ID: 1165243094

View in Genome Browser
Species Human (GRCh38)
Location 19:34482413-34482435
Sequence CTCGGCTCCCGGGGCTCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 214}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165243081_1165243094 21 Left 1165243081 19:34482369-34482391 CCGGGCCGCCTTCGGTGGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243077_1165243094 27 Left 1165243077 19:34482363-34482385 CCGGTCCCGGGCCGCCTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243082_1165243094 16 Left 1165243082 19:34482374-34482396 CCGCCTTCGGTGGGCAGCGCCCG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243076_1165243094 28 Left 1165243076 19:34482362-34482384 CCCGGTCCCGGGCCGCCTTCGGT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243087_1165243094 -9 Left 1165243087 19:34482399-34482421 CCAGCGTTTCCAGCCTCGGCTCC 0: 1
1: 0
2: 1
3: 25
4: 243
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243085_1165243094 -4 Left 1165243085 19:34482394-34482416 CCGCTCCAGCGTTTCCAGCCTCG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243084_1165243094 -3 Left 1165243084 19:34482393-34482415 CCCGCTCCAGCGTTTCCAGCCTC 0: 1
1: 0
2: 3
3: 25
4: 336
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243083_1165243094 13 Left 1165243083 19:34482377-34482399 CCTTCGGTGGGCAGCGCCCGCTC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214
1165243080_1165243094 22 Left 1165243080 19:34482368-34482390 CCCGGGCCGCCTTCGGTGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG 0: 1
1: 0
2: 3
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165243094 Original CRISPR CTCGGCTCCCGGGGCTCGGC CGG Exonic
900309778 1:2028099-2028121 CAGGGCTCCCGGGGCAGGGCCGG + Intronic
900593948 1:3472046-3472068 CTCTGCTCACGGGGCCCGACTGG - Intronic
901086772 1:6615321-6615343 CGCGGTTCCCGTGGCTGGGCAGG + Intronic
901154745 1:7128063-7128085 CTCGGCACCCAGGGCTCTGCTGG - Intronic
902169588 1:14599134-14599156 CGCGGCTCCCGGGCCCGGGCCGG - Exonic
903193320 1:21668642-21668664 GTCGCCTCCCCTGGCTCGGCAGG - Intronic
903462827 1:23531086-23531108 CTCGGCACCTGGGGTCCGGCCGG + Exonic
904252777 1:29236748-29236770 CACGGGCCCCGAGGCTCGGCGGG - Intronic
905684992 1:39901693-39901715 CGCAGCTCCCAGGGCCCGGCGGG + Intronic
906204448 1:43979490-43979512 CCCGGCGCTCGGGGCTCAGCAGG - Intronic
906611912 1:47209471-47209493 CTGGGCTCCTGCGGCTCAGCTGG + Intergenic
907541087 1:55215686-55215708 CGCGGCTGCGGAGGCTCGGCCGG - Intergenic
910587033 1:88891450-88891472 CTCAGCTCGCCGGGCTCGGCGGG + Intronic
912401681 1:109398221-109398243 CCAGGAGCCCGGGGCTCGGCGGG - Intergenic
920511802 1:206557308-206557330 CCGGGCGCCCGGGGCTCTGCAGG + Intronic
1063104896 10:2984601-2984623 CTGGGCTCCAGGGGCTTTGCAGG - Intergenic
1064354495 10:14604593-14604615 CTCGGCCTCCGGGACTCGGTGGG + Intronic
1065605630 10:27414395-27414417 CTCCGCTTCCGGAGCGCGGCTGG - Intergenic
1067079574 10:43205517-43205539 CTGGGCTCCAGGACCTCGGCTGG + Intronic
1068908287 10:62351495-62351517 CTCGGCTCCTGTGGCTTTGCAGG + Intergenic
1070156669 10:73839706-73839728 CTCCGCTCCCCCAGCTCGGCTGG - Intronic
1071546981 10:86536569-86536591 CGCGGCTCCCGGGTCCCGGGAGG - Intergenic
1071563867 10:86661750-86661772 CTCTGCTCCCAGGGCCTGGCAGG + Intronic
1071578868 10:86752475-86752497 CCCAGCTCCCGGTGCTCGGTGGG + Intergenic
1071598143 10:86942742-86942764 CTGGGCTCCAGGTGCTCTGCCGG + Exonic
1073059403 10:100724456-100724478 CTCGGCGGGCGGGGCTTGGCGGG + Intergenic
1074085663 10:110207738-110207760 CTGGGGGCCCGGAGCTCGGCCGG + Exonic
1075207100 10:120457241-120457263 CGCGGCTCCCGCAGCTCGGCCGG - Exonic
1076576869 10:131475222-131475244 CTCGGCGCCCGGGGCAGGCCTGG - Intergenic
1076864695 10:133160880-133160902 CTGGCCTCCTGGGGCCCGGCAGG - Intronic
1077021965 11:420909-420931 TGGGGCTCCCGGGGCTGGGCGGG + Intronic
1077028152 11:450787-450809 CCCGGGTCCCGGGGAGCGGCCGG + Intronic
1077177772 11:1198399-1198421 CTCGAGTCCCTGGCCTCGGCCGG - Intronic
1077375591 11:2203905-2203927 CTGGGATCCTGGGGCTGGGCTGG + Intergenic
1079034838 11:17013128-17013150 CTGGCCTCCCGGAGCTCAGCAGG + Intronic
1080204852 11:29716902-29716924 CTCTGCTCCTGTGGCTCTGCAGG + Intergenic
1080406874 11:31987509-31987531 CTCGGCGCGCGGGGCGCGGGCGG - Intronic
1081676621 11:44973806-44973828 CTTGCCTCCCTGGGCTCGCCTGG - Intergenic
1083430767 11:62612688-62612710 CTCGGCTCCCGGGGGTGGGGTGG + Exonic
1083572521 11:63768276-63768298 GTCGGCTCGCGGGGCTCGGGCGG - Intronic
1083936563 11:65872708-65872730 CGCGGCTCTGGCGGCTCGGCTGG + Exonic
1084010860 11:66347657-66347679 GGCGGCGCTCGGGGCTCGGCTGG - Exonic
1084385525 11:68841147-68841169 CTCGGCCCTCGGGATTCGGCAGG - Intronic
1084483839 11:69436888-69436910 CACGTCTCCCAGGGCTCTGCAGG + Intergenic
1090042303 11:123301825-123301847 CTCGGCGCCCGGGGGGCGGCCGG - Intergenic
1090075830 11:123579514-123579536 GTGGGCTCCAGCGGCTCGGCAGG + Intronic
1090285554 11:125496144-125496166 GGCGGATCCCGGGGCTCAGCCGG + Exonic
1090574537 11:128086601-128086623 CACTTCTCCCGGGACTCGGCTGG - Intergenic
1096789092 12:54034106-54034128 CGCCTCTCCCGGGGCTGGGCTGG + Intronic
1102197269 12:111034349-111034371 GGCGGCTGCCGGGGCTCGCCGGG + Intronic
1103407758 12:120687543-120687565 CCTGGATCCCGCGGCTCGGCAGG - Intronic
1104847107 12:131852171-131852193 CCCAGGTCCCGGTGCTCGGCCGG - Intergenic
1104929221 12:132329410-132329432 CTGGGGTCGCGGGGCGCGGCCGG + Intergenic
1105004141 12:132710748-132710770 CCCGCCTCCTGGGGCGCGGCAGG - Intergenic
1105011812 12:132761519-132761541 GCCGGCTCCAGGGGCGCGGCCGG + Intronic
1105278598 13:18950241-18950263 CACGGCTCCCGGGCCTCTCCAGG + Intergenic
1105378287 13:19863974-19863996 CTCGGGGCCCGGGGCTCTCCGGG + Intergenic
1105388934 13:19958374-19958396 CTCGGGGCCCGGGGCTCTCCGGG - Intergenic
1105871908 13:24512786-24512808 CCCTGCCCCCGGGGCTGGGCGGG + Exonic
1105930462 13:25047413-25047435 CGCGGCTTCCAGGGCTGGGCTGG + Intergenic
1106115556 13:26814864-26814886 CTCTGCTCCTGGGGCTCGTGAGG + Intergenic
1108573138 13:51769551-51769573 CTCTGCTCTCAGGGCTGGGCTGG - Intronic
1111421693 13:88019261-88019283 CTCGGCCCCTGTGGCTCTGCAGG - Intergenic
1114528475 14:23380673-23380695 CTGGGCTCCTCGGGCTGGGCAGG - Intergenic
1115119860 14:29927144-29927166 TCCGGCTCCCGGGGCTCGGCTGG - Intronic
1117063876 14:51989600-51989622 CTGGTCCCCCGGGCCTCGGCCGG - Exonic
1117548430 14:56811497-56811519 CTCGCAGCCCGGGGCTCGGGCGG - Intergenic
1119262534 14:73245986-73246008 CTGGGCTCCCTGGGCTCGGGCGG + Intronic
1122638998 14:103146298-103146320 CTTCGCTACCGGGGCTCGGCCGG + Intergenic
1128520232 15:68370295-68370317 CACGGCCACCGGGGCTTGGCCGG - Intronic
1129609656 15:77043110-77043132 CTCTGCTCCTGTGGCTTGGCGGG + Exonic
1131093657 15:89642233-89642255 CTCGGCTCCAGGAGTTCCGCAGG - Exonic
1132555422 16:569978-570000 CTCGGGTCCCGCGGCGGGGCTGG + Intronic
1132859987 16:2065656-2065678 CTCTGCTCCCGGGGCGCGCATGG + Intronic
1132997181 16:2829509-2829531 CTCGGTCCCCGGGGCCCTGCTGG - Intergenic
1135752290 16:25067000-25067022 CTCGCCTTCCGGGGCTTGGTCGG - Intergenic
1136365290 16:29806665-29806687 CGGGGCCCCCGGGGCTCAGCGGG - Exonic
1137828899 16:51525221-51525243 CTTTGCTCCCAGGCCTCGGCAGG - Intergenic
1138690955 16:58768314-58768336 CTCGCCTGCTGGGGCTCAGCTGG + Intergenic
1140664187 16:77213096-77213118 TACGGCGCCCGGGGCTCGACTGG - Intronic
1141585136 16:85028364-85028386 CACCGCTCCCGGGGCTTAGCAGG + Intronic
1141764548 16:86049840-86049862 CAAGGCTGCCGGGGCTCAGCTGG + Intergenic
1141831266 16:86511077-86511099 TACGGCTTCCAGGGCTCGGCCGG + Exonic
1142290477 16:89191847-89191869 CCAGGCTCCCAGAGCTCGGCCGG + Exonic
1142428088 16:90011358-90011380 CTCAGCTCCCTTGGCTCTGCTGG - Intronic
1143110460 17:4549985-4550007 CTTGGGTCGCGGGGCTCTGCAGG + Intronic
1147134756 17:38428447-38428469 CTCTGCGGCCGGGGCACGGCTGG - Exonic
1147382207 17:40062760-40062782 CGGGGGTCCCGGGGCGCGGCAGG + Intronic
1147900275 17:43779035-43779057 CGCAGCTCCCGGAGCCCGGCGGG - Intergenic
1148060130 17:44830325-44830347 CCCCGCTCCCGGGCCGCGGCGGG - Intronic
1148848446 17:50542213-50542235 CTCCGGACCCGGGGCTGGGCGGG + Exonic
1149751909 17:59154494-59154516 CTCCGCTCCCGGAGCGCGGGCGG - Intronic
1152326680 17:79645602-79645624 CTGGGCTCCCTGGGCTGGACTGG - Intergenic
1152598881 17:81251540-81251562 CTCTGCTCGCGAGGCTCGGGCGG + Exonic
1152725345 17:81942241-81942263 CTGGGCTCCTGGGGCTCGCGGGG + Intronic
1152728666 17:81959737-81959759 CTGGGCGCGCGGGGCGCGGCGGG - Intronic
1156008585 18:32470981-32471003 CGCAGCTCCCGCGGCCCGGCAGG + Intergenic
1159797863 18:72866863-72866885 AGGGGCTCCCGGAGCTCGGCGGG - Intronic
1159896879 18:74005630-74005652 CTCTGCTCTAGGGGCTTGGCTGG - Intergenic
1160452963 18:78978530-78978552 CGCGGCTCGCGGCGCTCGGCGGG - Intergenic
1160500636 18:79399876-79399898 CCCCACTCCCGGGGCTCCGCAGG + Intronic
1160819975 19:1053360-1053382 CTGGGTGCCCGGGGCACGGCTGG + Exonic
1161031470 19:2059763-2059785 CTCCACTCCAGTGGCTCGGCAGG + Intergenic
1162100467 19:8335623-8335645 CGGGGGTCCCGGGGCGCGGCGGG + Exonic
1162780767 19:13006033-13006055 TTAGGCCCCGGGGGCTCGGCAGG + Intronic
1163154585 19:15432828-15432850 CTCGGCGCTCGGCACTCGGCAGG - Intronic
1163665969 19:18604244-18604266 CTGCCCTCCCGGGGCTGGGCGGG + Intronic
1165243094 19:34482413-34482435 CTCGGCTCCCGGGGCTCGGCCGG + Exonic
1165330436 19:35138830-35138852 CTCAGCCCCCGGGGCACAGCAGG + Intronic
1166721821 19:45001459-45001481 CGCGGCGCCCGGGGCTGCGCGGG - Exonic
1167002835 19:46756080-46756102 CTCGGCGCCCCTGGCCCGGCCGG + Exonic
1167366594 19:49057842-49057864 CCAGGCTCCCGGAGCTCCGCTGG + Exonic
926172152 2:10559192-10559214 CTGGGGTCCTGGGGCTGGGCAGG - Intergenic
926226441 2:10970486-10970508 CTCGGATCCTTGGGCTCTGCAGG - Intergenic
927719279 2:25372652-25372674 CTGGGCTCCCGGGGGTAGGCTGG + Intergenic
927965018 2:27262983-27263005 CGGGGATCCCGGGGGTCGGCGGG - Exonic
932566849 2:72916204-72916226 CACGGCTCCCGGCGCTCAGGCGG + Intergenic
932567189 2:72917537-72917559 CTGGGCGGCCGGGGCTGGGCAGG + Exonic
932901893 2:75710758-75710780 CTCGGCGCCCCAGGCTCAGCAGG + Exonic
933847543 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG + Intronic
935820322 2:106887021-106887043 CTCGGGTCCCGGGCGGCGGCAGG + Intronic
936814611 2:116444734-116444756 CTCTGCTCCTGTGGCTCTGCAGG + Intergenic
938058358 2:128233467-128233489 CTCGGCGCCCGCGTCTCCGCCGG + Intergenic
938061828 2:128260988-128261010 CTCGGCTTCTGGGGCTGGGCGGG + Intronic
938368818 2:130756213-130756235 CGCGGCTCCAGGGGCCCCGCGGG - Intronic
939667497 2:144969254-144969276 CTCGGCTCCTGTGGCTTTGCAGG + Intergenic
948002408 2:234579351-234579373 CTGGGCTCCCAGTGCTCCGCGGG - Intergenic
1169073741 20:2749529-2749551 CGCGGCGGCCGGGGCTGGGCCGG - Intronic
1169913680 20:10667293-10667315 GTCGGCTCCCAGGGTTCGTCAGG + Intronic
1170152119 20:13236863-13236885 CTCTGCCCCCGGGGCTTTGCAGG + Intronic
1172480230 20:35267210-35267232 GTGGGCTCCAGAGGCTCGGCTGG - Exonic
1173855978 20:46251141-46251163 GTCGGCGCCCGGAGCTCGGCAGG - Exonic
1175852798 20:62102834-62102856 CTCGGCTTCCGGGGGTCCTCAGG - Intergenic
1176161663 20:63651879-63651901 CTCGGTTCCTGGGGCTGAGCTGG - Intronic
1178843486 21:36156540-36156562 CTCGGCTGGCCGGGCTAGGCTGG - Intergenic
1179209489 21:39313365-39313387 CCCGGCTCCCCGGGCTCCCCCGG - Intronic
1179730039 21:43362549-43362571 CAGGGCTCCCGGAGCGCGGCTGG - Intergenic
1179882727 21:44300262-44300284 CCCGGGTCCCGGGGCTCGGCGGG - Intronic
1180064390 21:45405300-45405322 CGGGGGTCGCGGGGCTCGGCCGG + Intronic
1180201594 21:46228044-46228066 CTCGGTGGCCGGGGCTCGGCAGG + Intronic
1180960085 22:19758639-19758661 CTCGGCTCCCTCGGCTGGCCAGG + Intronic
1181478111 22:23180868-23180890 CCCGGCGCCCGGGGCCGGGCTGG + Exonic
1182511322 22:30822423-30822445 CTCGGCTCCCGCGGCGCGGACGG + Intronic
1183093977 22:35541267-35541289 GTGGGCTCCGAGGGCTCGGCGGG - Exonic
1183405638 22:37629398-37629420 CTCGGCTCTCTGGCCTCTGCAGG + Intronic
1184386874 22:44181623-44181645 CTGGGCCCCCGGGGTTCTGCAGG - Intronic
1184593884 22:45502883-45502905 GTTGGCTGCCGAGGCTCGGCCGG + Exonic
1185255192 22:49827738-49827760 CCCGGCTCGGGGGGCCCGGCCGG + Intergenic
1185271145 22:49929733-49929755 CCCGGCTCCCGGGACTCGGCCGG + Intergenic
1185349438 22:50326930-50326952 CGCGGCTGCCTGGGCGCGGCTGG - Exonic
1185409447 22:50674454-50674476 AGCGGCTCCGGGGGCTCCGCAGG - Intergenic
950021784 3:9792682-9792704 CGCAGCTCCTGGCGCTCGGCGGG - Exonic
950502921 3:13375937-13375959 CTCAGCTCTGGGGGCTGGGCGGG - Intronic
950517850 3:13479457-13479479 CTGGGATCCCTGGGCTCCGCGGG - Intergenic
950667373 3:14505687-14505709 CTCGTCCTCCGGGGCTCGGTGGG + Exonic
952796438 3:37243300-37243322 CGCGGCTCCCGGGGCTGGATGGG + Exonic
952816667 3:37452698-37452720 CTCGGCCGCCGGGGGACGGCGGG + Intronic
954390851 3:50267346-50267368 CCCAGCTCCAGGGGCTCAGCAGG - Intergenic
954409848 3:50365688-50365710 CTCGGCTCCCCGTGCGCTGCAGG - Exonic
954882689 3:53846397-53846419 CTCGCCTGCTGGGGCTCGGAGGG - Intergenic
956675033 3:71725318-71725340 GGCGGCTCCCGGGCCCCGGCGGG + Exonic
960224014 3:115148094-115148116 CTCCGCTCCCGCGGCTCCCCCGG - Intergenic
961041862 3:123683414-123683436 CTGGGCTCCTGGGGCTCTGAGGG + Intronic
962220996 3:133564565-133564587 CTCAGTTCCCTGGGCTAGGCTGG - Intergenic
966576767 3:181511204-181511226 CTCTGCTCCTGTGGCTCTGCAGG - Intergenic
966878337 3:184336096-184336118 ATCGGCTCTCGGAGCCCGGCGGG + Intronic
968283690 3:197495787-197495809 CTAGGCTGGCCGGGCTCGGCTGG + Intergenic
968572106 4:1347274-1347296 TTCGGTCCCCGGGGCTCTGCGGG + Intronic
968726407 4:2249942-2249964 CTGGGCTCTCGGGGCCAGGCAGG - Exonic
968902159 4:3436870-3436892 CACGGCTCCCTGCCCTCGGCTGG - Intronic
968940301 4:3634199-3634221 CTCAGCTCCCGGGGCTCTCCAGG - Intergenic
969704857 4:8786149-8786171 CTGGGCTCCCAGGGCTCTGCTGG - Intergenic
970222577 4:13825714-13825736 CTCTGCCCCCGGGGCTTTGCAGG - Intergenic
972533133 4:39977842-39977864 CCCGGCTCCCGGGGCACGGACGG - Exonic
972765916 4:42152183-42152205 CTCGGAGCCCGGCGCCCGGCGGG - Exonic
976595596 4:86892282-86892304 CCGGGCTCCAGGGGCTCGGAGGG + Intronic
976812329 4:89110958-89110980 CTCGGCACCCTGGGCTTGTCCGG + Intronic
978619230 4:110622502-110622524 GGCGGCTACGGGGGCTCGGCGGG - Exonic
980035856 4:127881531-127881553 CTCCGCTCCCGGGGATTGGCTGG + Intronic
983850135 4:172570199-172570221 CTGGGCTGCCCGGGCTCGTCTGG - Intronic
985064250 4:186105327-186105349 CACTGCTCCCGCGGCGCGGCTGG - Intronic
986813693 5:11385293-11385315 CTCTGCTCTCGGGGCCGGGCTGG - Intronic
989229834 5:39073957-39073979 CTCGGTTCCCGCGGGCCGGCAGG + Intronic
992483558 5:77174666-77174688 CTCAGCTCCCTGGGCTCTGCTGG + Intergenic
992866314 5:80960485-80960507 GGGGGCTCCGGGGGCTCGGCCGG + Intergenic
994932557 5:106207713-106207735 CTCGGCTCCCACTGCTCTGCTGG + Intergenic
995477639 5:112563868-112563890 CTCTGCTCCTGTGGCTCTGCAGG - Intergenic
997580992 5:135016943-135016965 CCCGGCTCCCGGGGCTCCCAGGG - Intergenic
997583886 5:135033754-135033776 AGCGGCTCGCGGGGGTCGGCGGG + Exonic
998374115 5:141680217-141680239 CTGGGCTTGCGGGGCTGGGCTGG + Exonic
999727135 5:154446362-154446384 GTCGGCTCCCGCGGCTCGCAGGG - Exonic
1001352326 5:170980946-170980968 CTCCGCTCCTGTGGCTCTGCAGG - Intronic
1002622136 5:180495032-180495054 CTGGGCTCCCGGATCCCGGCCGG + Intronic
1002777569 6:341854-341876 CTCGGCTCTCTGGGCACGGATGG + Intronic
1005575877 6:27188729-27188751 CTCCGCTGCCGAGACTCGGCTGG + Intergenic
1005905567 6:30259748-30259770 CGCGGCTCCCCGGGCCGGGCGGG - Intergenic
1007327445 6:41073177-41073199 CTCGACTCCCCGGGCTCGACGGG - Intronic
1010032771 6:71288450-71288472 CTCAGCTCCAGGAGCTGGGCGGG + Intergenic
1011517381 6:88167463-88167485 CTCCGCCCCCGGGGCCCTGCAGG + Intergenic
1013482191 6:110562330-110562352 CTCGGCTGACGTGGCTGGGCAGG + Intergenic
1019403832 7:872089-872111 CTCATCTCCCCGGGCTCAGCAGG + Intronic
1019562556 7:1665842-1665864 CTCGGAGCCCGGGGCTGGCCGGG - Intergenic
1019689701 7:2403732-2403754 CTGGGCTCCCAGGGCCCGGGCGG + Intronic
1021828039 7:24573714-24573736 CTCGGCACCTGGGCTTCGGCGGG + Intronic
1023881909 7:44325529-44325551 CTCGGCTCGCGGCGCCAGGCGGG + Intronic
1023905567 7:44519454-44519476 CTCAGCTACCAGGGCTGGGCAGG + Intronic
1025819393 7:64947901-64947923 CTCGGCTCGGGGAGCCCGGCAGG - Intergenic
1026471290 7:70695265-70695287 CTCGGCCGGCCGGGCTCGGCCGG + Intronic
1027385835 7:77659079-77659101 CCCAGCTTCCGGGGCTCAGCTGG + Intergenic
1027592693 7:80135293-80135315 GTCGGGGCCCGGGGGTCGGCGGG + Intronic
1028985642 7:97006486-97006508 CTCGACGCCCGGGCCTCCGCCGG + Intronic
1029522011 7:101068799-101068821 CCCAGCTCCCGGTGGTCGGCTGG + Intergenic
1033339137 7:140478766-140478788 TCCGGCTCCCGGGGCTCGGGAGG - Intronic
1034299232 7:150000807-150000829 CTCGACTCCCTGGTCTCGCCTGG + Intergenic
1034434599 7:151057344-151057366 CGAGGCTCCAGGGGCTCGGCAGG + Intronic
1034470559 7:151252174-151252196 CTCCGCTCGGGGGGCGCGGCAGG + Intronic
1034806783 7:154095966-154095988 CTCGACTCCCTGGTCTCGCCTGG - Intronic
1036778843 8:11631786-11631808 CACAGCTCCCTGGCCTCGGCAGG + Intergenic
1038613143 8:29071816-29071838 CTCGGCCCCCGGGGAGCAGCCGG + Exonic
1038931291 8:32196577-32196599 CTCTGTTCCCAGGGCTCTGCTGG - Intronic
1048009362 8:130443622-130443644 CTCGGCTCCCGCGCCTCGCCTGG - Exonic
1049222957 8:141436195-141436217 CTCGGCTCCCGGGGAAGGGAAGG + Intergenic
1049636381 8:143691721-143691743 CTGGGCTGTCTGGGCTCGGCGGG + Intronic
1053435010 9:38068729-38068751 CTCGGCGCCCCGGCCCCGGCGGG + Exonic
1056154006 9:83817412-83817434 CTCGGCGCCCCGGCCTCGGGTGG - Intronic
1057208031 9:93184812-93184834 CTCCGCGGCCGGGGCTGGGCAGG + Intergenic
1057313480 9:93955317-93955339 CGGGGCGCGCGGGGCTCGGCCGG + Exonic
1057759765 9:97862765-97862787 CACAGCTCCAGGGGCTCAGCAGG + Intergenic
1058663073 9:107283592-107283614 CTCGGCTGCCGGGCCTGCGCCGG - Exonic
1062483677 9:136763833-136763855 CTGGGCTGCCTGGGCTGGGCTGG - Intronic
1185831813 X:3310204-3310226 CACCCCTCCCGGGGCTGGGCAGG - Exonic
1187394391 X:18907027-18907049 ATCTTCTCCCGGGGCTCGGGCGG + Exonic
1192168205 X:68839093-68839115 CTTGGCTCCAGGGGTTGGGCAGG + Intronic
1192363766 X:70454945-70454967 CTCGGCACCTGGGCCTCGGTTGG - Intronic
1193520017 X:82518537-82518559 CTCTGCTCCCGTGGCTCTGAAGG + Intergenic
1194895337 X:99432869-99432891 CTCTGCTCCTGTGGCTCTGCAGG - Intergenic
1196605601 X:117654190-117654212 CTCTGCTCCTGTGGCTTGGCAGG + Intergenic
1200079160 X:153566989-153567011 CTCGCCTCCCGGTTCTCAGCTGG - Intronic
1200218531 X:154379411-154379433 CTCGGCAGCCGTTGCTCGGCCGG + Exonic
1200255530 X:154580521-154580543 CTCCGCTCCTGTGGCTCTGCAGG - Intergenic
1200262239 X:154623883-154623905 CTCCGCTCCTGTGGCTCTGCAGG + Intergenic