ID: 1165258604

View in Genome Browser
Species Human (GRCh38)
Location 19:34595175-34595197
Sequence CCTACGGGTAGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 2, 1: 17, 2: 24, 3: 18, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165258604_1165258614 4 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258614 19:34595202-34595224 CCGAAGTCTGGTGGTGACAAAGG 0: 1
1: 6
2: 13
3: 30
4: 152
1165258604_1165258609 -8 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30
1165258604_1165258611 -5 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258611 19:34595193-34595215 GTAGGGTACCCGAAGTCTGGTGG 0: 2
1: 13
2: 19
3: 11
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258604 Original CRISPR CCTACGGGTAGTGTTGAGGC TGG (reversed) Exonic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
907454664 1:54567653-54567675 CCTGCGGGCAGTGTAGAGGGAGG - Intronic
914862437 1:151397868-151397890 CCTAAGGACAGTGTTGAGGATGG + Intergenic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
916821021 1:168398935-168398957 CCTATGGGTAGTGATGGGCCAGG - Intergenic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
921908883 1:220527284-220527306 CCTACAGGATGTCTTGAGGCAGG + Intergenic
923361656 1:233217894-233217916 CTTACGTGTATTGGTGAGGCGGG + Exonic
1064928228 10:20593866-20593888 CCCAGGGGCAGTATTGAGGCTGG - Intergenic
1066494818 10:35932636-35932658 CCTACAGGTAGAGGTGAGGTGGG + Intergenic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1066795194 10:39112443-39112465 AATACAGGTTGTGTTGAGGCTGG + Intergenic
1068885726 10:62094776-62094798 TCTACTGGTAGTGTTGCGGGAGG - Exonic
1069321178 10:67173412-67173434 CCTATGGGGAGTGTTGGAGCTGG - Intronic
1072310287 10:94147786-94147808 CCTACAGGTAGACTAGAGGCAGG - Intronic
1073009760 10:100349948-100349970 CCTACAGGGGGTGCTGAGGCTGG - Intronic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1097825599 12:64172337-64172359 CCTAGAGGTAGTGTTGGGGGTGG - Intergenic
1100424497 12:94471354-94471376 GCTACGGGGGGTGCTGAGGCAGG - Intergenic
1102195364 12:111021559-111021581 CCTAAGGGTAGGGAGGAGGCAGG - Intergenic
1102516403 12:113449777-113449799 CCTGCTGCTAGTCTTGAGGCTGG + Intergenic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1108493254 13:51001481-51001503 CCCAGGGGTAGTGACGAGGCTGG + Intergenic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1125511349 15:40294043-40294065 CCAACGGGAAGGGCTGAGGCTGG - Intronic
1127142583 15:55993225-55993247 CCTTCAGGAAGTGTTGAGGAGGG - Intronic
1130162070 15:81411573-81411595 CCTACAGTTATTGTTGAAGCAGG + Intergenic
1130379102 15:83356721-83356743 CCACCGGGGAGGGTTGAGGCAGG + Intergenic
1133646191 16:7766879-7766901 CCTGCAGGTAGTGTTGAGGAGGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1138171291 16:54852105-54852127 CCTGCGGTAACTGTTGAGGCTGG - Intergenic
1142174794 16:88640160-88640182 CCCAAGGGTAGTGTTGGGGGAGG - Exonic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1144669545 17:17125227-17125249 CCCAGGGTCAGTGTTGAGGCAGG + Intronic
1146197206 17:30824193-30824215 CATGCGGGTAGTGATGAGTCGGG - Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1149474236 17:56945825-56945847 CCTACTGGAAAGGTTGAGGCAGG - Intronic
1151803295 17:76390410-76390432 CCAAGGGATAGTGTTGACGCTGG + Exonic
1153541624 18:6161721-6161743 CCTCGGGGCAGTGTTGAGCCGGG - Intronic
1153791290 18:8582148-8582170 CCCAAGGGTTGAGTTGAGGCAGG + Intergenic
1157795468 18:50570433-50570455 ACCAAGGGAAGTGTTGAGGCAGG + Intronic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1162423969 19:10582935-10582957 GCTACGGGGAAGGTTGAGGCAGG - Intronic
1164086716 19:21909304-21909326 CCTCCGGGCAGGGCTGAGGCAGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
943586865 2:189751262-189751284 CCTTGTGGCAGTGTTGAGGCTGG - Intronic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1170596157 20:17807149-17807171 CCCACGGGGAATGTTGTGGCGGG + Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
950172229 3:10846850-10846872 CCTGGGGTCAGTGTTGAGGCAGG - Intronic
956334321 3:68146263-68146285 CCCAGGGGTTCTGTTGAGGCTGG + Intronic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
964455845 3:156865198-156865220 CATTAAGGTAGTGTTGAGGCTGG + Intronic
965765708 3:172128089-172128111 CCTACGGGTTGTGTTGAGCAAGG + Intronic
967140569 3:186555001-186555023 CCGACTGGTAGTGATGAGCCAGG - Exonic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
968284772 3:197502085-197502107 CCTGCCTTTAGTGTTGAGGCTGG - Intergenic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969944315 4:10767361-10767383 ACTAGAGGTAGTTTTGAGGCAGG + Intergenic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
973914025 4:55614958-55614980 CCTACGGAATGGGTTGAGGCAGG + Intronic
977741659 4:100491493-100491515 CCTATGGGGAGCCTTGAGGCAGG - Intronic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
986859291 5:11906462-11906484 CCTACAGATACTGTTGGGGCTGG + Intergenic
990601235 5:57360555-57360577 GAGGCGGGTAGTGTTGAGGCTGG + Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
993096629 5:83486020-83486042 CCTACTGGGAGGGCTGAGGCAGG + Intronic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1001511058 5:172322233-172322255 CCTACAGGAAGTGGGGAGGCTGG + Intergenic
1004138215 6:12989585-12989607 CCTACAGGCAGTGTTGAGACTGG - Intronic
1004600029 6:17140540-17140562 CCTTCAGGTAGTTATGAGGCAGG + Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1029815464 7:103090074-103090096 CCTACAGGTAGAGTTGGGGAAGG + Intronic
1034367165 7:150561082-150561104 CCCGCAGGTAGTGTTGAGGCTGG - Intergenic
1034863530 7:154621056-154621078 CATAGGGGTAGTATTGAGGTAGG - Intronic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1040329283 8:46377725-46377747 ACTAAGGGAAATGTTGAGGCAGG + Intergenic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1061056654 9:128226258-128226280 CCTGCGGGTAGCCGTGAGGCCGG - Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1189510249 X:41654894-41654916 ACTTGGGGTAATGTTGAGGCAGG + Intronic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1196797120 X:119511260-119511282 CCTACCTGCAGTGTAGAGGCAGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1200669083 Y:6065078-6065100 GCTACTGGGAGGGTTGAGGCAGG + Intergenic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic