ID: 1165258603

View in Genome Browser
Species Human (GRCh38)
Location 19:34595160-34595182
Sequence GAGGCTGGTCCCCAACATGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 431}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165258603_1165258611 10 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258611 19:34595193-34595215 GTAGGGTACCCGAAGTCTGGTGG 0: 2
1: 13
2: 19
3: 11
4: 44
1165258603_1165258606 -7 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258606 19:34595176-34595198 CAGCCTCAACACTACCCGTAGGG 0: 1
1: 18
2: 21
3: 14
4: 52
1165258603_1165258614 19 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258614 19:34595202-34595224 CCGAAGTCTGGTGGTGACAAAGG 0: 1
1: 6
2: 13
3: 30
4: 152
1165258603_1165258605 -8 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258605 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 3
1: 16
2: 24
3: 20
4: 68
1165258603_1165258609 7 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258603 Original CRISPR GAGGCTGGTCCCCAACATGT AGG (reversed) Exonic
901271776 1:7957674-7957696 CAGGCTGGTCCCCAACTCCTGGG + Intronic
901284108 1:8062795-8062817 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
901408488 1:9066443-9066465 CAGGCTGGTCCCAAACTTGTGGG + Intronic
901504000 1:9672634-9672656 CAGGCTGGTCTCCAACTTCTGGG + Intronic
901594244 1:10372322-10372344 CAGGCTGGTCTCAAACTTGTGGG - Intronic
902895370 1:19476111-19476133 CAGGCTGGTCTCGAACTTGTGGG - Intronic
902956984 1:19932154-19932176 GAGGCTGGTCCTCAACATTCTGG - Intergenic
903083597 1:20834236-20834258 CAGGCTGGTCTCCAACAACTAGG - Intronic
903177450 1:21589514-21589536 GAGGCTGGTCTCGAACTTCTGGG - Intergenic
903188120 1:21640782-21640804 GAGGCTGGGCTCCAACCTGTAGG - Intronic
903230179 1:21917220-21917242 GAGTCTGGTCCCAAACTTCTTGG - Intronic
903510156 1:23868671-23868693 CAGGCTAGTCTCCAACTTGTGGG - Intergenic
903557334 1:24203238-24203260 GAGGCTGCTCCCCCACCTGCTGG - Intergenic
903734532 1:25521948-25521970 GAGCCTGGTCCCCAACACCCTGG + Intergenic
904090531 1:27941868-27941890 GAGGCTGGACCCCAAGGAGTTGG + Intronic
904240232 1:29139517-29139539 CAGGCTGGTCTCAAACACGTGGG + Intergenic
904568527 1:31443254-31443276 CAGGCTGGTCCCCAACTCCTGGG + Intergenic
905072509 1:35239559-35239581 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
905367570 1:37462233-37462255 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
905689377 1:39931673-39931695 CAGGCTGGTCTCGAACTTGTGGG + Intergenic
908381834 1:63604331-63604353 GAGGCTGGGTCCCAACATCATGG - Intronic
912773615 1:112488898-112488920 CAGGCTGGTCTCCAACTTCTGGG + Intronic
913361877 1:117989788-117989810 CAGGCTGGTCTCCAACACCTGGG + Intronic
913556406 1:119971607-119971629 CAGGCTGGTCTCTAACTTGTGGG - Intronic
915410620 1:155698972-155698994 GAGGCTGGTCCCCTACATTCTGG - Intronic
915440048 1:155940272-155940294 CAGGCTGGGTGCCAACATGTTGG - Intergenic
915660694 1:157402847-157402869 GAGGGTGGTCCTCAACTTGGGGG + Intergenic
917104086 1:171474889-171474911 AAGGCTGGTCTCAAACATCTGGG + Intergenic
917261328 1:173173109-173173131 GAGGTCTCTCCCCAACATGTAGG + Intergenic
917967028 1:180185398-180185420 GAGCCTGGACCCCAGCATGATGG + Intronic
919472057 1:197990544-197990566 CAGTCTGGTCTCCAACACGTGGG + Intergenic
920451906 1:206065733-206065755 GAGGCAGCTTCCCAACATGCTGG - Intronic
921228510 1:213045109-213045131 GAGGCTGGTCCCCAACATAGTGG - Intergenic
921289096 1:213638027-213638049 CAGGCTGGTCTACAACTTGTGGG + Intergenic
921603180 1:217128924-217128946 CAGGCTGGTCTCCAACTTCTGGG - Intronic
921629152 1:217412989-217413011 GAGGCTGGTCTCCAACTCCTGGG + Intergenic
922165629 1:223113414-223113436 CAGGCTGGTCTCCAACTTGTGGG + Intronic
922279815 1:224113158-224113180 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
922306254 1:224347624-224347646 TAGGCTGGTCTCCAACCTCTGGG + Intergenic
922447820 1:225712312-225712334 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
922888785 1:229044414-229044436 GAGGCTGGTCTCCAACTCCTGGG - Intergenic
922921194 1:229306205-229306227 GAGGCTGGTGACCAACAACTTGG - Intergenic
924653801 1:245954461-245954483 CAGGCTGGTCTCAAACATCTAGG - Intronic
924755240 1:246934563-246934585 CAGGCTGGTCTCAAACTTGTGGG + Intergenic
1064735536 10:18378536-18378558 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1065732154 10:28719147-28719169 CAGGCTGGTCCCAAACTTTTAGG - Intergenic
1065750771 10:28885120-28885142 CAGGCTGGTCTCAAACTTGTGGG + Intergenic
1066661640 10:37742374-37742396 GAGACTGGGTTCCAACATGTTGG + Intergenic
1067050452 10:43014382-43014404 TAGGCTGGTCTCCAACTTCTGGG - Intergenic
1067527800 10:47048769-47048791 GAGCCTGGGCCCACACATGTTGG + Intergenic
1067774395 10:49152089-49152111 GAGGCTGGTCTCCAACTCCTGGG - Intergenic
1069018374 10:63458273-63458295 CAGGCTGGTCTCAAACATCTGGG - Intronic
1069561141 10:69430513-69430535 CAGGCTGGTCTCGAACTTGTGGG + Intergenic
1069701548 10:70430249-70430271 AAGGCTGGTCTCCAACTTCTCGG - Intergenic
1069715004 10:70515062-70515084 AAGGCTGGTTCTCAACAAGTAGG - Intronic
1070612356 10:77942286-77942308 CAGGCTGGTCTCAAACCTGTGGG + Intergenic
1070620401 10:78005284-78005306 GAGGCTGATCACAAACATCTGGG - Intronic
1070844858 10:79513541-79513563 GGGGCTGGTCCCCAGTCTGTTGG - Exonic
1070928947 10:80246766-80246788 GGGGCTGGTCCCCAGTCTGTTGG + Intergenic
1071835470 10:89413554-89413576 CAGGCTGGTCTCCAACACCTGGG - Intronic
1071848081 10:89540307-89540329 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1072955365 10:99883451-99883473 CAGGCTGGTCTCCAACTTCTAGG - Intronic
1073033174 10:100544364-100544386 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1073245249 10:102085850-102085872 CAGGCTGGTCCCCAACTCCTAGG - Intergenic
1073505084 10:103979225-103979247 CAGGCTGGTCCCCAACTCCTGGG + Intronic
1073568767 10:104558185-104558207 GAGGCTGGGCCCCAGCTTTTGGG - Intergenic
1073865227 10:107795442-107795464 GAGGCTGGTCCCAAACTCCTGGG + Intergenic
1076002296 10:126921999-126922021 TAGGCTGGTCTCCAACTTCTGGG - Intronic
1076051883 10:127341660-127341682 GAGCCTGTTTCTCAACATGTTGG + Intronic
1077194995 11:1275128-1275150 GAGGCTGGCCCCCACTGTGTGGG + Exonic
1079215347 11:18505463-18505485 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1079625999 11:22618275-22618297 CTTGCTGGTACCCAACATGTGGG + Intergenic
1080014476 11:27490110-27490132 CAGGCTGGTCCTCAACTTCTGGG + Intergenic
1080075384 11:28141470-28141492 AAGGCTGGTCTCCAACTTCTGGG - Intronic
1081334630 11:41849277-41849299 GAGGCTGTTCCCCAGCCTGCAGG + Intergenic
1081959579 11:47125353-47125375 GAGGGTGGTGGCCAGCATGTAGG - Intronic
1082018493 11:47510969-47510991 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1082614334 11:55340062-55340084 GAGGCTGGTTTTCACCATGTCGG + Intergenic
1082688154 11:56265386-56265408 CAGGCTGGTCTCCAACTTCTAGG + Intergenic
1082814992 11:57501787-57501809 CAGGCTGGTCTCAAACTTGTAGG - Intronic
1083369662 11:62168055-62168077 GAGGCTGGTCTCCAACCCCTGGG + Intergenic
1083649588 11:64193870-64193892 CAGGCTGGTCCCAAACCTTTGGG - Intronic
1083888933 11:65586128-65586150 GAGACTGGTCTCCAGCATCTGGG - Intronic
1084197462 11:67531847-67531869 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1084276895 11:68056797-68056819 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1084630091 11:70342252-70342274 GAGGCTGCTGCCCAGCAGGTGGG + Intronic
1085015422 11:73170709-73170731 GAGGCTGGTCTCAAACTTCTGGG - Intergenic
1085357953 11:75856654-75856676 TAGGCTGGTCCCAAACTTCTGGG + Intronic
1085481804 11:76829293-76829315 GAGGCTGGTCTCCAACTCCTGGG + Intergenic
1086739291 11:90347373-90347395 GAGGCTGGTCTCAAACTTCTGGG - Intergenic
1087705988 11:101492371-101492393 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1087782981 11:102320473-102320495 GAGGCTGGTCTCAAACACCTGGG + Intronic
1088252489 11:107873144-107873166 CAGGCTGGTCTCCAACTCGTGGG + Intronic
1088886777 11:114013905-114013927 CAGGCTAGTCTCCAACTTGTGGG - Intergenic
1089272409 11:117311143-117311165 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1090854385 11:130598867-130598889 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
1091757532 12:3064296-3064318 CAGGCTGGTCTCAAACTTGTAGG + Intergenic
1092207160 12:6621784-6621806 CAGGCTGGTCCCCAACTCCTAGG - Intronic
1092337897 12:7650025-7650047 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1092782954 12:12004201-12004223 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1096160290 12:49370922-49370944 CAGGCTGGTCCCCAACTCTTGGG + Intronic
1096857451 12:54494653-54494675 GAAGATGGTCCCCACCAAGTTGG + Intergenic
1097201125 12:57279590-57279612 TAGGCTGGTCTCAAACTTGTGGG - Intronic
1100252563 12:92843367-92843389 TAGGCTGGTCCCCAACTCCTGGG + Intronic
1100769926 12:97910514-97910536 CAGGCTGGTCTCCAACCTCTGGG + Intergenic
1102333336 12:112055482-112055504 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1103287879 12:119817862-119817884 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1103422134 12:120795151-120795173 CAGGCTGGTCTCAAACATCTGGG + Intronic
1103464034 12:121127828-121127850 CAGGCTGGTCCCAAACTTCTGGG + Intergenic
1105841570 13:24258454-24258476 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1106082807 13:26514594-26514616 GAGGCTGGGTTTCAACATGTTGG - Intergenic
1107473982 13:40717162-40717184 GAGGCTGGGTCTCACCATGTTGG - Intergenic
1108196753 13:48002458-48002480 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
1108255756 13:48609736-48609758 AAGTCTGCTGCCCAACATGTTGG + Intergenic
1108558108 13:51616031-51616053 TAGGCTGGTCCCGAACTTCTGGG - Intronic
1108576941 13:51799016-51799038 GAGGCTGGACCCCAGCAAGGAGG + Intronic
1110169592 13:72484756-72484778 GAGGCTGGTCTCCAACTCCTGGG - Intergenic
1110746295 13:79057297-79057319 GAGGCAGGGCTCCACCATGTTGG - Intergenic
1111706219 13:91752293-91752315 CAGGCTGGTCTCCAACTTCTAGG + Intronic
1112006943 13:95261885-95261907 CAGGCTGGTCTCGAACATTTGGG - Intronic
1112355923 13:98675011-98675033 CAGGCTGGTCTCCAACTTCTAGG + Intergenic
1112497801 13:99918563-99918585 GAGGCAGATCCCCAAGATGAGGG - Intergenic
1113215393 13:108034835-108034857 AAAGCTGGTCCCCAAAAAGTTGG + Intergenic
1115072616 14:29343137-29343159 GAGGCTGGTCTCGAACTTTTGGG + Intergenic
1115221052 14:31058784-31058806 CAGGCTGGTCCCCAACTTCTGGG + Intronic
1115573667 14:34690519-34690541 CAGGCTGGTCCCCAACTCCTGGG + Intergenic
1117097722 14:52314778-52314800 GAGGCAGGTCCCGAGCAGGTCGG - Exonic
1117386617 14:55220557-55220579 CAGGCTGGTCTCAAACATCTAGG + Intergenic
1119094965 14:71821377-71821399 GAGGCTGGTACCGAACTTCTGGG + Intergenic
1119288033 14:73471929-73471951 CAGGCTGGTCTCAAACTTGTGGG - Intergenic
1119766683 14:77194790-77194812 GAAGCTGGTCTCTAACTTGTGGG + Intronic
1120932064 14:89858708-89858730 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1122338776 14:101010883-101010905 GAGGCTGGCCACCAAAATGTTGG - Intergenic
1123430881 15:20215300-20215322 CAGGCTGGTCTCCAACTTTTGGG + Intergenic
1125496426 15:40198876-40198898 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1125588328 15:40838080-40838102 GAGGCTGGTCTCTAACTTCTGGG - Intergenic
1126013625 15:44328267-44328289 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1126028622 15:44474036-44474058 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1126615941 15:50579982-50580004 CAGGCTGGTCCCCAACACCTGGG + Intronic
1127551523 15:60043490-60043512 GGGTCAGGTGCCCAACATGTGGG - Intronic
1127588623 15:60400697-60400719 CAGGCTGGTCCCGAACTTCTGGG + Intronic
1127990385 15:64110610-64110632 GAGGCTGGTCTCCAACTCCTGGG + Intronic
1128826710 15:70724870-70724892 GAGGCTGGTCTCAAACTTCTGGG - Intronic
1129142971 15:73618624-73618646 CAGGCTGGTCTCCAAAGTGTTGG - Intronic
1129354991 15:74984380-74984402 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1129809145 15:78492768-78492790 CAGGCTGGTCTCCAACACATGGG + Intronic
1130346539 15:83052288-83052310 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1130434882 15:83887799-83887821 CAGGCTGGTCTCCAACTGGTGGG + Intronic
1131031825 15:89192757-89192779 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1131274559 15:90970080-90970102 GAGATAGGTCCCCTACATGTGGG - Intronic
1133061040 16:3174847-3174869 CAGGCTGGTCCCCAACCCCTGGG + Intergenic
1133114886 16:3572496-3572518 TAGGCTGGTCTCCAACTTCTGGG + Intronic
1133201105 16:4205110-4205132 TAGGCTGGTCTCCAACTTTTGGG - Intronic
1133997306 16:10758258-10758280 CAGGCTGGTCCCGAACTCGTGGG - Intronic
1134367992 16:13597026-13597048 CAGGCTGGTCTCAAACTTGTAGG - Intergenic
1135949441 16:26900018-26900040 CAGGCTGGTCTCAAACTTGTGGG - Intergenic
1136853768 16:33635930-33635952 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
1137682618 16:50363843-50363865 CAGGCTGGTCCCAAACTTCTGGG - Intronic
1137989764 16:53142310-53142332 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1138080662 16:54087590-54087612 CAGGCTGGTCTCGAACTTGTTGG - Intronic
1138517661 16:57545474-57545496 CAGGCTGGTCTCCAACACCTGGG - Intronic
1138555400 16:57768137-57768159 GAGGCTGGGCTTCACCATGTTGG - Intronic
1138559550 16:57792670-57792692 CAGGCTGGTCCCGAACTTGTGGG - Intronic
1138570268 16:57866804-57866826 CAGGCTGGTCTCAAACTTGTGGG + Intergenic
1138570392 16:57868052-57868074 CAGGCTGGTCTCGAACTTGTGGG + Intergenic
1138591770 16:58003212-58003234 GAGGCTGGTCTCAAACACCTGGG - Intronic
1138657492 16:58499652-58499674 GGGTCTGGTCCCCAAGATGTTGG + Intronic
1140045433 16:71437573-71437595 GATGCTGGTCCCCAGCCTGGTGG - Intergenic
1140231278 16:73119315-73119337 TAGGCTGGTCTCCAACTTCTGGG + Intergenic
1140505270 16:75467851-75467873 CAGGCTGGTCTCAAACTTGTGGG + Intergenic
1140786304 16:78345408-78345430 CAGGCTGGTCTCCAACACCTGGG - Intronic
1142326652 16:89419961-89419983 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1142551712 17:744833-744855 GGAGCTGGGCCCCAACATGGCGG - Exonic
1142885347 17:2909206-2909228 GAGGCTGGGCCCGGACATGGAGG + Intronic
1143495847 17:7312243-7312265 GGGGCTGGTCCCCAGTCTGTTGG - Exonic
1144044419 17:11442126-11442148 GAGGTTGCTCACCAACATTTTGG + Intronic
1144821158 17:18075667-18075689 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
1146410927 17:32584108-32584130 GAAGATGGTCCCCAAAAGGTAGG - Intronic
1146499735 17:33354166-33354188 GAGTCTGTCCCACAACATGTGGG + Intronic
1146900411 17:36582087-36582109 CAGGCTGGTCTCCAGCTTGTGGG + Intronic
1147061181 17:37879788-37879810 GAGGCTGGTCTCGAACATCTGGG - Intergenic
1147238238 17:39073235-39073257 CAGGCTGGTCTCCAACTCGTGGG + Intronic
1147291362 17:39446122-39446144 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1147291763 17:39449389-39449411 TAGGCTGGTCTCCAACTTGTGGG + Intronic
1147595472 17:41714381-41714403 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1147619066 17:41851693-41851715 GAGGCTGGTCTCCAACTCCTGGG - Intergenic
1147944900 17:44075388-44075410 GAGGCTGGTGCCTAGCATGAGGG - Exonic
1148391423 17:47275777-47275799 GAGGCAGCTGCCCAACATCTGGG + Intronic
1148410470 17:47462233-47462255 AAGGCTGGTCTCGAACATCTGGG - Intergenic
1148436277 17:47688434-47688456 CAGGCTGGTCTCCAACTTCTAGG - Intergenic
1150010776 17:61501279-61501301 CAGGCTGGTCTCGAACATCTGGG - Intergenic
1150305184 17:64078792-64078814 TAGGCTGGTCTCCAACTTCTGGG - Intronic
1151143389 17:72016676-72016698 GAGGCTGTTCCTCAATATGCTGG + Intergenic
1151213194 17:72560095-72560117 CAGGCTGGTCTCAAACTTGTGGG + Intergenic
1152437860 17:80287147-80287169 CAGGCTGGTCTCCAACACCTAGG - Intronic
1152702204 17:81824693-81824715 GTGGCTGGACCCCAGCCTGTGGG - Exonic
1153301078 18:3592626-3592648 CAGGCTGGTCTCCAACACCTGGG - Intronic
1153535440 18:6097460-6097482 GAGGCTGGACCCCTGCATTTTGG + Intronic
1153783066 18:8511165-8511187 CAGGCTGGTCTCCAACTAGTGGG + Intergenic
1153888298 18:9487725-9487747 GAGGCTGGTCTCGAACTTCTGGG + Intronic
1154025676 18:10705386-10705408 GATGCTGGACCCCAGCTTGTCGG + Exonic
1155541148 18:26869597-26869619 GAGAGTGGTCACCAAAATGTTGG - Intergenic
1156123062 18:33868252-33868274 CAGGCTGGTCTCGAACATCTGGG + Intronic
1156416281 18:36894733-36894755 CAGGCTGGTCCCGAACTTCTGGG + Intronic
1157480433 18:48050324-48050346 GAGGCTGGAACCAGACATGTGGG + Intronic
1157527676 18:48397332-48397354 GAGCTTGGCCCCCATCATGTTGG + Intronic
1158457875 18:57623326-57623348 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1159806637 18:72964960-72964982 GAGACTGGGTCCCATCATGTTGG + Intergenic
1160803937 19:983219-983241 CAGGCTGGTCTCCAACACCTGGG - Intergenic
1161155098 19:2728440-2728462 CAGGCTGGTCTCCAACTTGTGGG + Intronic
1161352935 19:3803848-3803870 GTGGCTGCTCCCCAAGGTGTGGG - Intergenic
1161466808 19:4435578-4435600 CAGGCTGGTCCCCAACTCCTGGG + Intronic
1161471354 19:4458187-4458209 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
1161822525 19:6539059-6539081 TAGGCTGGTCTCCAACTTCTGGG + Intergenic
1161829555 19:6592416-6592438 CAGGCTGGTCTCAAACATCTGGG + Intronic
1162446120 19:10723879-10723901 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1162929663 19:13951423-13951445 CAGGCTGGTCTCCAACACCTGGG - Intronic
1163007795 19:14407308-14407330 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1164253073 19:23501260-23501282 GAGGCTGGTCTCAAACTTTTGGG + Intergenic
1165035620 19:33031587-33031609 GAGGCTGGTCTCCAACTCCTGGG + Intronic
1165096402 19:33412131-33412153 CAGGCTGGTCTCGAACTTGTGGG - Intronic
1165258603 19:34595160-34595182 GAGGCTGGTCCCCAACATGTAGG - Exonic
1165308534 19:35016959-35016981 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1165546422 19:36540581-36540603 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1166085043 19:40468886-40468908 CAGGCTGGTCTCAAACATCTGGG - Intronic
1166136907 19:40783219-40783241 GAGGCTGGTCTCCAACTCCTGGG - Intronic
1166910402 19:46150875-46150897 CAGGCCGGTCTCCAACTTGTAGG + Intronic
1166979440 19:46624028-46624050 GAAGCTGGTGCCCAGCAGGTCGG + Exonic
1167136167 19:47617184-47617206 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1167347952 19:48958304-48958326 CAGGCTGGTCTCCAACAGGGAGG + Intronic
1167456418 19:49598607-49598629 CAGGCTGGTCTCGAACATCTGGG - Intronic
1167881882 19:52465919-52465941 GAGGCTGGTCCCCAACAGCTTGG - Intronic
926064529 2:9827024-9827046 CAGGCTGGTCCCAAACCTCTGGG - Intergenic
926195485 2:10761296-10761318 GAGACTGGTTCCCAGCTTGTGGG + Intronic
927833638 2:26373097-26373119 CAGGCTGGTCTCAAACTTGTGGG + Intronic
928380298 2:30811796-30811818 CAGGCTGGTCTCAAACTTGTGGG - Intronic
928524864 2:32129786-32129808 TAGGCTGGTCTCCAACTTCTGGG - Intronic
928739105 2:34328745-34328767 GAGGTTGGGCCCGATCATGTGGG - Intergenic
929468562 2:42169106-42169128 GAAGCTGGTTCCAAACAGGTGGG - Intergenic
929546443 2:42857897-42857919 CAGGCTGGTCTCGAACGTGTGGG - Intergenic
929603036 2:43216759-43216781 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
929989591 2:46774449-46774471 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
930017783 2:46982751-46982773 CAGGCTGGTCTCAAACTTGTGGG - Intronic
931367112 2:61628670-61628692 CAGGCTGGTCTCCAACACCTGGG + Intergenic
932458126 2:71862611-71862633 CAGGCTGGTCTCCAACTTATGGG + Intergenic
932866041 2:75344125-75344147 TGGGCTGGTGCCCATCATGTAGG + Intergenic
933316862 2:80726280-80726302 GAGGAGGTACCCCAACATGTTGG + Intergenic
937644022 2:124245953-124245975 CAGGCTGGTCTCCAACTCGTAGG + Intronic
937961735 2:127465275-127465297 CAGGCTGGTCACCAACTTCTGGG - Intronic
938382275 2:130843391-130843413 GAGGCTGGTCTCCTGCATGGTGG + Intronic
939046962 2:137261021-137261043 TAGGCTGGTCTCAAACTTGTGGG + Intronic
939823769 2:146988914-146988936 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
941477801 2:165970225-165970247 GAGCCTAGTCCCCAAAATATTGG + Intergenic
941867526 2:170350207-170350229 CAGGCTGATCTCCAACTTGTGGG + Intronic
942455235 2:176133613-176133635 GAGGCTGTTCCCCAGCCTCTTGG - Intergenic
942807244 2:179946237-179946259 CAGGCTGGTCTCCAACTTCTGGG - Intronic
943381312 2:187152434-187152456 GAGGCTGGTCTCAAATTTGTGGG + Intergenic
944228005 2:197367382-197367404 GAGGCTGGTCTCAAACTTCTGGG - Intergenic
944638158 2:201694828-201694850 CAGGCTGGTCTCCAACTTCTGGG + Intronic
944668968 2:201979672-201979694 CAGGCTGGTCCCGAACAGGCTGG + Intergenic
945281793 2:208042331-208042353 CAGGCTGGTCTCAAACTTGTGGG - Intergenic
948971916 2:241435314-241435336 CAGGCTGGTCTCAAACATGTGGG + Intronic
949016469 2:241714804-241714826 CAGGCTGGTCTCAAACATCTGGG + Intronic
1169705257 20:8496280-8496302 GAGGCTGGTCTCGAACTTCTGGG - Intronic
1172052499 20:32129280-32129302 CAGGCTGGTCCCAAACTTCTGGG - Intronic
1172257007 20:33527933-33527955 AAGGCTGGTCTCCAACTTCTGGG + Intronic
1173495477 20:43514755-43514777 GAGGCGGGCCCCCAACAGGCGGG + Exonic
1173740448 20:45396462-45396484 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1174256489 20:49259637-49259659 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1175081165 20:56421484-56421506 CAGGCTGGTCTCCAACAGCTGGG - Intronic
1175101592 20:56583114-56583136 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1175284013 20:57825340-57825362 GAGGCTGGCCTTCAACATCTGGG - Intergenic
1176703685 21:10092428-10092450 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
1177165572 21:17599388-17599410 GAGGCTGGTCCCAAACTCCTAGG + Intronic
1177261594 21:18736158-18736180 CAGGCTGGTCCCCAACTCCTGGG - Intergenic
1177609000 21:23421692-23421714 CAGGCTGGTCTCAAACGTGTGGG - Intergenic
1177780957 21:25621978-25622000 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1178424264 21:32466869-32466891 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1178570959 21:33736773-33736795 CAGGCTGGTCTCCAACACCTGGG - Intronic
1179330805 21:40399058-40399080 CAGGCTGGTCTCAAACTTGTAGG - Intronic
1179528111 21:41997130-41997152 CAGGCTGGTCTCCAACTCGTGGG + Intronic
1180935118 22:19620379-19620401 CAGGCTGGTCTCGAACATCTGGG - Intergenic
1183877339 22:40794961-40794983 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1184083747 22:42245292-42245314 CAGGCTGGTCTCCAACACCTGGG + Intronic
1184820448 22:46905762-46905784 CAGGCTGTTCCTCAACCTGTGGG + Intronic
949238153 3:1836185-1836207 GAGGCTGTTCTCCAACTTCTGGG + Intergenic
949741470 3:7239209-7239231 CAGGCTGGTCTCCAACTTCTGGG + Intronic
949832069 3:8225663-8225685 CAGGCTGGTCTCGAACTTGTGGG + Intergenic
950386796 3:12666391-12666413 CAGGCTGGTCTTCAACATCTGGG - Intergenic
950637968 3:14329325-14329347 CAGGCTGGTCTCCAACAACTGGG - Intergenic
952353594 3:32564088-32564110 CAGGCTGGTCCCCAACTCCTGGG - Intronic
952485058 3:33801576-33801598 CAGGCTGGTCTCCAACTCGTGGG - Intronic
955100812 3:55848005-55848027 CAGGCTGGTCTCCAACCTCTGGG + Intronic
955404220 3:58615683-58615705 CAGGCTGGTCTCCAACTTCTGGG - Intronic
956082233 3:65569664-65569686 CAGGCTGGTCTCCAACTTCTGGG - Intronic
956210834 3:66799619-66799641 GAGGCTGGTTCCAAAGATGGTGG + Intergenic
956622646 3:71236657-71236679 CAGGCTGGTCTCCAACTTCTGGG - Intronic
956734795 3:72230115-72230137 AAGGCAGGTGGCCAACATGTAGG - Intergenic
957047869 3:75390415-75390437 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
957679149 3:83409016-83409038 CAGGCTGGTCTCAAACATCTGGG + Intergenic
959737815 3:109680615-109680637 GAGGCAGGACCCCTAAATGTTGG + Intergenic
961166432 3:124766861-124766883 GAGGCTGGTGCCCACCGTGGTGG + Intronic
961252049 3:125515449-125515471 CAGGCTGGTCTCAAACATCTGGG - Intronic
962558009 3:136575433-136575455 TAGGCTGGTCTCGAACATCTGGG + Intronic
962797900 3:138864674-138864696 CAGGCTGGTCCCCAACTCCTGGG + Intergenic
962989097 3:140562480-140562502 GGGACTGGTCCCCAAGATGCTGG - Intronic
963785312 3:149528579-149528601 CAGGCTGGTCTCGAACTTGTGGG - Intronic
963971982 3:151440238-151440260 AAGGCTGGTCTCCAACTTCTGGG + Intronic
963993220 3:151677552-151677574 GAGGCTGGTCCCAAACCTCTGGG + Intergenic
966136395 3:176704043-176704065 GAGGCGGGTTTTCAACATGTTGG - Intergenic
968640094 4:1710049-1710071 GAGGCTGGTCCCCAACAATGGGG + Intronic
968678174 4:1896958-1896980 GAGGCTGGTCTCCAACTCCTGGG - Intronic
968862852 4:3186254-3186276 AAGACTGGTCCCCAAAATGTTGG + Intronic
969034755 4:4244263-4244285 CAGGCTGGTCTCAAACTTGTGGG - Intronic
969260433 4:6030130-6030152 GAGACTGGACCAAAACATGTAGG + Intronic
970879207 4:20908284-20908306 GAGGCAGGGCTTCAACATGTTGG + Intronic
972543722 4:40060813-40060835 TAGGCTGGTCACAAACTTGTGGG + Intronic
972562397 4:40240265-40240287 GAGGCTGGTCCCGAACTCCTGGG - Intronic
973029132 4:45312953-45312975 CAGGCTGGTCTCAAACTTGTGGG - Intergenic
974227110 4:59060506-59060528 GAGGCTGTTTCCCATCATGTGGG + Intergenic
974729155 4:65838627-65838649 GAGGCTGATCCTCAAACTGTGGG + Intergenic
975266367 4:72373686-72373708 CAGGCTGGTCTCAAACATCTGGG - Intronic
976090780 4:81455224-81455246 CAGGCTGGTCTCCAACTTTTGGG - Intronic
976601679 4:86943612-86943634 CAGGCTGGTCCCGAAAATGCTGG - Intronic
976767097 4:88609074-88609096 CAGGCTGGTCCCCAACTCCTTGG - Intronic
977232505 4:94468362-94468384 CAGGCAGGTCTCAAACATGTGGG + Intronic
979307056 4:119158343-119158365 CAGGCTGGTCTCAAACTTGTGGG - Intronic
979855957 4:125635068-125635090 CAGGCTGGTCTCCAACTTCTAGG - Intergenic
979906668 4:126301682-126301704 GAGGTTTGTCTCCAACATGTGGG + Intergenic
980375899 4:131948780-131948802 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
982841597 4:160194783-160194805 AGGGTTGGTCCCAAACATGTGGG + Intergenic
983086002 4:163445322-163445344 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
983224106 4:165070116-165070138 GAGGCTGGTCTCCAACTCCTAGG + Intergenic
983767266 4:171499795-171499817 GAGGCTTGTGCCAGACATGTTGG - Intergenic
984139107 4:175980147-175980169 CAGGCTGGTCTCCAACTAGTGGG - Intronic
984895923 4:184539535-184539557 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
985248445 4:187999340-187999362 GAGGCTGGTCACCAACTCCTGGG + Intronic
986552960 5:8979116-8979138 GAGGCTGGTCTCCAACTCCTGGG - Intergenic
986677723 5:10201470-10201492 GAGGCTGGTTCTGAGCATGTGGG + Intergenic
987366732 5:17155309-17155331 GAGGCTGGCCCCCTACATTTAGG - Intronic
988824213 5:34918090-34918112 CAGGCTGGTCTCCAACACCTGGG - Intronic
989313385 5:40048020-40048042 CAGGCTGGTCTCGAACTTGTGGG - Intergenic
989326752 5:40205641-40205663 TAGGCTGGTTTCAAACATGTAGG - Intergenic
990373706 5:55148501-55148523 CAGGCTGGTCCCGAACACCTGGG - Intronic
991048114 5:62244254-62244276 CAGGCTGGTCTCCAACTTTTGGG + Intergenic
991701673 5:69322193-69322215 CAGGCTGGTCTCCAACTCGTGGG + Intronic
991713451 5:69430424-69430446 CAGGCTGGTCTCAAACATCTGGG + Intronic
992509241 5:77416864-77416886 GAAAGTGGTCCCCAAGATGTTGG - Intronic
992637432 5:78738504-78738526 CAGGCTGGTCTCCAACACCTGGG + Intronic
992967897 5:82021834-82021856 GAGACTGGGTCTCAACATGTTGG - Intronic
994641165 5:102411473-102411495 CAGGCTGGTCCCCAACTCCTGGG + Intronic
996051798 5:118943012-118943034 CAGGCTGGTCTCAAACTTGTGGG + Intronic
996634879 5:125677544-125677566 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
996873881 5:128220195-128220217 CAGGCTGGTCTCAAACATCTTGG + Intergenic
997350550 5:133228014-133228036 CAGGCTAGTCTCGAACATGTGGG - Intronic
997629581 5:135356664-135356686 GAGGCTGGCCCCCACCATTTAGG + Intronic
998249950 5:140545808-140545830 CAGGCTGGTCTCAAACTTGTGGG - Intronic
1000068644 5:157719095-157719117 CAGGCCGGTCTCCAACTTGTGGG - Intergenic
1001447444 5:171796814-171796836 GAGGCTGGGCACCCACATCTGGG - Intergenic
1001660325 5:173386564-173386586 GAGGCTGGTCTCAAACTTCTGGG - Intergenic
1001788011 5:174430615-174430637 GAGGCTGGTCCCCAGGCTCTAGG + Intergenic
1002033127 5:176445636-176445658 TAGGCTGGTCCCCAACTCCTAGG + Intergenic
1002659345 5:180780650-180780672 CAGGCTGGTCCCAAACTTCTAGG - Intergenic
1002705846 5:181160527-181160549 GAGGCTGGTTCCGAAAGTGTGGG + Intergenic
1002711335 5:181196946-181196968 CAGGCTGGTCTCCAACACCTGGG - Intronic
1002756765 6:168268-168290 GAGGCAGGTTCTCACCATGTTGG - Intergenic
1003495559 6:6660603-6660625 GGAGCTTGTCCACAACATGTAGG - Intergenic
1003591872 6:7443569-7443591 GAGGCTGGTCTCCAACACCTGGG + Intergenic
1004645281 6:17554466-17554488 CAGGCTGGTCCCGAACTTCTGGG + Intronic
1004778479 6:18876199-18876221 CAGGCTGGTCTCCAACACCTGGG + Intergenic
1005037720 6:21572087-21572109 GAGGCTGGTCTCAAACACCTGGG + Intergenic
1005396761 6:25390530-25390552 CAGGCTGGTCTCCAACTTTTGGG + Intronic
1005452736 6:25990061-25990083 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG + Intergenic
1006151108 6:31990499-31990521 GAGGCTGGTCCCCAACATTCTGG - Intronic
1006157409 6:32023237-32023259 GAGGCTGGTCCCCAACATTCTGG - Intronic
1006328659 6:33373460-33373482 CAGGCTGGTCTCCAACACCTGGG - Intergenic
1006539119 6:34725176-34725198 CAGGCTGGTCTCAAACATCTGGG + Intergenic
1007853123 6:44824447-44824469 GAGGCTGGTCTCCAACTCCTAGG - Intronic
1007912072 6:45525782-45525804 GAGGCTGGTCTCCAACTGCTGGG - Intronic
1008042787 6:46819539-46819561 GAGGTTGGTGACCAACATGTGGG + Exonic
1008525692 6:52404651-52404673 GTGGCTGGTCCTCACCCTGTTGG + Exonic
1008573310 6:52835717-52835739 GAGGCTGGTGCCCAGGATGCTGG - Intronic
1008657807 6:53633626-53633648 AAGGCTGGTCTCCAACTTCTGGG + Intergenic
1010197242 6:73252252-73252274 CAGGCTGGTCTCTAACTTGTGGG + Intronic
1011465351 6:87650264-87650286 CAGGCTGGTCTCAAACATCTGGG + Intronic
1011622427 6:89255594-89255616 AAGGCAGGTCCCCACCATGCCGG - Intergenic
1018093093 6:160362650-160362672 GAGGCCGGTCCCCAGCGGGTGGG + Intronic
1019398763 7:838542-838564 GACGCTGGGCCCCAGCATCTGGG + Intronic
1020183312 7:5939370-5939392 CAGGCTGATCCCCAACACCTGGG - Intronic
1020314980 7:6899233-6899255 CAGGCTGGTCTCCAACTTCTGGG - Intergenic
1022523510 7:31022849-31022871 GAGGGTGGTCCCCAGGGTGTGGG - Intergenic
1022858991 7:34346000-34346022 CAGGATGGTCTCCAAAATGTTGG + Intergenic
1024924806 7:54601380-54601402 CAGGCTGGTCGCCCTCATGTGGG - Intergenic
1025114379 7:56245268-56245290 GAGGCAGGGTCTCAACATGTTGG - Intergenic
1026294747 7:69041590-69041612 GAGGCAGGGCCTCACCATGTTGG + Intergenic
1026429077 7:70326032-70326054 GAGGCTGGTCCCCATCAGCAGGG - Intronic
1026938301 7:74271668-74271690 CAGGCTGGTCCCGAACTTCTGGG + Intergenic
1028446663 7:90932292-90932314 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1029130722 7:98328634-98328656 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1029482360 7:100820936-100820958 GAGGCAGGTTTCCACCATGTTGG - Intronic
1030814192 7:114013985-114014007 CAGGCTGGTCTCAAACATCTGGG + Intronic
1031861893 7:126989729-126989751 CAGGCTGGTCTCAAACATCTGGG - Intronic
1031880877 7:127196930-127196952 CAGGCTGGTCTCAAACCTGTTGG + Intronic
1031986101 7:128165814-128165836 GAGGCTGGCCCCCAAAAAGATGG - Intergenic
1033145434 7:138867011-138867033 CAGGCTGGTCTCCAACACCTGGG + Intronic
1033327828 7:140393958-140393980 CAGGCTGGTCCCGAACTCGTGGG - Intronic
1033936201 7:146588717-146588739 CAGGCTGGTTTCCAACTTGTGGG + Intronic
1034043007 7:147899127-147899149 TAGGCTGGTCTCCAACTTTTGGG - Intronic
1034367162 7:150561067-150561089 GAGGCTGGACCCCAACAAAAGGG - Intergenic
1036421720 8:8602354-8602376 CAGGCTGGTCTCGAACTTGTGGG - Intergenic
1037469593 8:19194428-19194450 CAGGCTGGTCCCGAACTCGTGGG + Intergenic
1037848248 8:22303787-22303809 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1038326283 8:26575198-26575220 GAGGCTGGTCTCCAACTCTTGGG + Intronic
1040757581 8:50797983-50798005 GAGGCTGGTCTCGAACTTTTGGG + Intergenic
1041794084 8:61728068-61728090 CAGGCTGGTCTCAAACATCTGGG - Intergenic
1041843121 8:62294753-62294775 CAGGCTGGTCTCCAACTGGTGGG + Intronic
1045081498 8:98630429-98630451 CAGGCTGGTCTCGAACACGTGGG - Intronic
1045087744 8:98705208-98705230 CAGGCTGGTCTCCAACTTCTGGG - Intronic
1047225080 8:122949631-122949653 CAGGCTGGTCTCCAACACCTGGG - Intronic
1047285455 8:123483854-123483876 GAGGCTGGTCCCAAACTCCTGGG - Intergenic
1047608010 8:126493773-126493795 CAGGCAGGTCCTCAACACGTGGG + Intergenic
1049568086 8:143353202-143353224 TAGGCTGGTCTCAAACTTGTGGG - Intronic
1050380384 9:5021841-5021863 GAGGCTTGTCTCCAACTTCTGGG + Intronic
1051152265 9:14095443-14095465 GAGGCTGGAAATCAACATGTGGG - Intronic
1052538181 9:29774765-29774787 GAGGCAGGTCCTCAGTATGTAGG + Intergenic
1053640950 9:40079448-40079470 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
1053765188 9:41386020-41386042 CAGGCTGGTCTCCAACTCGTGGG - Intergenic
1054321638 9:63675429-63675451 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
1054543802 9:66297182-66297204 CAGGCTGGTCTCCAACTCGTGGG - Intergenic
1054797489 9:69316267-69316289 CAGGCTGGTCCCCAACTCCTGGG - Intergenic
1055392910 9:75842599-75842621 GAGGCTGGTGGCCAACATATTGG + Intergenic
1055522452 9:77095219-77095241 CAGGCTGATCTCCAACATTTAGG + Intergenic
1055830389 9:80371700-80371722 GGGGCAGGTCCCCCATATGTGGG - Intergenic
1058402789 9:104636896-104636918 GAGCCTGGTCCCCAAGAGGCAGG - Intergenic
1058482387 9:105409472-105409494 GAGGCTGGTCTCGAACACCTAGG - Intronic
1059203020 9:112436062-112436084 CAGGCTGGTCTCCAACTCGTGGG - Intronic
1059207752 9:112482654-112482676 CAGGCTGGTCCCAAACACCTGGG + Intronic
1060154905 9:121312836-121312858 CAGGCTGGTCTCCAACTTCTGGG + Intronic
1060726032 9:126006519-126006541 GAGGCTGGTCCCCAGGAGGAAGG - Intergenic
1060965188 9:127708288-127708310 GAGACTGGGCTTCAACATGTTGG - Intronic
1061938670 9:133872480-133872502 GAGGCTGTGCCCCCACATGCTGG - Intronic
1062418823 9:136469058-136469080 GAGGCTGGTCTCGAACACCTGGG + Intronic
1202788722 9_KI270719v1_random:62523-62545 CAGGCTGGTCTCCAACTCGTGGG + Intergenic
1185786996 X:2899196-2899218 CAGGCTGGTCTCCAACACCTGGG - Intergenic
1186735799 X:12462776-12462798 CAGGCTGGTCTCCAACACCTGGG - Intronic
1187080629 X:15983094-15983116 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1187448957 X:19380383-19380405 CAGGCTGGTCTCCAACACCTGGG - Intronic
1189162772 X:38827504-38827526 CAGGCTGGTCTCCAACACCTGGG - Intergenic
1189802307 X:44702874-44702896 CAGGCTGGTCTCAAACATATGGG - Intergenic
1190892619 X:54583851-54583873 CAGGCTGGTCTCCAACTTCTGGG + Intergenic
1192196453 X:69031936-69031958 GAGGCTGGTCCCCAGAATATGGG + Intergenic
1192783262 X:74315049-74315071 CAGGCTGGTCCCCAACTCCTGGG - Intergenic
1195589870 X:106612105-106612127 GAGGCTGGTCCCTCACATGCAGG + Exonic
1195805376 X:108759510-108759532 CAGGCTGGTCACAAACTTGTGGG - Intergenic
1196394733 X:115247202-115247224 CAGGCTGGTCTCAAACACGTGGG + Intergenic
1196937119 X:120741053-120741075 GAGACTGGTTCTCACCATGTTGG + Intergenic
1197196194 X:123703675-123703697 CAGGCTGGTCCCAAACTTTTGGG - Intronic
1197237952 X:124089495-124089517 GAGACTGGTTCCCAACCTATGGG - Intronic
1197743897 X:129917740-129917762 CAGGCTGGTCTCAAACTTGTGGG + Intronic
1200688220 Y:6276851-6276873 GAGGCTGGGCTTCACCATGTTGG - Intergenic
1201047047 Y:9897837-9897859 GAGGCTGGGCTTCACCATGTTGG + Intergenic
1201347474 Y:13000530-13000552 GAAGCTGGTCCCCAACATTCTGG - Intergenic
1201632907 Y:16089631-16089653 CAGGCTGGTCTCAAACATCTAGG - Intergenic