ID: 1165255545

View in Genome Browser
Species Human (GRCh38)
Location 19:34575549-34575571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165255536_1165255545 4 Left 1165255536 19:34575522-34575544 CCAAGGCGGGGGTGACGAATGAC No data
Right 1165255545 19:34575549-34575571 TTGGAGAGGGGGCCTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165255545 Original CRISPR TTGGAGAGGGGGCCTGCAAA GGG Intergenic
No off target data available for this crispr