ID: 1165258604

View in Genome Browser
Species Human (GRCh38)
Location 19:34595175-34595197
Sequence CCTACGGGTAGTGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 2, 1: 17, 2: 24, 3: 18, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165258604_1165258609 -8 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30
1165258604_1165258614 4 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258614 19:34595202-34595224 CCGAAGTCTGGTGGTGACAAAGG 0: 1
1: 6
2: 13
3: 30
4: 152
1165258604_1165258611 -5 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258611 19:34595193-34595215 GTAGGGTACCCGAAGTCTGGTGG 0: 2
1: 13
2: 19
3: 11
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258604 Original CRISPR CCTACGGGTAGTGTTGAGGC TGG (reversed) Exonic