic
1026869181 7:73840435-73840457 CAGCCTCTGCACCCTGGGCCAGG - Exonic
1031965690 7:128026753-128026775 CAGCCTCAGCTCCTGGGACCTGG - Intronic
1032027629 7:128456087-128456109 CAGCCTCGCGTTCCAGGGCTGGG + Intronic
1035236932 7:157503400-157503422 CAGCCTCTGCTCCTGGAGATGGG - Intergenic
1035397870 7:158546895-158546917 CAGCCTGGGCACCTGGGGCAGGG + Intronic
1036482481 8:9151066-9151088 CAGCCGCAGCTCCCGGGTCACGG + Intronic
1036485071 8:9172035-9172057 CAACCAGAGCTCCCGGGGCTGGG - Intergenic
1036567964 8:9954126-9954148 CAGCCTCGACCTCCTGGGCTTGG + Intergenic
1039553082 8:38457314-38457336 CAGCCTGGACTCCTGGGCCTTGG - Intronic
1040567576 8:48581639-48581661 CAGCCCGGGCTCCGGGCGCTTGG + Intergenic
1040596820 8:48846741-48846763 CAGCCTCTGCTCCAGGCCCTGGG - Intergenic
1042875738 8:73438595-73438617 CAGCTTCCACTCCCTGGGCTTGG - Intronic
1042962934 8:74321681-74321703 AAGCGGCGGCTCCCGGGGCTGGG - Intronic
1045975747 8:108128854-108128876 CAGCCTCGACCTCCTGGGCTCGG - Intergenic
1049062715 8:140288260-140288282 CAGCCTCAGCCTCCTGGGCTCGG - Intronic
1049329724 8:142043746-142043768 ACACCCCGGCTCCCGGGGCTTGG - Intergenic
1049391129 8:142372268-142372290 CAGCCTCAGCTCCTGGGACCTGG + Intronic
1049756234 8:144312361-144312383 CAACCTCGGAGCTCGGGGCTGGG + Intronic
1052192681 9:25677706-25677728 CGGCCTCCGCTCCCGGGACTCGG - Exonic
1057808960 9:98242891-98242913 CAGCCTTGACTTCCTGGGCTTGG + Intronic
1059412463 9:114141151-114141173 AAGCCTCTACTCCCGGAGCTTGG - Intergenic
1060549377 9:124477816-124477838 CAGCCGCGGCGCCCGCGGGTGGG - Intronic
1060731495 9:126039702-126039724 CAGCCTCAGCTCCCCGGGCTGGG + Intergenic
1060774438 9:126361831-126361853 CAGCCTTGACTTCCCGGGCTCGG - Intronic
1061620022 9:131805878-131805900 CAGCCTGGGTTCCTGGGGCTTGG + Intergenic
1061808481 9:133149219-133149241 CCGCCCCGGCTCCCCGGGCTCGG + Intronic
1061874327 9:133536332-133536354 CAGCCTCGGCTGAGGGGGCTGGG - Intronic
1062538036 9:137029392-137029414 CAGGCTAAGCCCCCGGGGCTGGG - Intronic
1062577671 9:137216112-137216134 CAGCACCGGCTCCGGGAGCTGGG + Exonic
1186509092 X:10117202-10117224 CAGCCGGGGCTCCCTGAGCTCGG + Exonic
1187939150 X:24364605-24364627 AAGCCTGGGCTCCCTGGACTGGG - Intergenic
1190362343 X:49661148-49661170 CTGCCTGGTCTCCTGGGGCTGGG + Intergenic
1190526344 X:51332795-51332817 CTCCCTCCGCTCCCCGGGCTCGG + Intronic
1190870242 X:54418922-54418944 CAGCCTCGATTTCCCGGGCTCGG + Intergenic
1192261060 X:69505981-69506003 CAGCCCGGGCTCCGGGGCCTGGG + Exonic
1194215814 X:91129079-91129101 CAGCCACGGCTCAAGTGGCTGGG + Intergenic
1195971063 X:110473964-110473986 CAGCCTCGGCACACTGGTCTTGG - Intergenic
1196788585 X:119443824-119443846 CAGCCTCAACTTCCTGGGCTCGG + Intronic
1198205651 X:134462049-134462071 CAGCCTCGACTTCCCGGGCTCGG + Intronic
1198277797 X:135112829-135112851 CAGCCTCAGCTGCCTGGCCTGGG - Intergenic
1199949814 X:152698895-152698917 CTGCCTCTGCTGCCGGGCCTGGG + Intronic
1199959860 X:152769566-152769588 CTGCCTCTGCTGCCGGGCCTGGG - Intronic
1200053064 X:153444935-153444957 CAGCCACGGCACCCGGGCCCGGG - Exonic
1200061295 X:153484931-153484953 CACCCTCAGCCCCCGTGGCTAGG - Intronic
1200109393 X:153732624-153732646 CTGTCTCGGTGCCCGGGGCTAGG - Intronic