ID: 1165244024

View in Genome Browser
Species Human (GRCh38)
Location 19:34487647-34487669
Sequence CTTTGTTGACTGAGGAAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165244017_1165244024 24 Left 1165244017 19:34487600-34487622 CCATAGATGGGGACGGCTAGGAG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG 0: 1
1: 0
2: 3
3: 25
4: 255
1165244020_1165244024 -3 Left 1165244020 19:34487627-34487649 CCAAGTGTGGGCCATGTTCTCTT 0: 1
1: 0
2: 1
3: 13
4: 210
Right 1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG 0: 1
1: 0
2: 3
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165244024 Original CRISPR CTTTGTTGACTGAGGAAAGG CGG Intronic
900954346 1:5877498-5877520 ATTTGAAGGCTGAGGAAAGGAGG - Intronic
902207012 1:14876044-14876066 GTTGTTTGACTGAGGCAAGGAGG + Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
907574716 1:55515752-55515774 TTTTGTAGACTTAGGAAAAGAGG + Intergenic
907612773 1:55889213-55889235 CTTAGTTGACTGGGGAAAAGGGG - Intergenic
908090332 1:60678753-60678775 CTGTGTGTACTGAGCAAAGGGGG - Intergenic
909151270 1:72008983-72009005 TTTTTTTGACTGATGAGAGGTGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
910685069 1:89907638-89907660 CTTTGTAAACTGAGAAAAGAAGG - Intronic
911182224 1:94871338-94871360 CTAACTTGCCTGAGGAAAGGAGG - Intronic
911768191 1:101704619-101704641 TTTTTTTGTCTGAGGAATGGTGG + Intergenic
912620743 1:111154524-111154546 CTATGTTGAGTGTGGAAAGTGGG + Intronic
913490454 1:119374876-119374898 CTCTCCTGACTGAGGGAAGGAGG - Intronic
917656360 1:177130213-177130235 CTTTGTTGACTGAGACAAGGTGG - Intronic
918600401 1:186352012-186352034 CTTTGTTAGCTGAACAAAGGGGG - Exonic
919992317 1:202716863-202716885 CTTTGCTGACTTCTGAAAGGAGG + Intergenic
920345242 1:205302023-205302045 CTTTGGTGACTGAGGTGGGGAGG - Intergenic
921133162 1:212237015-212237037 CTTAGTGGGCTTAGGAAAGGAGG - Intergenic
922811994 1:228421542-228421564 CTTGGTGGACTGAACAAAGGAGG - Intergenic
1063468093 10:6261521-6261543 CCTTGTTGACAGAGGAGAGTGGG + Intergenic
1065242910 10:23726003-23726025 CCTTTTTGAGTGAGGAAAGGGGG - Intronic
1066204078 10:33170491-33170513 CTTTCCTGACTGAGGAGAGCTGG - Intergenic
1067067210 10:43110852-43110874 CTTTGTTGTCTGAGTGAGGGAGG + Intronic
1067090011 10:43261716-43261738 CTTTGCTGGCTGAGGAGAGGAGG - Intronic
1067530281 10:47066165-47066187 GTTTGTTGACTGTGGACATGCGG - Intergenic
1067690672 10:48499444-48499466 CTTTGTTAAATGAGAACAGGTGG + Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1070165217 10:73892489-73892511 CTTTGAGGACTGATGAGAGGAGG + Intergenic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1072056464 10:91762492-91762514 CTTTGTAGAATGAGTAAGGGAGG - Intergenic
1072147247 10:92652499-92652521 CTTTGTTAACTGTTGAAAGCAGG - Intronic
1075296701 10:121283329-121283351 ATCTGTTGAATGAGGAAGGGAGG + Intergenic
1077942455 11:6857643-6857665 CTCTGTTCACTGGGAAAAGGAGG - Intergenic
1079200963 11:18377146-18377168 CTTGGGAGACTGAGGCAAGGAGG - Intergenic
1079374021 11:19875949-19875971 CTTTTTTGGCTGAGAAAATGTGG - Intronic
1083904174 11:65659503-65659525 CTTTGTTGGCTGGGGAGAGAGGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1085287396 11:75372592-75372614 TTTTGTTGGGGGAGGAAAGGCGG + Intergenic
1086492435 11:87369096-87369118 GTTTTTCGACTGAGGAAGGGTGG - Intergenic
1086894431 11:92295743-92295765 CTTTGCTGACTATGGAAAGAAGG + Intergenic
1087003633 11:93446550-93446572 CCTTGTTGAATGTTGAAAGGAGG + Intergenic
1087120230 11:94566852-94566874 CCTTGTAAACTGAGGACAGGTGG + Intronic
1087769955 11:102197844-102197866 CTTTGTTTCCTGGGGAAAGGGGG - Intronic
1087890542 11:103532951-103532973 GTTTGTTGAATGAAGAAAAGAGG - Intergenic
1090393040 11:126401867-126401889 GTTTGATCACTGAGGGAAGGAGG + Intronic
1090563782 11:127964188-127964210 CATTGTTGTCTGAGAAAAGGAGG + Intergenic
1091482431 12:847412-847434 CTCAGTTGACTGAAAAAAGGGGG + Intronic
1094526458 12:31234343-31234365 CATTGTTGAGTGAGGAAATAAGG + Intergenic
1095575923 12:43739219-43739241 CTTTTTTGACTCAGGTAAGTTGG - Intronic
1095704200 12:45220152-45220174 CTTTGCTGAAGGAGGAAAAGTGG + Intronic
1095874429 12:47064936-47064958 ATTTGTTGACTGATAAAATGGGG - Intergenic
1096109519 12:49020649-49020671 GTTTGGTGACTGAGGGAAAGTGG + Exonic
1096442154 12:51652257-51652279 TTTTGTTGACTGACTAAAAGAGG - Intronic
1097197066 12:57248795-57248817 TGTTGTTGACTTGGGAAAGGGGG + Exonic
1097522364 12:60685414-60685436 CTTGGTGGACTGAACAAAGGAGG - Intergenic
1098073743 12:66703656-66703678 CTTTGGTGACTGGTGAAGGGTGG + Intronic
1100606411 12:96155347-96155369 CTTTGTAGGCTGAAGAAAGGAGG - Intergenic
1101900132 12:108785881-108785903 TTTTGTTGGCTGAGGGAAAGGGG + Exonic
1101922612 12:108945094-108945116 TTTTGCTGATTGAGGTAAGGAGG - Exonic
1102308522 12:111825434-111825456 CTTGGTGGACTGAACAAAGGGGG + Intergenic
1104793402 12:131498708-131498730 CTTGAATGGCTGAGGAAAGGTGG - Intergenic
1105512899 13:21065882-21065904 CTTTGTGGAGTGAGGAAGAGGGG + Intergenic
1111122861 13:83878003-83878025 CTTTATGGACTGGGGAAAGCCGG + Exonic
1112472108 13:99698582-99698604 TTTTATTAACTGAGGCAAGGAGG + Intronic
1112669078 13:101614009-101614031 CTTTGTTGAATAGGGATAGGAGG + Intronic
1113823335 13:113231312-113231334 CTTTGAAGAATGAGCAAAGGTGG + Intronic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1114431910 14:22669095-22669117 TTTGATTAACTGAGGAAAGGGGG - Intergenic
1118619003 14:67597542-67597564 ATTTGTTGATTGATGAATGGAGG + Intronic
1119068346 14:71553483-71553505 TTTGGCTGACTGAGGTAAGGAGG - Intronic
1121885452 14:97538782-97538804 ATTTGTTGAATGAATAAAGGTGG + Intergenic
1123919570 15:25060834-25060856 CTTGGTTGGCTTAGGAAAGTTGG + Intergenic
1123980494 15:25597547-25597569 CTGTGGTGACTGAGGAAGTGAGG - Intergenic
1124464584 15:29925359-29925381 CTTTGAGGACTGAGGACAGAGGG + Intronic
1126038349 15:44568040-44568062 CTTTGTTAAGTGAGAAAAGCAGG + Intronic
1126410152 15:48365110-48365132 AGTTGTTGACTGAGTAAAGTGGG - Intergenic
1129311554 15:74715333-74715355 ATTGGTGGACTGAGTAAAGGAGG + Intergenic
1129653719 15:77508975-77508997 CTTTGTTAACTCAGCAAAGATGG + Intergenic
1130436354 15:83903608-83903630 CTTTATTGAATTAGAAAAGGGGG + Intronic
1130793165 15:87178352-87178374 CATTCCTGTCTGAGGAAAGGTGG + Intergenic
1131408156 15:92183654-92183676 GTTTGTTGTCGGAGGAAATGAGG - Intergenic
1132200732 15:99953051-99953073 CTTTGATGGCAGAGGAAGGGAGG - Intergenic
1132273080 15:100543997-100544019 CTTTGTAGCCGGGGGAAAGGGGG + Intronic
1136296519 16:29307159-29307181 CTGTGGGGACTGAGGAAATGAGG + Intergenic
1137374429 16:47940613-47940635 CCTTGATGACTGGGAAAAGGTGG + Intergenic
1137532671 16:49290887-49290909 CCTTGTGGAATGGGGAAAGGAGG + Intergenic
1137731183 16:50691750-50691772 CTCTGGTGCCAGAGGAAAGGGGG + Intergenic
1137804542 16:51291551-51291573 CTTAGTTGAGTGAGGAAACCAGG + Intergenic
1139648933 16:68352056-68352078 GTTTGTTGACTGAGGGAGGGAGG + Intronic
1140310040 16:73840298-73840320 CTTTTGGGACTGAGAAAAGGGGG - Intergenic
1140352447 16:74275588-74275610 CTTTGATGTCAGAAGAAAGGGGG + Intergenic
1140802378 16:78500212-78500234 CTTTGTGCAGTGGGGAAAGGTGG + Intronic
1141930303 16:87197699-87197721 ATTGGTGGACTGAGGAAAGCAGG - Intronic
1142058102 16:88013278-88013300 CTGTGAGGACTGAGGAAATGAGG + Intronic
1142764919 17:2059392-2059414 CCTTGGTGACTGAGGAAGGAAGG - Exonic
1145883991 17:28370262-28370284 CTCTGATGCCTGAGGAAGGGAGG + Exonic
1147211125 17:38873009-38873031 ATTTGTTGAATGAGCAAATGAGG - Intronic
1147759121 17:42786257-42786279 CTTTGCTGAATGAGTAAAGGAGG - Intronic
1148177405 17:45579121-45579143 TCTTGAGGACTGAGGAAAGGAGG + Intergenic
1149775353 17:59352851-59352873 CTTGGTTGGCTCAGGAGAGGGGG + Intronic
1151327477 17:73388100-73388122 CTTTCTCGAGGGAGGAAAGGAGG + Intronic
1151881934 17:76901110-76901132 CTTTCTTTCCTTAGGAAAGGTGG + Intronic
1152868364 17:82737267-82737289 TTTGGGCGACTGAGGAAAGGTGG + Intronic
1153032175 18:724966-724988 CTTGGGTTACTGAGGAATGGTGG + Intronic
1153507338 18:5814604-5814626 CTTTGTTGACTGAGAGCAAGGGG + Intergenic
1155250956 18:23952976-23952998 TTATGGTGACTGGGGAAAGGAGG - Exonic
1155461089 18:26084550-26084572 CTTTGATGACTTAGTTAAGGTGG - Intronic
1156572885 18:38279179-38279201 CTTTGTTTCCACAGGAAAGGAGG - Intergenic
1158265535 18:55657186-55657208 CTTAGATGTCGGAGGAAAGGGGG + Intronic
1159435955 18:68417499-68417521 ATTTGTTGCCTGAGCAAAAGAGG - Intergenic
1159656956 18:71041514-71041536 CATTTTTGACTCATGAAAGGGGG + Intergenic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1164072964 19:21786151-21786173 CCTGGTGGACTGAAGAAAGGAGG + Intergenic
1164143013 19:22491137-22491159 ATTCGTTCACTGAAGAAAGGAGG + Intronic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1166630112 19:44399357-44399379 GTTTTTTGACAGGGGAAAGGAGG - Intronic
1166637348 19:44462078-44462100 GTTTTTTGACAGGGGAAAGGAGG + Intergenic
1167122527 19:47527155-47527177 CAGTGCTGACTGAGGACAGGGGG + Intronic
1167387727 19:49173967-49173989 ATTTGTTGACTAAATAAAGGAGG - Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167527709 19:49995267-49995289 ACTTGTTGACTGCGGAAAGCAGG + Exonic
1167706116 19:51082218-51082240 TTTTGTTGTCAGAGGGAAGGTGG - Intronic
925830544 2:7889921-7889943 AATTGTTGACTGTGGAAAGAAGG + Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
927033209 2:19143951-19143973 ATTTGTTGACTGATGAATAGAGG + Intergenic
928122899 2:28596522-28596544 CTTTATTGAAGGAGAAAAGGAGG + Intronic
929125727 2:38521297-38521319 CATTGGTGAATGAGGAGAGGTGG + Intergenic
929304725 2:40348025-40348047 CTTTATTTACTGAAGGAAGGAGG + Intronic
931893311 2:66700100-66700122 CTGTGGTGACTGAGAAAAGAGGG + Intergenic
932013112 2:67998263-67998285 CTTTGTCAACTGAGGAAAATTGG - Intergenic
932502995 2:72200860-72200882 ATTTGTTCACTGAGGTAAGATGG - Intronic
932885941 2:75549381-75549403 CTTTGTCTACTGAGGAAAAGTGG + Intronic
938543648 2:132307152-132307174 GTTTTTTGACAGGGGAAAGGAGG + Intergenic
940659159 2:156524754-156524776 CGTAGTTTACTGAGGAGAGGTGG + Intronic
944930099 2:204508531-204508553 CTGAGCTGACTGAGGAGAGGTGG + Intergenic
945133043 2:206595437-206595459 CTTGGCTGACTGAGAAAAGAGGG + Intronic
945183090 2:207111653-207111675 CTTTGGGGAATGAAGAAAGGAGG - Intronic
945317027 2:208380526-208380548 CTTTGTTGAAATAGGAAGGGGGG - Intronic
945821498 2:214671220-214671242 CTTTGATTACTGAAGGAAGGAGG - Intergenic
945823766 2:214696555-214696577 CTTTGCTGCCAGAGGAAGGGAGG - Intergenic
946956227 2:224932740-224932762 CTTTGCAGAATGAGGAAGGGTGG - Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948686998 2:239675973-239675995 GTTTGCTGAGTGAGGAGAGGAGG + Intergenic
1169413315 20:5393317-5393339 AATTGTTAACTGAGGAAAGCAGG + Intergenic
1170703904 20:18727961-18727983 GTTTGTTCACTGTGGAAAGGGGG + Intronic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1171872513 20:30539878-30539900 GTTTTTTGACAGGGGAAAGGAGG + Intergenic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172435210 20:34924057-34924079 CTTTGATGTATGAGGAAAGATGG + Intronic
1172506080 20:35463693-35463715 ATTTGTTGACTGAGGGAGGTTGG + Intronic
1173875683 20:46369574-46369596 CTTAGTTGACTGATGGAATGAGG + Intronic
1174683301 20:52429236-52429258 CTTAGTTAACTGAGAAAAGTTGG - Intergenic
1174947047 20:54999022-54999044 CTTTCATGAAGGAGGAAAGGAGG - Intergenic
1175652858 20:60742737-60742759 CTTTGTTGACAGCGGGAAGGTGG - Intergenic
1176031414 20:63014812-63014834 CTGTGCTGACTGAGGGCAGGCGG - Intergenic
1178258728 21:31079126-31079148 CTTTGTTGACATGGGAAAAGAGG + Intergenic
1179654284 21:42835480-42835502 CTTTGTAGACCCAGGAAATGAGG - Intergenic
1181712693 22:24700541-24700563 ATTTGGTGACAGAGGGAAGGAGG - Intergenic
1183599110 22:38829817-38829839 CTTAGGAAACTGAGGAAAGGTGG - Intronic
1184207345 22:43013929-43013951 CTTGGGTGCCTGAGGGAAGGTGG - Intronic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
950070985 3:10152455-10152477 ATTTGTTGAATGTTGAAAGGAGG - Intergenic
953429150 3:42822875-42822897 CTTTCATGACTGGGGAAGGGGGG - Intronic
955010873 3:55013071-55013093 CTCTGTAGTCTGTGGAAAGGAGG - Intronic
955785240 3:62530804-62530826 ATTTGTTGACTTTGGAGAGGGGG + Intronic
955939537 3:64134484-64134506 CTTTGTTGACTGGGTATAGGGGG + Intronic
958666797 3:97150522-97150544 CTTAGTGGACTGAGGAACAGGGG - Intronic
959006345 3:101024813-101024835 TTTTGTAGAATGAGTAAAGGAGG + Intergenic
959739337 3:109698034-109698056 CTTTATTAACTGAAGAAAAGTGG + Intergenic
959937348 3:112042969-112042991 CTGTGTAGAATGAGGAAAGGTGG + Intronic
961118574 3:124353147-124353169 CTTTGTTGACTTAGTAAAACTGG + Intronic
961518750 3:127455160-127455182 CTGGGTTGCCTGGGGAAAGGGGG - Intergenic
961547789 3:127647557-127647579 CTTTATTGGCTGAAGAACGGGGG + Intronic
961606177 3:128097124-128097146 CTTTGGTGACTAGGGAAATGAGG + Intronic
962191659 3:133317341-133317363 CATTGCTGACTTAGTAAAGGTGG - Intronic
963700265 3:148617470-148617492 CATTATTGACTTAGGAAAAGGGG + Intergenic
964465647 3:156988706-156988728 CATTGTAGACTGAGAAATGGAGG - Intronic
965623280 3:170661933-170661955 CTTTGGGGACTCAGGAAGGGAGG + Intronic
966183892 3:177211212-177211234 ACTTGTTCTCTGAGGAAAGGGGG + Intergenic
967734933 3:192942000-192942022 CTTGGTAGACTTTGGAAAGGAGG + Intergenic
968179975 3:196587070-196587092 CTTTGTTGACTTGGGAAACCTGG + Exonic
968940574 4:3635405-3635427 CTGTGTTGACTGAGGATGGGAGG - Intergenic
971261155 4:25057938-25057960 ATTTGTTCAGTCAGGAAAGGTGG - Intergenic
975739346 4:77413867-77413889 ATTTGTGTACTGGGGAAAGGAGG + Intronic
975814596 4:78204658-78204680 CTTTGTGGACTATGAAAAGGAGG - Intronic
976249999 4:83040628-83040650 ATTTGCTGACTGTGGAAAGATGG - Intronic
976457947 4:85271372-85271394 CTTTGTAGAGTGAGTTAAGGAGG - Intergenic
978298689 4:107239743-107239765 CTTTGTAGAATGAAGAAGGGAGG - Intronic
978332536 4:107630040-107630062 CTTTTTTGACTGAAGAAAAATGG - Intronic
978355166 4:107864401-107864423 CTTTGCTGACTGAGAGATGGTGG + Intronic
978485545 4:109249770-109249792 TTTTGTTGATAGAGGAAAGTAGG - Intronic
980057049 4:128088082-128088104 CTTGGTAGGCTGAGGTAAGGAGG + Intronic
981101280 4:140831970-140831992 CTTTGATGTCTGAGCACAGGAGG - Intergenic
981711127 4:147709898-147709920 CTTAGCTGATTGAGGAAAGTGGG - Intergenic
983538895 4:168887808-168887830 TTTTCTTGACTGAGGAAGGGAGG + Intronic
984709321 4:182871888-182871910 ATTTGTTGAATGAGCAAAGACGG - Intergenic
985332383 4:188852347-188852369 CTTTGTTCACTGGGGAACAGTGG - Intergenic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
987112288 5:14699612-14699634 CTTTCTTGAGTGGGAAAAGGCGG - Exonic
988142118 5:27256502-27256524 CTTTGTTAACTGAGGAAATATGG - Intergenic
988624157 5:32853007-32853029 CTTTGTGACCTGAGGAAATGTGG - Intergenic
988796110 5:34655356-34655378 CTTTCTTCCCTGAGCAAAGGAGG + Intergenic
990131693 5:52594466-52594488 CTGTGTTGACTGAGGTCAGTTGG - Intergenic
990951438 5:61302379-61302401 GTTTGTTGACTGATGACAGCAGG + Intergenic
991573251 5:68077371-68077393 CTATGCAGACTGAGGGAAGGGGG + Intergenic
992127589 5:73657707-73657729 CTTTGATGAGTGAGGAAAGAAGG - Intronic
992769507 5:80034602-80034624 CTTTGGTGACAGAGGAATAGAGG + Intronic
993956123 5:94235011-94235033 TTTTTTTGCCTGAGGAAAGAGGG - Intronic
994618894 5:102139115-102139137 CTTTGATGAGAAAGGAAAGGAGG - Intergenic
997961968 5:138329296-138329318 TTTTGTTGACTGATTAATGGTGG - Intronic
998174696 5:139894624-139894646 CTTAGGTGACTGAGGAAATGTGG - Intronic
998204963 5:140151579-140151601 CCTTGTTGAGTGTGGACAGGGGG + Intergenic
998536427 5:142935740-142935762 CATTGTTGTATGAGGGAAGGAGG + Intronic
999800252 5:155026883-155026905 CTGTGCTGAGTGAGGAAATGGGG - Intergenic
1000399117 5:160806575-160806597 CTTTATTGTCTAAGGAAGGGGGG + Intronic
1000860783 5:166453601-166453623 CATTGTTGCGTGAAGAAAGGAGG + Intergenic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1006384456 6:33722079-33722101 CATTTTTGCCTGTGGAAAGGAGG - Exonic
1006518563 6:34558141-34558163 CCTTGTTTACTGAGGAAAAGGGG - Intergenic
1006903984 6:37521032-37521054 TTCTGTTAACTGAGGAAAGCAGG - Intergenic
1012694764 6:102365044-102365066 CTATTTAGAGTGAGGAAAGGTGG + Intergenic
1013334641 6:109143257-109143279 CTTAAATGACTAAGGAAAGGAGG - Intronic
1013372929 6:109485583-109485605 CTTTGTTGGCTGGGTATAGGTGG - Intergenic
1013595693 6:111658613-111658635 CTTTGTTGCCTTAGGAAAGCTGG - Intergenic
1013598176 6:111679841-111679863 CTTTGTTCTCTGAGGACAAGGGG + Intronic
1014656126 6:124106553-124106575 TTTTGTTACCTTAGGAAAGGCGG + Intronic
1015014470 6:128394547-128394569 CTTTGATGACTGAGTTAAGTAGG + Intronic
1015563591 6:134542375-134542397 TTTGGTAGACTGAGGAAGGGGGG - Intergenic
1015927374 6:138323694-138323716 CTGTGTTCACTGAGGAGATGTGG + Exonic
1018023282 6:159783262-159783284 CTTTGTTGTATGAGGAAGGAAGG + Intronic
1018776414 6:167020983-167021005 CTTGGGAGACTGAGGCAAGGAGG + Intronic
1019436992 7:1027695-1027717 CTTTCTTGCCTGAGGCAAGGCGG - Intronic
1020287203 7:6693266-6693288 CTATGTGGAATGAGGAAAGAAGG - Intronic
1020672042 7:11128311-11128333 TTATTTTCACTGAGGAAAGGGGG + Intronic
1025239813 7:57261830-57261852 CTTTGTTGGAGAAGGAAAGGAGG - Intergenic
1026023281 7:66727205-66727227 CTTTGCTGACTAATGGAAGGTGG + Intronic
1026888073 7:73966403-73966425 CTTTGCTGACTAATGGAAGGTGG + Intergenic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1029975177 7:104826808-104826830 CTTTGGTGACTCTGGAAAGAGGG + Intronic
1031025552 7:116675612-116675634 AGTTGATGGCTGAGGAAAGGTGG - Intronic
1032098016 7:128949134-128949156 TTTTGTTGCCAGAGGAAATGGGG - Intronic
1032648343 7:133850768-133850790 CTTTGTTAAAAAAGGAAAGGAGG - Intronic
1033032574 7:137841761-137841783 CTTTCTAGTCTGAGGAAATGAGG - Intronic
1034112657 7:148553235-148553257 CTTTGTAGAATGAGTTAAGGAGG + Intergenic
1035239351 7:157519908-157519930 CTTAGGTGACAGGGGAAAGGGGG - Intergenic
1035686699 8:1528634-1528656 CCATGTTGACTGAGGACAAGAGG - Intronic
1036033717 8:4996868-4996890 CTTTGCTCTCTGGGGAAAGGAGG - Intergenic
1036051701 8:5206075-5206097 CTTTGGTGAGAGAGGAAAGCTGG + Intergenic
1036605450 8:10301764-10301786 ATTTATTGACGGAGGAGAGGAGG + Intronic
1036743572 8:11388719-11388741 CTGTGTTGACTCTGGAAAGAGGG - Intergenic
1037226033 8:16591067-16591089 ATTTTTTGAGTGAGGAAAGAAGG + Intergenic
1037400515 8:18491224-18491246 CCTTGTTGAATGAGGAGATGAGG - Intergenic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1039612067 8:38928002-38928024 CCTGGTTGACTGGGGAGAGGAGG + Intronic
1040916124 8:52567390-52567412 TTTTGTTGAATGAATAAAGGTGG - Intergenic
1041548756 8:59077185-59077207 CATTTGTGACTGAGGAAAGGTGG - Intronic
1041699793 8:60775691-60775713 CTTAATAGACTGAGGAAAGGGGG - Intronic
1041835017 8:62201926-62201948 CATTGATGACTGAGAAAAGCAGG - Intergenic
1043034854 8:75183686-75183708 CTTTGTAGACTGAGTTAGGGAGG - Intergenic
1045254595 8:100509096-100509118 CTTTGTAGGCTAAGGGAAGGAGG + Intergenic
1045735430 8:105290632-105290654 ATTTGTAGACTCAGGAAAGTTGG + Intronic
1051819280 9:21145672-21145694 CTTTGTAGACAGAGCAACGGGGG + Intergenic
1051954835 9:22679616-22679638 CTTGGTAGACTTAGGAAAGCAGG - Intergenic
1052399691 9:27985126-27985148 CTTTTCTGAATGAGGAAAGAAGG + Intronic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1055162639 9:73149262-73149284 TTTTGTTGGCTGTGGATAGGGGG + Intergenic
1055272064 9:74572397-74572419 CTTAGATGACTGAGGAAATCTGG + Intronic
1056651311 9:88466694-88466716 GTTTGTTGAATGAGGAAAATAGG + Intronic
1058432367 9:104930149-104930171 ATTCTTTGACTGAGGCAAGGGGG - Intergenic
1062186069 9:135219210-135219232 CTTTGTTGAATGAGTAAAGGGGG + Intergenic
1062725830 9:138073002-138073024 CTTTGCTGACTGAGCCAGGGAGG + Intronic
1185710247 X:2297861-2297883 CTTGGGAGACTGAGGAAGGGAGG - Intronic
1186309888 X:8306415-8306437 CATTGTTGGATGAGGAAAGGAGG - Intergenic
1186906154 X:14112968-14112990 CTTTGTTGAGGAAGGAAGGGTGG + Intergenic
1189750687 X:44218176-44218198 CTTAGTTAACTGAGGAATGCTGG - Intronic
1190531423 X:51381882-51381904 CTTTGTAGAATGAGTTAAGGAGG - Intergenic
1191008217 X:55733809-55733831 CTTTGTAGAATGAGTTAAGGAGG + Intronic
1192526413 X:71848764-71848786 CTTTCTGGCCTGATGAAAGGTGG - Intergenic
1193779885 X:85688360-85688382 CTTTGTAGAATGAGTTAAGGAGG - Intergenic
1196700244 X:118660296-118660318 CTTTGTTGAAGAAGGAAATGAGG + Intronic
1199527688 X:148810848-148810870 CTTTGGTAACTGAGGAAAGGGGG - Intronic
1199544241 X:148990562-148990584 CTTGGTTCACTTAGGGAAGGGGG - Intronic
1199697160 X:150350949-150350971 CTTTGGCCAATGAGGAAAGGAGG - Intergenic