ID: 1165258609

View in Genome Browser
Species Human (GRCh38)
Location 19:34595190-34595212
Sequence CCCGTAGGGTACCCGAAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 4, 1: 14, 2: 17, 3: 8, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165258604_1165258609 -8 Left 1165258604 19:34595175-34595197 CCAGCCTCAACACTACCCGTAGG 0: 2
1: 17
2: 24
3: 18
4: 61
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30
1165258603_1165258609 7 Left 1165258603 19:34595160-34595182 CCTACATGTTGGGGACCAGCCTC 0: 1
1: 0
2: 5
3: 27
4: 431
Right 1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG 0: 4
1: 14
2: 17
3: 8
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258609 Original CRISPR CCCGTAGGGTACCCGAAGTC TGG Exonic