ID: 1165254669

View in Genome Browser
Species Human (GRCh38)
Location 19:34568511-34568533
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165254669_1165254678 24 Left 1165254669 19:34568511-34568533 CCATCCTGCTTCTGCTCACCCTC No data
Right 1165254678 19:34568558-34568580 CAGTCCCAATGAAATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165254669 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr