ID: 1165258609

View in Genome Browser
Species Human (GRCh38)
Location 19:34595190-34595212
Sequence CCCGTAGGGTACCCGAAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 4, 1: 14, 2: 17, 3: 8, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165258603_1165258609 7 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30
1165258604_1165258609 -8 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258609 Original CRISPR CCCGTAGGGTACCCGAAGTC TGG Exonic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1075012984 10:118890824-118890846 TCTCTAGGGTACCCGAAGTGAGG - Intergenic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1078538860 11:12197604-12197626 CACATAGGTTCCCCGAAGTCAGG - Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1128991932 15:72267977-72267999 CCGGTAGGTCACCTGAAGTCGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1142509693 17:385893-385915 CCCCGAGGGTCCCCGAGGTCGGG + Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG + Exonic
1154399890 18:14026224-14026246 CCAGGAGGGGACCCGCAGTCTGG - Intergenic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1161982535 19:7637396-7637418 CCCTTTGGGTCCCCGGAGTCCGG - Intronic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG + Intergenic
926226225 2:10968707-10968729 CCTGTAAGCTACTCGAAGTCGGG - Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1179780706 21:43699027-43699049 CCCACAGCGTACCCGAAGTTCGG - Intergenic
1182275885 22:29188348-29188370 GCCGGAGGCTACCCGAAGCCAGG - Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
955770287 3:62378476-62378498 CCGGGAGGGTACCCGAAACCTGG - Intergenic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
962679530 3:137783993-137784015 CCGGGAGGATACACGAAGTCAGG + Intergenic
968660717 4:1797716-1797738 CCTGTAGGGACCCCGCAGTCAGG - Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1010105800 6:72165861-72165883 CCAGTAGGATACCAGAGGTCAGG - Intronic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1187647178 X:21360495-21360517 CTCTTAGGGTACCAGATGTCTGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic