ID: 1165246883

View in Genome Browser
Species Human (GRCh38)
Location 19:34503040-34503062
Sequence CATGGTGACCGGGATGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165246883_1165246891 15 Left 1165246883 19:34503040-34503062 CCTGCTCCATCCCGGTCACCATG 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1165246891 19:34503078-34503100 TGGCCTGAGTCATCACAGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 219
1165246883_1165246888 -5 Left 1165246883 19:34503040-34503062 CCTGCTCCATCCCGGTCACCATG 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1165246888 19:34503058-34503080 CCATGCACGCTCCTGCCAGCTGG 0: 1
1: 0
2: 3
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165246883 Original CRISPR CATGGTGACCGGGATGGAGC AGG (reversed) Exonic
900646469 1:3711029-3711051 CATGGTGAGAGGGGTGGAGCTGG + Intronic
902673773 1:17994194-17994216 CCTGGTGACCGAGATGCAGGTGG + Intergenic
903000446 1:20261885-20261907 CCAGGTGACATGGATGGAGCTGG + Intergenic
903223651 1:21882986-21883008 GATGGTGACCAGGAGGGAGGAGG - Intronic
903713502 1:25345038-25345060 CATGGTGACAGTGCTGCAGCAGG - Intronic
905384710 1:37594341-37594363 CATGGTGCCTTGCATGGAGCAGG - Intronic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
907159044 1:52358107-52358129 CAGGGTAATGGGGATGGAGCCGG + Intronic
908240974 1:62188760-62188782 TAGGGTGACTGGGATGGAGTTGG + Intergenic
908351046 1:63286527-63286549 CTTGGGGACTGGCATGGAGCTGG - Intergenic
908558184 1:65278965-65278987 CATGGGGAAGGGGATGGAGGAGG - Intronic
908572594 1:65424900-65424922 CACGGTGAGAGGGATGGAGCCGG + Intronic
915835324 1:159171613-159171635 GGTGGGGACCGGGAGGGAGCCGG - Exonic
917681341 1:177371261-177371283 CATGGGAACATGGATGGAGCTGG + Intergenic
920170598 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG + Intergenic
921710185 1:218365824-218365846 CAAGGTGACAGGGATGGCCCTGG - Intronic
922078508 1:222271484-222271506 CATGGTGACAGTGATAGAGAAGG + Intergenic
923196178 1:231670055-231670077 GATAGGGACCTGGATGGAGCGGG + Intronic
1062971789 10:1654095-1654117 CAGGGTGATGGGGAAGGAGCAGG - Intronic
1063059182 10:2533048-2533070 CAGCGTGACAGGGATGGGGCAGG + Intergenic
1065830858 10:29612405-29612427 CATGGTATCAGGGATGGAGTTGG + Intronic
1067302525 10:45025201-45025223 CATGGCAACGTGGATGGAGCTGG + Intergenic
1067665774 10:48277273-48277295 CATGGGAACATGGATGGAGCTGG - Intergenic
1069034211 10:63630515-63630537 CACGGTGACGGGGGTGGGGCGGG - Intergenic
1069550353 10:69360053-69360075 CGGGGTGACCCGGAGGGAGCAGG - Intronic
1072533168 10:96338776-96338798 TATGATGGCCGGGAAGGAGCAGG - Intergenic
1072900763 10:99404564-99404586 GATGGTGACCTGGATGAAGTAGG - Intronic
1073266428 10:102230829-102230851 CATGGAGGCGGCGATGGAGCTGG + Exonic
1076579019 10:131494518-131494540 CAGGGAGATTGGGATGGAGCAGG + Intergenic
1077130246 11:968440-968462 GATGGGGACGGGGATGGAGACGG - Intronic
1077498445 11:2897923-2897945 AAGGGTGACCTGGAAGGAGCGGG - Intronic
1078210277 11:9264973-9264995 CACGGAGACCGGGCTGGAGCCGG - Exonic
1078552198 11:12288504-12288526 CATGGTGTCTGGGATGGGCCTGG + Intronic
1081658847 11:44875444-44875466 CCTGGTGACCTGGAGGGAGGTGG - Intronic
1082783415 11:57303474-57303496 CATGGTGGCTGGGAGGGGGCAGG - Intronic
1082826709 11:57585129-57585151 CATGGAGATGGGGATGGAGTGGG - Intergenic
1087106344 11:94412154-94412176 CATGGTGCCTGGCATAGAGCAGG - Intergenic
1088201243 11:107337574-107337596 CATGGTGATGTGGACGGAGCTGG - Intronic
1088732335 11:112694328-112694350 CATGTTGACTGGGATGAACCTGG + Intergenic
1093177885 12:15933829-15933851 CATAGTGACAGAGTTGGAGCTGG + Intronic
1096629496 12:52916787-52916809 CATGCTGACCATGCTGGAGCAGG + Intronic
1099810629 12:87578058-87578080 CAGGGTGCCAAGGATGGAGCTGG + Intergenic
1100063590 12:90611829-90611851 CATGCTGAACTGGATGGAGGTGG + Intergenic
1102601444 12:114033752-114033774 CATGGTGACCAAGATGGATAGGG + Intergenic
1102663316 12:114548380-114548402 AATGGTGCCTGGCATGGAGCAGG - Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104691492 12:130829632-130829654 CTTGGAGACAGGGAGGGAGCAGG - Intronic
1106680652 13:32003720-32003742 CATGGGAACATGGATGGAGCTGG + Intergenic
1114080684 14:19199822-19199844 CATGGTGACCGGGGTCCACCAGG + Intergenic
1114302856 14:21393856-21393878 CAGCGTGACAAGGATGGAGCTGG + Exonic
1115497832 14:34024567-34024589 CATGCTGACCGGGAAGGAGAGGG - Intronic
1116312315 14:43342358-43342380 CCTGGTGAGAGGGATGGATCTGG + Intergenic
1117490918 14:56246940-56246962 CATGGTTACTGGGGTGGAGAAGG - Intronic
1117775997 14:59185161-59185183 CAGGGTGACCTGGAAGAAGCTGG + Intergenic
1118246736 14:64117870-64117892 CATCCTGGGCGGGATGGAGCAGG + Intronic
1118403944 14:65405033-65405055 AATAGTGACTGGGAGGGAGCTGG - Intergenic
1120085805 14:80271365-80271387 CATGATGTTTGGGATGGAGCTGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121630687 14:95419790-95419812 CATGGTGACTGTGATGGTGATGG + Intronic
1122118782 14:99540890-99540912 CAGGGTATCTGGGATGGAGCCGG - Intronic
1123989466 15:25672868-25672890 CATGGTGCCTGGGAGGGAGAAGG + Intergenic
1124205997 15:27720968-27720990 CATGATGAGCAGGACGGAGCTGG + Intergenic
1125788289 15:42342159-42342181 CATGGTGCCCGGCATGCAGTAGG + Intronic
1127011060 15:54629131-54629153 CACAGTGACATGGATGGAGCTGG + Exonic
1128965800 15:72056435-72056457 CACAGTGACCTGGATGGAACTGG + Intronic
1132616581 16:843902-843924 CACGGTGACCTGGATGCAGGGGG + Intergenic
1132616592 16:843941-843963 CACGGTGACCTGGATGCAGGGGG + Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1133128452 16:3662081-3662103 CATGGTCACCGTGCTGGAGATGG - Exonic
1133896174 16:9931380-9931402 CATGGTGCCAGGCATGGAGAAGG - Intronic
1134379185 16:13708527-13708549 CATGGTCACAGTGAAGGAGCAGG + Intergenic
1136519642 16:30787179-30787201 CAGGGTGACTGGGACGGAGCAGG + Exonic
1137315998 16:47323782-47323804 CATGGTGACTGGGCTGGAATTGG - Intronic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1138906069 16:61335472-61335494 CATGGTGGGGGGGATGGGGCGGG - Intergenic
1141269155 16:82523014-82523036 CATGGAGAGGGGGAAGGAGCAGG - Intergenic
1141458569 16:84161968-84161990 AATGGTGACTGGCATGTAGCAGG + Intronic
1142489564 17:269557-269579 GATGGTGCCAGGGATGAAGCCGG - Intronic
1143462668 17:7114241-7114263 GATGGGGCCCGGGCTGGAGCTGG + Exonic
1143868737 17:9942963-9942985 CATGGCGCCTGGGATGGATCTGG - Intronic
1150250366 17:63701127-63701149 CCTGGTGCCCGGGAAGGCGCCGG - Intronic
1151341945 17:73477296-73477318 CGGGGTGACCTGGATGGGGCTGG - Intronic
1151355842 17:73558048-73558070 CATGGTGTTGGGGATGGGGCAGG - Intronic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1151475622 17:74342983-74343005 GAGGGTGACCGGGGTGGGGCTGG - Intronic
1151787195 17:76280797-76280819 CAGGGTGGCTGGGATGGGGCCGG - Intronic
1151955827 17:77379704-77379726 CATCGTGCCGGGGATGGGGCTGG + Intronic
1152130425 17:78472823-78472845 AAGGGTGACCTGGGTGGAGCTGG - Intronic
1152619369 17:81354324-81354346 CATGGTCACCGTGATTGACCCGG - Intergenic
1152739948 17:82014476-82014498 CATGGTGTCTGGGAGGGAGGTGG - Intronic
1155388568 18:25308231-25308253 CCTGGTGGCCTGGATGGGGCTGG - Intronic
1156245882 18:35297468-35297490 GATGGTGACAGGGAGGGAGGGGG + Intergenic
1156742430 18:40348252-40348274 CAGGATGACTGGGATGAAGCAGG + Intergenic
1157427827 18:47599309-47599331 CATGGTGCCTGGGACAGAGCAGG + Intergenic
1160732677 19:648371-648393 CATCGTGCCCTGGCTGGAGCAGG - Exonic
1161248866 19:3270131-3270153 CATGGGGTCAGGGTTGGAGCTGG - Intronic
1162146623 19:8616332-8616354 GATGGTGATGGCGATGGAGCAGG + Intergenic
1162890760 19:13731659-13731681 CAGGGCGACCGGGGTGGGGCGGG - Intergenic
1163440547 19:17320531-17320553 CATGGTGCCAAGGATGGAGCGGG + Exonic
1164769082 19:30794516-30794538 CATGGTCACTGTGGTGGAGCAGG + Intergenic
1165246883 19:34503040-34503062 CATGGTGACCGGGATGGAGCAGG - Exonic
1165392135 19:35545003-35545025 CATGGTAAGGGGGAAGGAGCTGG + Exonic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165443561 19:35844406-35844428 GGTGGTGACCGCGGTGGAGCAGG - Exonic
1165909524 19:39216556-39216578 CATGTTGACTGGGATGTAGATGG - Intergenic
1166791315 19:45400335-45400357 CATGGGGATAGGGATGGTGCTGG - Intronic
1167768485 19:51499676-51499698 CAGGGTCCCCGGGATGGAGAAGG + Exonic
1168343032 19:55636598-55636620 AATGTTGACCAGGATGGAGCTGG + Intronic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
927335307 2:21915923-21915945 CATGGTGACCAGGATGGAAGGGG - Intergenic
927483039 2:23469264-23469286 CATGGTGACCTGGAGGGTGTTGG + Intronic
928458205 2:31443948-31443970 CGTGGTAACATGGATGGAGCTGG - Intergenic
930720209 2:54631035-54631057 CAAGCTGACCGGCATGGAGCGGG + Exonic
931659493 2:64545757-64545779 CAAGGGGACAGGGATGGAGGTGG + Intronic
931867063 2:66425021-66425043 GATGGAGTCAGGGATGGAGCAGG + Intergenic
934499902 2:94850053-94850075 CATGGTGACCCATTTGGAGCAGG - Intergenic
936093076 2:109513116-109513138 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
936096642 2:109535370-109535392 CATAGTGACTGGGAGGGAGTTGG - Intergenic
937135322 2:119546717-119546739 CATGGCGATGGGGATGGTGCTGG - Intronic
941336794 2:164255438-164255460 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
943462297 2:188184275-188184297 CATGGTGGGTGGGATGAAGCTGG + Intergenic
945170426 2:206989492-206989514 CATGGGGACAGGGAGGGAGGTGG + Intergenic
946371359 2:219283422-219283444 CATGGAGAACGGGCAGGAGCGGG + Exonic
947181281 2:227413583-227413605 CAAGATGCCCGGGAAGGAGCGGG + Intergenic
948729226 2:239952725-239952747 CATGGGGACAGGGATGGGCCTGG + Intronic
1169093962 20:2879458-2879480 CATGGTGAGCAGGAAGGGGCAGG + Intronic
1170926335 20:20727797-20727819 CATGGCCACAGGGATGGAACTGG + Intergenic
1172012126 20:31851612-31851634 CATGGGGACAGGGCTGGAGCTGG + Intronic
1172095950 20:32460593-32460615 GATGGTGCCCGAGATGGGGCAGG + Intronic
1172605126 20:36208856-36208878 CATGGAGCCCAGGGTGGAGCTGG + Intronic
1172879569 20:38190707-38190729 CATGTTGAACAGGATGGGGCTGG + Intergenic
1172993412 20:39052299-39052321 CCTGGTGACAGGGCTGGAGATGG + Intergenic
1173379838 20:42530341-42530363 CATGGTGCCTGGCATGCAGCGGG - Intronic
1173950837 20:46992163-46992185 GATGGTGACAGGGAGGGAGGAGG - Intronic
1174412035 20:50342572-50342594 CATGGTGAGAGGGATGCAGAGGG + Intergenic
1175183077 20:57162082-57162104 CATGGTGGACGAGATGGGGCCGG - Intergenic
1176032080 20:63017515-63017537 CATGGTGGCAGGGCTGGTGCAGG + Intergenic
1176051001 20:63119755-63119777 CATGGTGGCCGGGGAGGCGCAGG - Intergenic
1176428464 21:6562607-6562629 CCAGGTGACAGGGATGGAGCTGG - Intergenic
1179245657 21:39632105-39632127 CCTGGTGGCTGGCATGGAGCTGG + Intronic
1179703954 21:43170923-43170945 CCAGGTGACAGGGATGGAGCTGG - Intronic
1180594369 22:16963706-16963728 CAAGGTGCCTGGGGTGGAGCTGG - Exonic
1180836968 22:18934779-18934801 CCTTGTGGCCGGGATGGAGTGGG - Intronic
1180918531 22:19506261-19506283 CCTGGGGAGCGGGGTGGAGCTGG + Intronic
1183057362 22:35315176-35315198 GATGGTGGCCGGGCTGGGGCAGG + Intronic
1183401703 22:37608860-37608882 GATGGAGCCCGCGATGGAGCCGG + Exonic
1184147393 22:42619503-42619525 CATGAGGACAGGGATGGGGCTGG + Exonic
1184499670 22:44863983-44864005 CATGGGGACAGGGATGGGGAGGG + Intergenic
1184761434 22:46547019-46547041 TGTGGTCACCGGGAGGGAGCAGG + Intergenic
1203287061 22_KI270734v1_random:160078-160100 CCTTGTGGCCGGGATGGAGTGGG - Intergenic
950864326 3:16176602-16176624 CATGGTGACAGTAAGGGAGCAGG - Intronic
951112194 3:18817278-18817300 CATGGGAACATGGATGGAGCTGG - Intergenic
952024707 3:29065559-29065581 CATGGAGACTGGCATGGAGATGG - Intergenic
953656896 3:44861603-44861625 CCGGGTGGCCGGGATGGAGACGG + Intronic
955322731 3:57985873-57985895 GGTGGAGACCAGGATGGAGCAGG + Intergenic
955946432 3:64198906-64198928 CATGGTGACAGTGATGCCGCTGG - Exonic
956737557 3:72249565-72249587 GATCGTGACATGGATGGAGCTGG + Intergenic
960281288 3:115784187-115784209 CCTGGGGGCGGGGATGGAGCCGG - Intergenic
960525150 3:118701456-118701478 CATGGTGATGGGGAGGGAACTGG - Intergenic
962272523 3:133988505-133988527 CATGGTGGTCGGGGTGCAGCTGG - Intronic
965715177 3:171595144-171595166 GATGGTGACCAAGGTGGAGCAGG + Intergenic
966475690 3:180343145-180343167 CATGGTAACATGGATGGAACTGG - Intergenic
966500896 3:180637774-180637796 CATGGGAACGTGGATGGAGCTGG + Intronic
968045760 3:195623235-195623257 CATGATGACAGGTCTGGAGCGGG - Intergenic
968114871 3:196081881-196081903 CGGGGCGGCCGGGATGGAGCGGG - Intronic
968308896 3:197666852-197666874 CATGATGACAGGTCTGGAGCGGG + Intergenic
968903349 4:3441162-3441184 CCTGGGGCCTGGGATGGAGCTGG - Intergenic
969281032 4:6170838-6170860 CATGGTGATGGGGATGGTGGTGG - Intronic
969625724 4:8304377-8304399 CAAAGTGACCGGGAAGGGGCAGG + Intronic
969641853 4:8403501-8403523 CAGGGTGACAGGGATGCAGTGGG - Intronic
969801693 4:9571617-9571639 CATGGCAACCTGGATGGAGTTGG + Intergenic
975710601 4:77157315-77157337 CGCGGGGAGCGGGATGGAGCCGG + Exonic
977393642 4:96445865-96445887 TATGGGAACAGGGATGGAGCTGG - Intergenic
977800751 4:101227858-101227880 CATGGGTACATGGATGGAGCTGG - Intronic
978732802 4:112049899-112049921 CATGGTGGCCAGGCTGGACCTGG - Intergenic
981952974 4:150433016-150433038 CATGGTGATGGAGATGGAGAAGG + Intronic
985747529 5:1655607-1655629 CATGATGACAGGTCTGGAGCGGG + Intergenic
986519515 5:8599129-8599151 CCTGGTGTCTGGCATGGAGCTGG - Intergenic
986893163 5:12333506-12333528 CTTAGTGACCTGGATGGAGCTGG - Intergenic
986940088 5:12938208-12938230 CATAGTGTCCGGGATGGATGGGG + Intergenic
987013272 5:13790393-13790415 CATGGGAACATGGATGGAGCTGG + Intronic
989370855 5:40706172-40706194 CATGGGAACACGGATGGAGCTGG + Intergenic
990748212 5:58982753-58982775 CATGGTGGCAGGGATGGAGGTGG - Intronic
991631249 5:68658272-68658294 GATTGGGACTGGGATGGAGCTGG + Intergenic
994117628 5:96078781-96078803 CACAGTGACATGGATGGAGCTGG + Intergenic
996794558 5:127330776-127330798 AATGATGACTAGGATGGAGCAGG + Intronic
999271363 5:150298107-150298129 CATGGTGACCTGCATGGATGAGG - Exonic
999803182 5:155056791-155056813 GATGGTGGCCAGGATAGAGCAGG + Intergenic
1000330611 5:160202396-160202418 CATGTTGATCAGTATGGAGCTGG - Intronic
1001435829 5:171698616-171698638 CATGGTGACAGAGTTGGGGCTGG + Intergenic
1001708005 5:173756001-173756023 CATAGAGACTGGGATGGGGCAGG - Intergenic
1001741599 5:174057551-174057573 CATGGGGACCGGCAGAGAGCAGG - Intronic
1007414257 6:41682931-41682953 GATGGTGGCCGGGCTGGCGCAGG - Intergenic
1011634570 6:89359310-89359332 CAAGAAGACCGGGATGGGGCTGG + Intergenic
1012339314 6:98099828-98099850 CATGGGAACATGGATGGAGCTGG - Intergenic
1012926624 6:105274278-105274300 CATGGTGGAAGGGATGGGGCGGG + Intergenic
1014418971 6:121217502-121217524 CATGGCAACATGGATGGAGCTGG + Intronic
1017483351 6:154880044-154880066 CATGCTGACCAGGAGGAAGCCGG - Intronic
1022141697 7:27498702-27498724 GATGGTGTCCGGGCTGGGGCAGG - Intergenic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1023872242 7:44269439-44269461 GAAGGGGTCCGGGATGGAGCTGG + Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1028917364 7:96274149-96274171 CTTGATGACTGGGAGGGAGCAGG - Intronic
1032804191 7:135339314-135339336 CATGGAGACCTGGAGGGTGCTGG - Intergenic
1033232818 7:139614932-139614954 CATGGTGACAGGGAGAGAGCTGG + Intronic
1033472799 7:141664766-141664788 CATGCTGCCTGGGATGGAGATGG - Intronic
1034306764 7:150049494-150049516 CATGGAAACCCGGAAGGAGCAGG - Intergenic
1034800080 7:154051148-154051170 CATGGAAACCCGGAAGGAGCAGG + Intronic
1035076036 7:156178309-156178331 CGTGGGGACGGGGAAGGAGCAGG + Intergenic
1035732012 8:1860137-1860159 GATGATGACCGGGCTGGAGTAGG - Exonic
1035761941 8:2074935-2074957 CCGGCTGATCGGGATGGAGCCGG - Intronic
1035797929 8:2376402-2376424 CATCTTGACCGGGATGATGCAGG - Intergenic
1036721330 8:11178067-11178089 CCTAGTGACCGGGTAGGAGCCGG + Intronic
1037367303 8:18136467-18136489 CTTGTTGACCAGGCTGGAGCTGG - Intergenic
1037374694 8:18214983-18215005 CATGGAAACATGGATGGAGCGGG - Intronic
1038146889 8:24905451-24905473 CATGGAGACCAGGCTGGAGAGGG - Intergenic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1039454489 8:37697974-37697996 CCCGGTGAGCGGGCTGGAGCTGG - Exonic
1046723528 8:117650107-117650129 CATGGTGCCTTGGATGAAGCTGG - Intergenic
1049752531 8:144291902-144291924 CGTGGGGACCGGGAGGGAGCAGG + Intronic
1053657264 9:40230477-40230499 CATGGTGACCCATTTGGAGCAGG + Intronic
1053907626 9:42859768-42859790 CATGGTGACCCATTTGGAGCAGG + Intergenic
1054369385 9:64376754-64376776 CATGGTGACCCATTTGGAGCAGG + Intronic
1054527330 9:66145749-66145771 CATGGTGACCCATTTGGAGCAGG - Intronic
1054677016 9:67866510-67866532 CATGGTGACCCATTTGGAGCAGG + Intronic
1056992686 9:91425119-91425141 CAAGGAGACCAGGAGGGAGCTGG - Intergenic
1057139418 9:92717647-92717669 CATGCTGGCCCTGATGGAGCTGG + Intronic
1057191847 9:93092772-93092794 CATGGGGACAAGGATGGGGCAGG + Intergenic
1059912605 9:119062561-119062583 CATGGGAACATGGATGGAGCTGG - Intergenic
1059970888 9:119667046-119667068 CATGGCGCCTGGCATGGAGCAGG - Intergenic
1061512557 9:131069906-131069928 CCTGGTGCCCGGCATAGAGCTGG - Intronic
1061737427 9:132670745-132670767 CATGGTGACTCGGCGGGAGCCGG + Exonic
1061904288 9:133688659-133688681 CATTGAGGCTGGGATGGAGCAGG - Intronic
1062132564 9:134907554-134907576 CATGGTGACTGGGAAGGGACAGG - Intronic
1062495101 9:136827920-136827942 CATGGTGACCTTGATGGCGGAGG + Intronic
1062581993 9:137232892-137232914 CATGCTGACCACGATGGAGGAGG - Exonic
1203376311 Un_KI270442v1:380904-380926 CATCCTGCCCGGGTTGGAGCCGG - Intergenic
1187314940 X:18184139-18184161 TATGGTGAGCTGCATGGAGCTGG - Intronic
1190967766 X:55318128-55318150 TGTGGTGACAGGGATGAAGCTGG - Intergenic
1192247962 X:69388853-69388875 CAGGATGAGCGGGCTGGAGCTGG + Intergenic
1192360886 X:70438466-70438488 CATCCTGGGCGGGATGGAGCAGG + Intergenic
1192615840 X:72621227-72621249 AATGGTGGCAGGGATGGAGGAGG + Intronic
1193636231 X:83952616-83952638 CATGGCAACCTGGATGGAACAGG + Intergenic
1194039424 X:88921444-88921466 CATTCTGAGCAGGATGGAGCAGG + Intergenic
1194075971 X:89394418-89394440 CACAGTAACCGGGATGGAGTTGG - Intergenic
1195105498 X:101599067-101599089 GATGGGGACCGGGGTGGAACGGG + Intergenic
1195107384 X:101614700-101614722 GATGGGGACCGGGGTGGAACGGG - Intergenic
1195814421 X:108869457-108869479 CTTGGTTCCCAGGATGGAGCAGG - Intergenic
1195940584 X:110164415-110164437 CATGGTTATCGGGAGTGAGCTGG + Intronic
1199594309 X:149494402-149494424 TATGGTGACTCGGAAGGAGCAGG + Intronic
1199781206 X:151061675-151061697 CATGGTGGCCTAGAAGGAGCTGG - Intergenic
1201401378 Y:13607775-13607797 CATGGTCTGCAGGATGGAGCAGG + Intergenic