ID: 1165258777

View in Genome Browser
Species Human (GRCh38)
Location 19:34596246-34596268
Sequence CTGTGGCTGAGCAGGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1320
Summary {0: 1, 1: 1, 2: 8, 3: 138, 4: 1172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165258777 Original CRISPR CTGTGGCTGAGCAGGGAGGA TGG Exonic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900242086 1:1621958-1621980 CTGCAGGTGAGCAGTGAGGAGGG - Intronic
900398057 1:2461362-2461384 CTGTCCTTCAGCAGGGAGGAGGG + Intronic
901001601 1:6151628-6151650 CTGTGGCTGAGCAGCGGGCCTGG + Intronic
901032150 1:6313440-6313462 TTGTGGCTGAGCAGGGTGTGGGG - Intronic
901083523 1:6597101-6597123 CTGTGCCGGAGCACAGAGGAGGG - Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901577701 1:10214028-10214050 CGGAGGCTGAGTGGGGAGGATGG + Intronic
901590208 1:10335039-10335061 AGGTGGCTGAGGTGGGAGGATGG - Intronic
901797390 1:11688183-11688205 CTGTGGCAGAGAAGAGATGATGG - Intronic
901808579 1:11752804-11752826 GAGTGGCTGAGCAGAGAGGGTGG + Intronic
902165093 1:14563709-14563731 CTGTGGCAGGGCTGAGAGGATGG - Intergenic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902328310 1:15717143-15717165 CAGGGGCTGAGGTGGGAGGATGG + Intronic
902380299 1:16049450-16049472 ATGAGGCTGGGCAGGGAGGCAGG + Intronic
902471114 1:16647986-16648008 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
902487689 1:16759459-16759481 CTGCGGGTGAGACGGGAGGAGGG - Intronic
902782859 1:18716016-18716038 CTGGGGCTGAGGTGGGAGCAGGG - Intronic
902953094 1:19903150-19903172 AGGAGGCTGAGCTGGGAGGATGG - Intronic
903060408 1:20664861-20664883 CTCTGGCTGGGCAGGGGGGCGGG - Intronic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
903545179 1:24119468-24119490 CTGTGGGGGATCAGGGAGGCTGG + Intergenic
903641932 1:24866074-24866096 GGGTGGCTGAGTGGGGAGGATGG + Intergenic
903645906 1:24896436-24896458 GTGTCGCTGAGCTGGGAGGATGG - Intergenic
903646109 1:24897358-24897380 CCGGGGCTGAGGAGGGAGGCAGG + Intergenic
903940737 1:26929331-26929353 GGGTGGCTGAGATGGGAGGATGG + Intronic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904026938 1:27509870-27509892 TTGTTGCTGAGCTGGGAGAAGGG + Intergenic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904314355 1:29650656-29650678 CGGTGGGTGGGCAGGGTGGAGGG + Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904883170 1:33715677-33715699 CCGTGGCTGAGAAAGGTGGAGGG + Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905507495 1:38491567-38491589 GGGAGGCTGAGCTGGGAGGATGG + Intergenic
906474238 1:46157236-46157258 GGGTGGCTGAGGTGGGAGGATGG - Intronic
906485366 1:46230467-46230489 GGGTGGCTGAGGTGGGAGGATGG - Intergenic
906533580 1:46538724-46538746 CAGTGCCTGAGCAGGAGGGAGGG + Intergenic
906557248 1:46723646-46723668 CTATGGCTGAGGTGGGGGGAAGG + Intergenic
906592093 1:47034813-47034835 ATGTGGCTGAGAAATGAGGAGGG - Intronic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
907053175 1:51343450-51343472 CTGTGTCTGAGAAGAAAGGAGGG - Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
907852220 1:58266504-58266526 GTGAGGCTCAGCAGGGAGAAAGG - Intronic
908590106 1:65621939-65621961 ATGTGCCTGGTCAGGGAGGATGG + Intronic
909349174 1:74629575-74629597 CTGTAGCTGGGCATGGAGGAGGG - Intronic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910359332 1:86398982-86399004 GTGTGGCAGACCAGGGATGAAGG - Intergenic
910413543 1:86972454-86972476 TTGGGGCTGAGCCAGGAGGATGG - Intronic
910457539 1:87413535-87413557 CTGCGGCTGGGCATGGTGGAAGG - Intergenic
910638955 1:89439683-89439705 CTGGGGGAGAGCAGGCAGGATGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911799922 1:102122977-102122999 CTGTGGCGGTGAAGAGAGGATGG + Intergenic
912369752 1:109164776-109164798 CTCAGGCTGGGCAGGGAGGATGG + Intronic
912473898 1:109923871-109923893 CTGTGGCTGAGCAGAGAGGGTGG - Exonic
912474313 1:109925832-109925854 CTGTGGCTAGGCAGGGAGCTGGG - Intronic
912490403 1:110059665-110059687 CTTTGGCTGTGCTGGGAGGCAGG - Intronic
912714313 1:111971622-111971644 CTGGAGCTTAGCAGGGAGAAAGG - Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912866545 1:113262856-113262878 CTGTGGCTGAAGAGGGGGAAAGG + Intergenic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912988453 1:114458660-114458682 GAGTGGCTGAGCAAGGAGGATGG - Intronic
913214501 1:116609349-116609371 CGGAGGCTGAGGTGGGAGGATGG - Intronic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914706049 1:150170735-150170757 CAGTGACTGAGCAGAGTGGAGGG + Intergenic
914810601 1:151024837-151024859 CTGTCCCTGAGAAGGGAGGGTGG + Intronic
914958042 1:152182309-152182331 ATGTGGTGGACCAGGGAGGAAGG + Intergenic
915000116 1:152581293-152581315 GGGAGGCTGAGCAGGGAGAATGG - Intronic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915426019 1:155827579-155827601 GGGGGGCTGAGCTGGGAGGATGG + Intronic
915467125 1:156104317-156104339 CAGTTGCTAAGCAAGGAGGAAGG - Intronic
915564851 1:156707546-156707568 GCATTGCTGAGCAGGGAGGATGG - Intergenic
915580108 1:156808496-156808518 CTCAGGCTGAGCAGGGAGCCTGG + Intronic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
915777125 1:158502005-158502027 CTCTGGCTGAGGCGGGAGAATGG - Intergenic
917100870 1:171443685-171443707 CGGGGGCTGAGGTGGGAGGATGG + Intergenic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917436167 1:175023493-175023515 CTGGGGCGGAGCTGGGAGGTGGG + Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
919102562 1:193112465-193112487 ATGGGGCTGAGGTGGGAGGATGG - Intergenic
919938884 1:202272905-202272927 TTGTGGCTGAGCTGAGAAGATGG - Intronic
919951649 1:202369898-202369920 GGGTGGCTGAGGTGGGAGGATGG - Intronic
919962536 1:202485984-202486006 GTGAGGCTGAGATGGGAGGACGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920696646 1:208185891-208185913 CTGTGGGTGAGCAGGAGGGCAGG + Intronic
920808474 1:209257716-209257738 CAGTTGGTCAGCAGGGAGGAAGG - Intergenic
921006441 1:211098214-211098236 GGGTGGCTGAGATGGGAGGATGG + Intronic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921289202 1:213639464-213639486 CTGGGGTGGAGCAGGGAGGGAGG + Intergenic
921318433 1:213914446-213914468 GTGCTGCTGAGCAGGCAGGATGG - Intergenic
921336508 1:214092377-214092399 CTGTGGCTGAGCCAGGAAGCGGG + Intergenic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921708872 1:218353437-218353459 GAGGGGCTGAGCAAGGAGGAGGG - Intronic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922721563 1:227902634-227902656 GTGGGGCTGACCAGGGAGGGAGG + Intergenic
922755746 1:228095996-228096018 CTGTGGCTCATCTGGGATGATGG + Intronic
922901217 1:229138266-229138288 CTCTGGTTGAGCTGGGAGGAAGG - Intergenic
922916040 1:229258669-229258691 ATGTGTCTGAACAGGAAGGAAGG - Intergenic
923220526 1:231888631-231888653 CGGTGGCTGAGGTGGGAGAATGG + Intronic
923672051 1:236049372-236049394 GGGAGGCTGAGCTGGGAGGATGG + Intronic
923844896 1:237719150-237719172 GGGTGGCTGAGGTGGGAGGATGG + Intronic
923953959 1:238993728-238993750 AGGAGGCTGAGAAGGGAGGATGG - Intergenic
924332476 1:242953891-242953913 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062833047 10:618794-618816 GTGTGGCTGAGCAGTGCGGGAGG - Intronic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063411493 10:5840041-5840063 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064283993 10:13976301-13976323 CAGTGGCTGACCTGGGAGGGAGG + Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1064898651 10:20269483-20269505 TTCTGGCTAAGCAGAGAGGAAGG + Intronic
1065502121 10:26392504-26392526 CTGTGGATGAACAGACAGGAAGG - Intergenic
1065716062 10:28569658-28569680 CTGTGGCTGGGCAAGGAGGTTGG + Intronic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066336333 10:34481978-34482000 CTGTAGCTGAGCATGGTGGGGGG - Intronic
1066498399 10:35965112-35965134 GAGTGGCTGAGGTGGGAGGATGG - Intergenic
1066626328 10:37409578-37409600 GAGTGGCTGAGATGGGAGGATGG - Intergenic
1067429139 10:46231357-46231379 CTGTGGGTGGCCAGGGTGGAGGG + Intergenic
1067582542 10:47454583-47454605 CCTAGGCTGGGCAGGGAGGATGG + Intergenic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1067936128 10:50613557-50613579 ATGTGGCAGGGCAGAGAGGATGG - Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069506488 10:69002781-69002803 CGGGGGCTGAGGTGGGAGGATGG + Intronic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1069898327 10:71692641-71692663 CAGGGGCTGAGCAGGGAGCTGGG - Intronic
1069903373 10:71718526-71718548 TTGAGTCTGAGCAGGGAGGAGGG + Intronic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070768918 10:79071034-79071056 CCGTGGCAGAGCAGAGAGGAGGG - Intronic
1070794282 10:79207848-79207870 CGGTGGCTGGGCAGTCAGGAAGG + Intronic
1070800363 10:79241799-79241821 CTGAGGCTGAGAAGAGGGGATGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070959404 10:80488217-80488239 CAGTGGCTGAACAGTGGGGAAGG - Intronic
1071345137 10:84685115-84685137 TTGTGGGTGACCAGGGAGCATGG + Intergenic
1071968563 10:90878247-90878269 CTGTGCTTGAGCAGGTAAGAGGG - Intronic
1072449764 10:95530716-95530738 CTCTGGCTAAGCTGGGAGGAGGG - Intronic
1072475890 10:95759370-95759392 CCTTGGCTGAGCAGGGAGTAGGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072702733 10:97655677-97655699 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1072804021 10:98412858-98412880 CTGTGGCTGAGCACGGAAGGAGG + Intronic
1073141388 10:101250634-101250656 CCGGGGCTGAGGTGGGAGGAGGG - Intergenic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073516298 10:104078243-104078265 CAGGGGCTGAGGAGAGAGGAGGG + Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074129727 10:110563346-110563368 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1074211161 10:111336464-111336486 CTGTGACTGCCCAGGGTGGATGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1075226139 10:120630957-120630979 AGGAGGCTGAGTAGGGAGGATGG - Intergenic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075450811 10:122550937-122550959 CTATGCCTGACCAGTGAGGAGGG - Intergenic
1075578291 10:123596870-123596892 CTGTGCCTAAGAATGGAGGAGGG + Intergenic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076310332 10:129501794-129501816 CTGTGGTAGACCAGGGAGGCAGG + Intronic
1076364050 10:129910793-129910815 CTGCTGCTGAACAGGGAGGCTGG - Intronic
1076367855 10:129933882-129933904 GTGGGGCTGAGCAGAGAGGAGGG - Intronic
1076371005 10:129953661-129953683 CTGTGGCTGCCCAGGCAGGCCGG - Intronic
1076594432 10:131617243-131617265 CGGTGGCCGAGCGAGGAGGACGG - Intergenic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076717894 10:132375768-132375790 CCGTAGCTGGGCAGGGAGCAGGG - Exonic
1076725331 10:132410451-132410473 CTGTGCGGGAGCAGGAAGGAGGG + Intronic
1076746201 10:132515940-132515962 CTCTGGCAGAGCTGGGAGGCTGG + Intergenic
1077072798 11:684726-684748 CTGTGACGTATCAGGGAGGAGGG + Intronic
1077266788 11:1654882-1654904 CTGAGGCTGGGCAGGGGGTAGGG + Intergenic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077551435 11:3202237-3202259 TTGAGGCTGAGCTGGCAGGAGGG + Intergenic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1079027498 11:16960688-16960710 CTGTGGCTGAGCAGGGACCCAGG - Intronic
1079129336 11:17738310-17738332 CTGTGGCTGAGCTGTGGGGAGGG + Intronic
1079131188 11:17747793-17747815 CTGGGGCTGGCCAGGGTGGAAGG - Intronic
1079320494 11:19447886-19447908 CTGGGGGTGAGCATGGAGGCGGG - Intronic
1079610760 11:22430072-22430094 CTGTGGCTGAGCACAGAAGGTGG + Intergenic
1080637835 11:34139246-34139268 ATGAGGCTGACCAGGGAGGCTGG + Exonic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081629082 11:44675679-44675701 GGGTGGCTGAGATGGGAGGATGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082797549 11:57388972-57388994 CTGAGGCTGAGGTGGGAGCATGG - Intronic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1083198660 11:61106246-61106268 CTTTGGCTGGGCAGGCAGGGAGG + Intronic
1083306425 11:61764290-61764312 CTGGGGCTGGGAAGTGAGGACGG + Intronic
1083332304 11:61904659-61904681 CTGTGGCAGACCAGGGAGGCAGG + Intronic
1083563642 11:63694575-63694597 CGGAGGCTGAGGTGGGAGGACGG - Intronic
1083651932 11:64209005-64209027 CTAAGGCCGGGCAGGGAGGATGG + Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083843715 11:65318962-65318984 ATGTGTCAGAGCAGGGAGGCAGG + Intronic
1084303033 11:68263769-68263791 TTGTGGGTGAGCTGGGAGCAAGG + Exonic
1084376770 11:68783222-68783244 TTCTGGTTGGGCAGGGAGGAGGG - Intronic
1084931808 11:72561988-72562010 CTGGGGTGGAGCAGGGTGGATGG - Intergenic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1085047792 11:73363430-73363452 GTGTGGCTGGGCACTGAGGATGG + Exonic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085455528 11:76663395-76663417 CAGTGGCTGAGCTGGTAGGGAGG + Intronic
1085534835 11:77211604-77211626 CTGGGGGTGAGAAGGGAGGTCGG + Intronic
1085634662 11:78149272-78149294 CTCTGGGGGAGCAGGGAGGCGGG - Intergenic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086065924 11:82744793-82744815 GGGAGGCTGAGCCGGGAGGATGG + Intergenic
1086496043 11:87405485-87405507 CAGTGGCTGAGCAGTGGGGCTGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086693789 11:89820196-89820218 CTTTGTCTGCGCTGGGAGGAAGG + Intergenic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087941719 11:104105237-104105259 TTGTAGCTGAGCAAGAAGGAGGG + Intronic
1088071897 11:105797102-105797124 CAGAGGCTGAGATGGGAGGATGG + Intronic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1088896431 11:114082173-114082195 GGGTGGCTGAAGAGGGAGGATGG + Intronic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089416522 11:118296613-118296635 CTGTGGCAGACTAGGGAGAAAGG + Intergenic
1089417522 11:118304735-118304757 CTGAGGCTGGGAGGGGAGGAGGG - Exonic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089581461 11:119484128-119484150 GAGTGGCTGGGCATGGAGGAGGG + Intergenic
1089681323 11:120120512-120120534 GTGGGGCTGTGCAGGCAGGAGGG - Intronic
1090076666 11:123584206-123584228 CGGAGGGTGGGCAGGGAGGAGGG - Intronic
1090093722 11:123723689-123723711 CTGAGCGTGAGCAGGGAGGTTGG - Intergenic
1090188275 11:124752067-124752089 CTGTGCCTGAGTGGTGAGGAGGG - Exonic
1091138842 11:133217939-133217961 GGGAGGCTGAGCGGGGAGGATGG + Intronic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091495156 12:966079-966101 CAGAGGCTGAGTTGGGAGGATGG - Intronic
1091822801 12:3489307-3489329 CTGTGACTAACCAGGGAGGAGGG - Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092118130 12:6024073-6024095 GGGTGGCTGAGCAGGGAGGTAGG - Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092824612 12:12386789-12386811 GTATGGGTGGGCAGGGAGGAAGG - Intronic
1092878781 12:12871797-12871819 CGGAGGCTGAGTGGGGAGGATGG - Intergenic
1093776578 12:23082635-23082657 CTGTTGCTGAGAAGTGAAGAAGG + Intergenic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1095099571 12:38166277-38166299 CTGTGGCTGAGCTGGTAGCCAGG + Intergenic
1095834770 12:46625545-46625567 GGGAGGCTGAGCTGGGAGGATGG + Intergenic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096168910 12:49450352-49450374 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1096490496 12:52010249-52010271 CTCTGGCTGGGCGGGAAGGAAGG + Intronic
1096571266 12:52524629-52524651 CTGGGGCTGAGCAGGAAGGGAGG + Intergenic
1096681227 12:53256690-53256712 GGGAGGCTGAGAAGGGAGGATGG - Intergenic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097929833 12:65170609-65170631 CGGCCGCGGAGCAGGGAGGAGGG + Exonic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1101182566 12:102235376-102235398 GTGGGGCTGGGCAGGGAGGGTGG - Intergenic
1101207276 12:102501197-102501219 CGGAGGCTGAGGCGGGAGGATGG + Intergenic
1101403882 12:104411627-104411649 CTGGGGCTGAGCAGAGGGGTCGG - Intergenic
1101478102 12:105070591-105070613 CTGTGCCTGGGCAGGATGGATGG + Exonic
1101773065 12:107769410-107769432 AGGAGGCTGAGCTGGGAGGATGG + Intergenic
1101962832 12:109262723-109262745 CTCAGGCTGAGATGGGAGGATGG - Intronic
1101966285 12:109284399-109284421 CTGGGGCTGGGCTGGGAGGAGGG + Intronic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102770023 12:115467694-115467716 CAGGGGCTGAGCAAGGAGTATGG + Intergenic
1102988667 12:117299016-117299038 CTGGGGCTGAGCTGGGCAGAGGG + Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103097214 12:118141627-118141649 GTGGGGCTGAGGTGGGAGGATGG + Intronic
1103202640 12:119100845-119100867 CTGAGGCTGAGCAGGATGGAAGG + Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103320998 12:120092924-120092946 CTGGGGCTGGACAGGGAGGTGGG - Intronic
1103370797 12:120417708-120417730 AGGAGGCTGAGCTGGGAGGATGG - Intergenic
1103497961 12:121377499-121377521 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1103531096 12:121602401-121602423 CTGAGGCTGAGCCAGGAGAATGG - Intergenic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103856249 12:123972901-123972923 CTGTGGCGGGGCAGGGGCGAAGG + Intronic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104772727 12:131373881-131373903 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104924469 12:132306653-132306675 CTGGCTCTGAGCAGGGGGGAAGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1105218230 13:18302821-18302843 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1105746659 13:23383502-23383524 CTGGGGCTGTTCAGGAAGGAGGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106166010 13:27246970-27246992 CAGTGGCTGAGGCAGGAGGATGG + Intergenic
1107015365 13:35704663-35704685 CTGTGCCAGCTCAGGGAGGAGGG - Intergenic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1107553787 13:41499978-41500000 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108599197 13:51975836-51975858 CTGTGGCTGAGCCGAGGGGCGGG + Intronic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1109854022 13:68105705-68105727 GTGTGGGGGAGCAGGTAGGAGGG - Intergenic
1110277970 13:73660996-73661018 CTGTGGGAGAGCACTGAGGATGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1111929062 13:94495199-94495221 AGGAGGCTGAGCTGGGAGGATGG - Intergenic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112142861 13:96665065-96665087 AGGAGGCTGAGCTGGGAGGATGG + Intronic
1112200502 13:97269480-97269502 CCCTGGATGAGCAGGGAGGAAGG - Intronic
1112280175 13:98056037-98056059 CTGTGGCTGGGCAGGTGGGCAGG + Intergenic
1112558426 13:100490722-100490744 CTGTGGCTGGCCAGGGAGCAGGG - Intronic
1112993700 13:105546037-105546059 ACTTGGCTGAGCTGGGAGGATGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113415455 13:110125251-110125273 CGGTGGCTCAGCGGGGTGGATGG + Intergenic
1113541067 13:111110170-111110192 CCCTGGCTGAGCAGGCAGCATGG + Intergenic
1113886708 13:113664855-113664877 CATTGGGTGAGCAGGCAGGAAGG + Intergenic
1113924712 13:113935107-113935129 CTCGGGCTGTGCTGGGAGGAAGG - Intergenic
1113924973 13:113936498-113936520 CTCGGGCTGTGCTGGGAGGAAGG - Intergenic
1114390647 14:22304301-22304323 CTGTTCCTGAGCATGCAGGAGGG + Intergenic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114466861 14:22929245-22929267 CTGTGGCCAAGCAGGGGTGAGGG - Exonic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114671588 14:24414638-24414660 CACTGGCTGAGCTGGGAGGAAGG - Exonic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117619407 14:57569196-57569218 CTCTGGCTGAGAATGGAGAATGG - Intronic
1117839640 14:59846287-59846309 CTGTAGGTGAGCAAGGAGGAGGG - Intronic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119415471 14:74466627-74466649 CTGGGCTTGAGCTGGGAGGAAGG + Intergenic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119723275 14:76905983-76906005 TGATGGCTGAGCAGGTAGGAAGG + Intergenic
1119768654 14:77206390-77206412 CTGGGGTGGAGCAGGGAGGGAGG + Intronic
1119840997 14:77792950-77792972 GGGAGGCTGAGTAGGGAGGATGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120921645 14:89760964-89760986 AGATGGCTGAGCAGTGAGGAAGG + Intergenic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1120997269 14:90426312-90426334 ATGTGGTTGAGCCCGGAGGATGG - Intergenic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121322392 14:92999576-92999598 CTGAGGCCCAGCAAGGAGGAGGG - Intronic
1121762217 14:96455378-96455400 GTGAGGCTGAGCTGGGAGGATGG + Intronic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122207782 14:100156794-100156816 GCCTGGCAGAGCAGGGAGGAGGG + Intronic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122366802 14:101199215-101199237 CCGTGGCTGGGCAGGGGGCAGGG + Intergenic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122954510 14:105064299-105064321 GTGTGGTGGAGCAGGGAGGTTGG - Intronic
1122960437 14:105091613-105091635 CAGTGCCTGAGCAGAGCGGACGG - Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123067817 14:105627159-105627181 CTGGGGCCGAGCAGAGGGGATGG - Intergenic
1123071835 14:105645884-105645906 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123072659 14:105649258-105649280 CTGGGGCTGAGCAGAGGGGATGG + Intergenic
1123091499 14:105744160-105744182 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123097267 14:105772501-105772523 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123479403 15:20617091-20617113 GTGTCACAGAGCAGGGAGGAAGG + Intergenic
1123494109 15:20807262-20807284 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1124011749 15:25844702-25844724 CGGTGGGCGAGCAGTGAGGAGGG + Intronic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1124895185 15:33769842-33769864 GGGTGGCTGAGGTGGGAGGATGG + Intronic
1125594446 15:40875304-40875326 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125687064 15:41569853-41569875 CTGTCTCTGACCAGGTAGGAAGG + Intronic
1125919816 15:43518674-43518696 CAGAGGCTGAGCAGGCAGGAGGG - Intronic
1126119722 15:45240831-45240853 CATTGCCTGAGCAAGGAGGATGG + Intergenic
1126751053 15:51876956-51876978 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1126808110 15:52373629-52373651 CTGTGACTGGACAGGGTGGAAGG - Intronic
1127045401 15:55020146-55020168 CTTTGGCTGATTAGGGAGTAAGG - Intergenic
1127456513 15:59160512-59160534 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1127785043 15:62348341-62348363 TTGTGGCTGAGCAGGGCTGGAGG - Intergenic
1128286719 15:66443189-66443211 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1128466646 15:67918287-67918309 CTGTGACTGTGCTGGCAGGAGGG + Intergenic
1128740251 15:70078838-70078860 CTCTGGGAGAGCAGGGAGGCAGG + Intronic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129035539 15:72646473-72646495 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129102177 15:73275548-73275570 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1129168128 15:73790919-73790941 CCGTGGATGAGCAGGGAGACTGG - Intergenic
1129214345 15:74090743-74090765 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129391063 15:75221182-75221204 CTGTGTCTGGGCAGGGAGTGGGG - Intergenic
1129394913 15:75238437-75238459 CTAAGGCTGGGCAGGGAGGCAGG - Intergenic
1129473244 15:75766687-75766709 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129519734 15:76178111-76178133 CTGTGGCTGACCAGAGAGTTTGG + Intronic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1129731487 15:77935093-77935115 CTGTGTCTGGGCAGGGAGTGGGG + Intergenic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132514483 16:359862-359884 CTGAGGCTGCCCAGGGAGGTGGG - Intergenic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132762729 16:1518799-1518821 CTGTGGCAGAGCAGGGTGTGTGG + Intronic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132797049 16:1729739-1729761 GCGTGGCTGAGCAGGGATGTGGG + Intronic
1132859835 16:2064719-2064741 TGTTGGCTGGGCAGGGAGGACGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133027091 16:2993196-2993218 CTGGTCCTGAGCAGAGAGGAAGG + Intergenic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133259516 16:4538903-4538925 CTGGGGCTGAGCACGTGGGATGG + Intergenic
1133388012 16:5386403-5386425 GCGTGGCTCAGCAGTGAGGATGG - Intergenic
1133670071 16:8009910-8009932 ATGTTGGTGAGCAGAGAGGAGGG - Intergenic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1134232897 16:12442831-12442853 GTGAGGCTGAGATGGGAGGACGG - Intronic
1134550163 16:15135217-15135239 CAGTAGATGAGCAGGGAGGTTGG + Intronic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134718305 16:16367778-16367800 CAGTAGATGAGCAGGGAGGCTGG - Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134829658 16:17312983-17313005 CCGGGGCTGAGCAGGGAAGCTGG + Intronic
1134906124 16:17981310-17981332 CAGTGGATGGGCAGGAAGGATGG - Intergenic
1134956447 16:18384381-18384403 CAGTAGATGAGCAGGGAGGCTGG + Intergenic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1136254416 16:29028778-29028800 CTCTGGCTGGGCTGGGCGGAAGG + Intergenic
1136293788 16:29290631-29290653 TTGTGGCTGGGCTGGGAGGCCGG - Intergenic
1136467835 16:30457369-30457391 CTGTGGCAGAGCTGGGGAGAAGG - Intergenic
1136471108 16:30480890-30480912 CGGAGGCTGACGAGGGAGGATGG + Intronic
1136495534 16:30641239-30641261 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1136518234 16:30780663-30780685 CCCTGGCTGGGCAGGGAGAAAGG + Exonic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1137041800 16:35620058-35620080 CTGTGGTGGAGCAGGGTGGGGGG + Intergenic
1137249926 16:46733787-46733809 CTGAGTCTCAGCAGGGAGGCAGG + Intronic
1137360872 16:47813939-47813961 CTGTGCGTGAGCAGTGAGCAGGG - Intergenic
1137571759 16:49570928-49570950 CTGGGGTAGAGCAGGCAGGAGGG + Intronic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138486327 16:57346670-57346692 AGGAGGCTGAGAAGGGAGGATGG + Intergenic
1138516820 16:57540675-57540697 CTGGGACCGAGCAGGGAGGTGGG + Intergenic
1138533839 16:57649351-57649373 CCCTGGCTGACCAAGGAGGAGGG + Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1138658524 16:58504112-58504134 CTATGGCTGAGCAGAGGGGCCGG - Intronic
1138794155 16:59947373-59947395 AGGTGGCTGAGGTGGGAGGATGG - Intergenic
1139222238 16:65195439-65195461 CTGGGGCTGAGTAGGGAGAGGGG - Intergenic
1139511978 16:67432718-67432740 CTGAGGCAGAGTAGGGGGGAAGG + Intronic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140168517 16:72579625-72579647 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1140261921 16:73388028-73388050 CGGATGCTGAGCTGGGAGGAGGG + Intergenic
1140334907 16:74095972-74095994 GGGAGGCTGAGCTGGGAGGATGG - Intergenic
1141028329 16:80568429-80568451 GTGTGGTTGAGTAGGGAGGGTGG - Intergenic
1141028386 16:80568599-80568621 ATGTGGCTGAGTGGGGAGGGTGG - Intergenic
1141175119 16:81713640-81713662 GCGGGGCAGAGCAGGGAGGAAGG - Intergenic
1141458868 16:84164418-84164440 TTGGGGCTGAGGAGGTAGGAGGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141704417 16:85656793-85656815 GTGTGGCTGAACATGGAGTAGGG + Intronic
1141820491 16:86442224-86442246 GTCTGGCAGGGCAGGGAGGACGG + Intergenic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141844887 16:86601547-86601569 CTGGGGCTGAGCAGGGCAGGAGG + Intergenic
1141965125 16:87436993-87437015 GTGGGGCTGACCAGGGAGGGAGG - Intronic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142099686 16:88264677-88264699 GTGTGGCTGGGCTGGGAGGCCGG - Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142325999 16:89415051-89415073 GGGAGGCTGAGCGGGGAGGAAGG - Intronic
1142419704 16:89962858-89962880 CTGTGGCTGTGCAGGGCTGGTGG + Intronic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1142592315 17:1011789-1011811 CTGTGTCTGAGCAGGCTGGTGGG - Intronic
1142620815 17:1164769-1164791 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1142713678 17:1736712-1736734 CTGTGACTGAGAATGGAGGGAGG - Intronic
1143038580 17:4015845-4015867 TTGTGCCTGGGCAGGGAGGTAGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143461617 17:7108034-7108056 CTGTGGCAGTGCAGGGAGCCTGG - Intronic
1143557693 17:7672474-7672496 GGGAGGCTGAGCTGGGAGGATGG + Intronic
1144050199 17:11491541-11491563 GGGTGGCTGAGGTGGGAGGATGG - Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1144717472 17:17444511-17444533 CTGTCCCTGGGAAGGGAGGAAGG - Intergenic
1144751260 17:17649709-17649731 GGGAGGCTGAGCGGGGAGGATGG + Intergenic
1144871592 17:18375544-18375566 CTGAGTCTGAACAGGGAGGAAGG - Intergenic
1145018963 17:19415468-19415490 CCCTGGCTGAGAAGGAAGGAAGG + Intronic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1145277353 17:21440536-21440558 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145315191 17:21726431-21726453 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145713622 17:26998367-26998389 GTGAGGGTGAGCTGGGAGGAAGG + Intergenic
1145768151 17:27473481-27473503 TTCTGGCTGAGCAGGAAGGTGGG + Intronic
1146003108 17:29143335-29143357 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146497759 17:33338072-33338094 TTCTGGCAGGGCAGGGAGGATGG + Intronic
1146798237 17:35798062-35798084 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1147307482 17:39573874-39573896 CTGTGGCTGGCCAGGCAGGGCGG + Intergenic
1147458355 17:40552748-40552770 CTGTGGAGGAGCAGGGAGAGAGG - Intergenic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1147786770 17:42984072-42984094 GGGAGGCTGAGCTGGGAGGATGG - Intronic
1147933385 17:43996790-43996812 GGGTGGCTGAGGTGGGAGGATGG - Intronic
1147936017 17:44011638-44011660 CTGTCCCTGAGAAGGGAGTATGG - Exonic
1147976845 17:44252908-44252930 GGGCGTCTGAGCAGGGAGGAAGG - Intronic
1148169710 17:45508775-45508797 ATGTGGCTCAGCATGGAGCAGGG + Intergenic
1148237546 17:45979060-45979082 CTGTGGCTGATCCAGGAGCAAGG + Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148279496 17:46337039-46337061 ATGTGGCTCAGCATGGAGCAGGG - Intronic
1148301713 17:46554895-46554917 ATGTGGCTCAGCATGGAGCAGGG - Exonic
1148365646 17:47053885-47053907 ATGTGGCTCAGCATGGAGCAGGG - Intergenic
1148503001 17:48106188-48106210 CAAGGGCTGAGGAGGGAGGATGG + Intronic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149449229 17:56736922-56736944 GGGAGGCTGAGCTGGGAGGATGG + Intergenic
1149526166 17:57357468-57357490 CTGGGGCAGAGCAGGAGGGAGGG - Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149746805 17:59106708-59106730 CGGCGGCTGAGCCGGGAGAAAGG - Exonic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150530605 17:65977552-65977574 ATGTGGCAGAGAAGGGAAGATGG + Intronic
1150565453 17:66335230-66335252 CGGAGGCTGAGACGGGAGGATGG - Intronic
1150885862 17:69084888-69084910 CAGTGGCAGAGCAGGGATGAGGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151163604 17:72185903-72185925 TGGTGGCTGAGCAGGCAGGAGGG + Intergenic
1151396458 17:73826374-73826396 CTGTCCCTGAGCAGGGTGGATGG + Intergenic
1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG + Exonic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152550523 17:81027757-81027779 CTGGAGCTGGGCAGGGTGGAGGG - Intergenic
1152554023 17:81044174-81044196 CCGTGGCTGAGCAAGCAGGGAGG - Intronic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1152800636 17:82329206-82329228 CTGTGGCTGTGCAGGGCCCAGGG - Intronic
1152853523 17:82650529-82650551 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
1152854344 17:82655668-82655690 CTGTGGCACAGCAGAGAGAAGGG + Exonic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153609457 18:6868570-6868592 GTGTGCCTGAGCAGTGAGTAGGG - Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153966778 18:10189801-10189823 TTGTGGCTGAGCAGAGGGGCCGG + Intergenic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154368420 18:13733208-13733230 CTTTGGCTGAAAAGGGAGGTAGG + Intronic
1154451639 18:14481720-14481742 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155144649 18:23073092-23073114 CGGGGGCTGAGGTGGGAGGATGG + Intergenic
1155530565 18:26762329-26762351 GGGAGGCTGAGCTGGGAGGATGG - Intergenic
1155923125 18:31625422-31625444 GTGTCTCAGAGCAGGGAGGACGG + Exonic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156352211 18:36311200-36311222 ATGTGTCTGGGCAGGGAGGGCGG + Intronic
1156399555 18:36728194-36728216 CTGTTGCTGAGTGGGGAAGAGGG + Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1157195912 18:45619966-45619988 GAGTGGCAGAGCAGGGAGGCAGG + Intronic
1157233692 18:45943106-45943128 CTGTGTCTGACCAGGGTGAAAGG + Intronic
1157515237 18:48306267-48306289 CTGTGGCTGAGCCTGGACCATGG - Intronic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1157596791 18:48869078-48869100 CTGAGGCTGAGCAGGTGGGGAGG + Intergenic
1157700236 18:49757680-49757702 CTCTGGATGAGCAGGACGGAGGG + Intergenic
1158355905 18:56619107-56619129 GGGAGGCTGAGCTGGGAGGATGG + Intronic
1158568781 18:58579071-58579093 CTTTGGCAGAGCAGAGATGAAGG + Exonic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160455274 18:78994884-78994906 CTGTTCCTGAGCAGGGAGCGGGG + Exonic
1160589399 18:79934629-79934651 CTGGGGCTGCGCAGATAGGAAGG - Intronic
1160622669 18:80181624-80181646 CAGTCGCTGATGAGGGAGGATGG - Intronic
1160680719 19:410741-410763 CTGGGCCTGAGGCGGGAGGAGGG + Intergenic
1160680944 19:411345-411367 CTGGGCCCGAGCCGGGAGGAGGG + Intergenic
1160984035 19:1829177-1829199 ATGTGGCTGAGCAGGGCCGGGGG + Intronic
1161053271 19:2176665-2176687 CTGAGGCTGCGCAGGTTGGAGGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161323950 19:3654104-3654126 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1161413275 19:4129309-4129331 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1161470667 19:4455491-4455513 CTGTGGCTGCCCAGGGGGGCAGG - Intronic
1161652136 19:5491903-5491925 GGGTGGCTGAGGTGGGAGGATGG + Intergenic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1161958257 19:7508048-7508070 CAGTGTCTGACCAAGGAGGATGG - Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162188687 19:8927594-8927616 CTGTGGCTGGGCACGTAGGGAGG + Intronic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162332672 19:10039727-10039749 TTCTGGCAGAGCTGGGAGGAAGG - Intergenic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162800888 19:13109898-13109920 CGGCCGGTGAGCAGGGAGGAAGG - Exonic
1163281544 19:16321215-16321237 GGGAGGCTGAGCTGGGAGGATGG + Intergenic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163480327 19:17551795-17551817 CTGAGGCTGAGCGGGAAGGAGGG + Intronic
1163648127 19:18501831-18501853 CTGCGGGTGGGCAGGAAGGAGGG + Intronic
1163675928 19:18655284-18655306 CTCTGCCTGAGCTGGGAGGATGG - Intronic
1163691696 19:18742016-18742038 GTGGGGCTGGGCAGGCAGGAAGG - Intronic
1164449161 19:28345101-28345123 GTTTGGCTGAACAGAGAGGATGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1165086468 19:33351526-33351548 CTGAGGATGGGCAGGGAGCAGGG + Intergenic
1165246256 19:34500138-34500160 CTGCAGCTGAGCGGGGAGGAGGG + Exonic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165366521 19:35370885-35370907 CTGAGGCTGCGCAAGGAGGGAGG + Intergenic
1165719663 19:38070079-38070101 CCGTGGATGAGCAGGGAAGCTGG - Intronic
1165734698 19:38168677-38168699 CTGTGGCTGAGATGGGAGGGTGG + Intronic
1165878465 19:39026177-39026199 ATGTGGTTGCTCAGGGAGGAGGG - Intronic
1165893989 19:39130701-39130723 GTGTGGCTGAGCAGGGGGTGGGG + Intronic
1165898715 19:39158447-39158469 CTGAGGCTGGGCAGGGGGAAGGG - Intronic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166112723 19:40632699-40632721 CTGTGGCTGGGCAGATAGTAAGG + Intergenic
1166215427 19:41331505-41331527 CGGAGGCTGAGGCGGGAGGATGG - Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166529100 19:43532131-43532153 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1167047161 19:47056658-47056680 GTGGGGCTGAGGTGGGAGGATGG + Intergenic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167148283 19:47695134-47695156 GCGGGGCTGAGCAGGGAGAATGG + Intronic
1167599053 19:50443216-50443238 CAGGGGCTGAGGTGGGAGGATGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1167893870 19:52564979-52565001 GGGAGGCTGAGCAGGGAGAATGG + Intronic
1167953049 19:53043270-53043292 AGGAGGCTGAGCTGGGAGGATGG - Intergenic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168586803 19:57600325-57600347 CTGCGCCTGAGCCGGGAGGCTGG + Intronic
1202703511 1_KI270713v1_random:4781-4803 CTGCGGGTGAGACGGGAGGAGGG + Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925111349 2:1341076-1341098 CTTTGGCTGCCAAGGGAGGATGG + Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925636447 2:5945873-5945895 CTGTGGCCCAGCAGTGAGGGAGG + Intergenic
926097746 2:10093415-10093437 CTGAGGCTGAATAGGGAGAATGG - Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
927042955 2:19247893-19247915 CTGGGGGTGAGCAGAGATGAGGG + Intergenic
927136437 2:20100049-20100071 CAGTGGCTGAGCAGGAAGATGGG - Intergenic
927359671 2:22218160-22218182 CTTTGGCTGATCTGGGAGTAGGG - Intergenic
927476796 2:23419931-23419953 CTGTGGCTCAGTGGGGAGAAGGG - Intronic
927686368 2:25174257-25174279 GTGTTGGTGAGAAGGGAGGAGGG + Intergenic
927830979 2:26349866-26349888 CGGAGGCTGAGGTGGGAGGATGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927947031 2:27141388-27141410 GTGGGGCTGAGGTGGGAGGACGG - Intergenic
928003720 2:27544363-27544385 TTGTGTCTGAGCAGAGAGGAGGG - Intronic
928035828 2:27822197-27822219 CTATGGCTAAGCAGGGAACAGGG + Intronic
928253199 2:29699906-29699928 CTCTAGCAGAGCAGTGAGGATGG + Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
928423285 2:31156611-31156633 TTGTGGCTGAGATGGGAGAAGGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928799383 2:35068176-35068198 CTGGGGCTGAACAGGGAGATCGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929525044 2:42693746-42693768 CTGTGGCTGAGCAGTAACTAAGG + Intronic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929718007 2:44333094-44333116 CTGTGGCTGTCCAGGCAGCAGGG - Intronic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
930023044 2:47012859-47012881 CTGTGGCTGATCAGGAGGAAGGG + Intronic
930439803 2:51391279-51391301 CTGCTGCTGGGAAGGGAGGAGGG + Intergenic
930515000 2:52395135-52395157 CTGTGGTTGATCATGGAGGTAGG + Intergenic
930763282 2:55059456-55059478 CGGAGGCTGAGGTGGGAGGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
931103638 2:59030737-59030759 AGGAGGCTGAGAAGGGAGGATGG + Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932238516 2:70140003-70140025 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
932365791 2:71152560-71152582 CTTTGACTGAGATGGGAGGAGGG - Intergenic
932474096 2:71990389-71990411 CTGGAGGTGAGCAGGCAGGAAGG + Intergenic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932565210 2:72901849-72901871 GTGTGGCAAAGCAGGGAGGTGGG - Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
933145123 2:78842476-78842498 AAGAGGCTGAGTAGGGAGGATGG + Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933713660 2:85345103-85345125 CAGGGGCAGAGCAGGGAGGTCGG - Intronic
933762274 2:85680567-85680589 TTCTGGCTGGGCAGGGAGTAGGG + Intergenic
933852597 2:86382608-86382630 CAGTTTCTGAGCTGGGAGGAGGG - Intergenic
933915802 2:86992146-86992168 GTGGGGCTGAGGTGGGAGGATGG + Intronic
934007191 2:87777756-87777778 GTGGGGCTGAGGTGGGAGGATGG - Intronic
934094289 2:88584859-88584881 TAGTGGCTGAGCACGGTGGAGGG + Intronic
934527728 2:95062026-95062048 CCGTGGCTGGGGAGGAAGGAAGG - Intergenic
934534249 2:95119956-95119978 AGGTGGCTGAGGTGGGAGGATGG + Intronic
934659893 2:96137849-96137871 TTGGGGTTGAGCAGGGAGGCTGG - Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934759242 2:96844409-96844431 AGGTGGCTGAGCAAGGAGGCTGG + Intronic
935165272 2:100564014-100564036 CGGAGGCTGACAAGGGAGGATGG - Intronic
935194179 2:100802179-100802201 CTGTTGCTGGGCAGGGAAGCCGG + Intergenic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935718659 2:105960605-105960627 TTGGCGCTGAGCAGGAAGGAAGG - Intergenic
935770831 2:106418669-106418691 GTGGGGCTGAGGTGGGAGGATGG - Intronic
935909250 2:107877268-107877290 GTGGGGCTGAGGTGGGAGGATGG + Intronic
935967386 2:108494267-108494289 GTGGGGCTGAGGTGGGAGGATGG + Intronic
936092554 2:109510696-109510718 CCCAGGCTGGGCAGGGAGGAGGG - Intergenic
936131028 2:109842408-109842430 GTGGGGCTGAGGTGGGAGGATGG + Intronic
936213669 2:110529077-110529099 GTGGGGCTGAGGTGGGAGGATGG - Intronic
936422807 2:112383637-112383659 GTGGGGCTGAGGTGGGAGGATGG - Intronic
936476261 2:112842656-112842678 CTGTGGCTGATATGTGAGGAAGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937114700 2:119397026-119397048 CTTGGGCTGAGTACGGAGGAAGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938131334 2:128717997-128718019 CTGTGGCTGGGCTGGCAGAAAGG + Intergenic
938341197 2:130537746-130537768 CTGTAGCTGGGAATGGAGGATGG - Intergenic
938348634 2:130582963-130582985 CTGTAGCTGGGAATGGAGGATGG + Intronic
938891725 2:135712366-135712388 AAGTGGCTGAGGTGGGAGGATGG - Intronic
939977344 2:148733600-148733622 GGGAGGCTGAGCTGGGAGGATGG - Intronic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940149069 2:150578912-150578934 CTGAGGCTGCACAGGGAGGCAGG + Intergenic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
940636288 2:156300952-156300974 AGGAGGCTGAGCGGGGAGGATGG + Intergenic
940877658 2:158914200-158914222 TTGTGGCTGAGAAGGGGAGAAGG + Intergenic
941461059 2:165772478-165772500 AGGTGGCTGAGGTGGGAGGATGG + Intronic
942277727 2:174335063-174335085 CTCTGGCTGCGCAGCGAGGCTGG - Exonic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
944132021 2:196357218-196357240 CTCTGTCTGCACAGGGAGGATGG - Intronic
944316721 2:198292532-198292554 CTGTGACTGAGCTGTGAGGGAGG - Intronic
945233912 2:207616881-207616903 CTGTGGCTGAGTGGGGCTGAAGG - Intronic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946354002 2:219173446-219173468 GTGTGGCTGAGCAGCAGGGACGG - Exonic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946748047 2:222864814-222864836 CTGTGTCTTTGCTGGGAGGAGGG + Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
946878561 2:224155205-224155227 CTTTGTCTGGGCAGGGAAGATGG - Intergenic
947156073 2:227164257-227164279 AGGTGGCTGCGCAGGGTGGAGGG - Intergenic
947736334 2:232457344-232457366 CTGGGGCTGGGCAGAGGGGAAGG + Intronic
947840075 2:233202160-233202182 CAGGGGCTGAGATGGGAGGAGGG - Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
947930074 2:233957382-233957404 AGGTGGCTGAGGTGGGAGGATGG + Intronic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
948133097 2:235615297-235615319 GCGAGGCAGAGCAGGGAGGATGG - Intronic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948857077 2:240735219-240735241 CTGGGTCTGAGAAAGGAGGAAGG - Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168854165 20:997239-997261 CAGTGGCTGGGCAGGGGGGTTGG + Intronic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169459508 20:5782076-5782098 CTGGAGTTGACCAGGGAGGAGGG - Intronic
1169535722 20:6537880-6537902 CTGTGAGTGAGCAGGAATGAGGG + Intergenic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1170987687 20:21273614-21273636 CTGGGGGAGAGCATGGAGGAGGG - Intergenic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171215168 20:23347128-23347150 TGGTGGCTGAGCTGGGAAGAGGG + Intergenic
1171849651 20:30299514-30299536 CTGTGGAGGAGCTGGGAGGTGGG - Intergenic
1172149444 20:32779915-32779937 CAGAGGCTGAGCAGGGAGAGGGG + Intronic
1172154127 20:32811569-32811591 GTGTGGCTGAGGTGGGAGAATGG + Intergenic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172903890 20:38354975-38354997 CAGGGGCTGAGTTGGGAGGATGG + Intronic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1173399291 20:42710375-42710397 CTGAGGCTGGGCAGGGCAGAAGG - Intronic
1173490465 20:43475614-43475636 AGGAGGCTGAGCTGGGAGGATGG + Intergenic
1173569191 20:44065931-44065953 GTGGGGCTGAGCGGGAAGGAGGG - Exonic
1173645903 20:44633008-44633030 CTGTGGCTGACCAGGGAGTAGGG - Intronic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174561470 20:51433579-51433601 CTGGTGCTGGGCAGGGAGAAAGG - Intronic
1174564148 20:51452627-51452649 ATGAGGTTGGGCAGGGAGGACGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175118961 20:56703644-56703666 CTGTGGAGGAGCTGGGAGGGTGG + Intergenic
1175267503 20:57711384-57711406 CTGTGCCTGTGCAGGGAGAGCGG - Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175572360 20:60033667-60033689 CTCAGGCTGAGCAGAGAGTACGG + Intronic
1175769199 20:61612601-61612623 CTGGGCCTCAGCAGGAAGGATGG - Intronic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1175874308 20:62222157-62222179 CTGTGGATGACAGGGGAGGAGGG - Intergenic
1175903843 20:62370361-62370383 CGGGGGCTGAGCAAGAAGGAGGG + Intergenic
1175926189 20:62472767-62472789 TTGTGGCTGAGCAGGGAGTGGGG - Intronic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176169152 20:63689287-63689309 CTGGGCCTGGGCAGGCAGGATGG + Intronic
1176305549 21:5121291-5121313 CTTTGTCTGAGCAGGGACAAAGG + Intronic
1176377526 21:6093902-6093924 CTGCCCCTGAGCAGGGAGGCCGG - Intergenic
1176444506 21:6808503-6808525 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1176612494 21:8996503-8996525 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1176712629 21:10166969-10166991 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1176822671 21:13673541-13673563 CAGAGGCTGAGCAGGGTGGGGGG - Intergenic
1177202541 21:17973893-17973915 CTTAAGCTGAGCAAGGAGGAAGG - Intronic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178597328 21:33966577-33966599 CTTTGACTTAGCAGGAAGGATGG + Intergenic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179509261 21:41861660-41861682 CTGGGGATGAGCGGGGTGGAGGG - Exonic
1179530016 21:42011806-42011828 CCGAGGCTGAGACGGGAGGATGG - Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179674001 21:42969518-42969540 CTGGGGATGAGCACGGTGGATGG + Intergenic
1179745949 21:43444342-43444364 CTGCCCCTGAGCAGGGAGGCCGG + Intergenic
1179851507 21:44140740-44140762 CTTTGTCTGAGCAGGGACAAAGG - Intronic
1180044993 21:45301210-45301232 CTGTGGCTGAGCAGTGCTGAAGG - Intergenic
1180569562 22:16702490-16702512 GGGTGGCTGAGCAGGGAGGCAGG - Intergenic
1181063141 22:20291490-20291512 CTCTGCCTGAGCAGGTAGCAGGG - Intergenic
1181065103 22:20301953-20301975 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1181133566 22:20748857-20748879 CTGAGGCTGGGCACGGAGGGTGG + Intronic
1181172349 22:21016796-21016818 CTGGGGATGAGCTGGGTGGAGGG - Intronic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181270652 22:21656817-21656839 CAGTGGCTGACCAAGTAGGAGGG + Intronic
1181290130 22:21785513-21785535 AGGTGGCTGAGGTGGGAGGATGG + Intronic
1181310575 22:21942570-21942592 CTTTTGCACAGCAGGGAGGAAGG + Intronic
1181472454 22:23149182-23149204 CTGTGGCTGTGCAGGGGTGGGGG + Intronic
1181738385 22:24900123-24900145 GTGGGGCTGAGGTGGGAGGAAGG - Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1182091429 22:27597762-27597784 GGGTGGCTGAGCAAGGAGGATGG - Intergenic
1182255694 22:29036496-29036518 CTGTTGATGAGCTGGGTGGAAGG - Intronic
1182529150 22:30941864-30941886 GTGTGGCTGGGAAGGGAGGGAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182741980 22:32574372-32574394 GGGTGGCTGAGGTGGGAGGATGG + Intronic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183028301 22:35082921-35082943 CTGTCGCCAAGCGGGGAGGAAGG - Intronic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183290678 22:36999979-37000001 TTGAGCCTGAGCAGGGAGGCAGG + Exonic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183665768 22:39244926-39244948 CTGCGGGTGCGCAGGGAGGCAGG + Intergenic
1183785357 22:40026116-40026138 CCGTGGCTGCCCAGGGAGAAAGG + Intronic
1183831571 22:40420846-40420868 CTTTGGCGGGGCAGGCAGGATGG + Exonic
1184095212 22:42312696-42312718 CTGAGGCTCAGCAGGGATGGGGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184465290 22:44665400-44665422 CTGAGGCTGACCTGGGTGGACGG - Intergenic
1184617646 22:45648780-45648802 CTGCGGATGAGCAGGGCGGAAGG - Intergenic
1184744115 22:46446175-46446197 CTGTAGCTGCCCTGGGAGGAGGG - Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184853727 22:47135382-47135404 TTGTGGCCTGGCAGGGAGGATGG + Intronic
1184873734 22:47258933-47258955 ATGGGGGTGAGCAGGGAGGCAGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950176349 3:10877552-10877574 TTGTGGCTGATCATGGAGGCAGG - Intronic
950197051 3:11016686-11016708 CTGTGGCTGAATGGGGAGAAAGG - Intronic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950705939 3:14781659-14781681 CAGAGGCTGAGCAGAGAGGATGG + Intergenic
950708194 3:14796766-14796788 ATGTTGCTGAGAAAGGAGGAGGG - Intergenic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950889874 3:16394270-16394292 GGGAGGCTGAGCAGGGAGGATGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951048905 3:18072509-18072531 GGGTGGCTGAGGTGGGAGGATGG - Intronic
951362832 3:21744983-21745005 GTGTGGGAGAGCAGAGAGGAAGG - Intronic
952416854 3:33097226-33097248 CTGTGGCCGAGCCGGGCGGGTGG + Exonic
952967523 3:38630505-38630527 CTGTGGCTGAGCGGTGAGGTGGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953057238 3:39397857-39397879 CTGTGGCTGAGAATGGAAAATGG - Intergenic
953198679 3:40756968-40756990 GTGGAGCAGAGCAGGGAGGAGGG + Intergenic
953705677 3:45228059-45228081 CTTTGTCTGTGCAGGGGGGAAGG + Intergenic
953735958 3:45494210-45494232 CAGTGGCTGAGCAGAGAGCATGG - Intronic
953856018 3:46499620-46499642 CCTTGTCTCAGCAGGGAGGAGGG - Intronic
953961017 3:47265696-47265718 CAGTTGCTGCCCAGGGAGGAGGG - Intronic
953996010 3:47520475-47520497 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
954183372 3:48898833-48898855 CTGGGGCTGAGAAGCCAGGACGG - Exonic
954191943 3:48969332-48969354 GTGTGGTTGAGCAGAGAGAAGGG + Intronic
954298318 3:49686252-49686274 CTGCGGGTGAGACGGGAGGAAGG - Intronic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954827141 3:53383997-53384019 CAGTGGCAGAGCAGGGAGTGGGG - Intergenic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955401817 3:58597362-58597384 CTTTGGATTGGCAGGGAGGAGGG + Intronic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955989633 3:64612580-64612602 CTGTGGCTGGTCAGGGTGAAGGG + Intronic
956452403 3:69387237-69387259 CCGTGGCTGAGGTGGGAAGATGG - Intronic
957001803 3:74895209-74895231 ATGTGGCTGAGCAGTGAGGAGGG - Intergenic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
960586740 3:119327033-119327055 CGGAGGCTGAGGTGGGAGGATGG + Intronic
960841592 3:121964042-121964064 CTGGTGATGAGCAGGGAGGCTGG - Intergenic
960959036 3:123056153-123056175 GGGTGGCTGAGGTGGGAGGATGG + Intergenic
960964639 3:123096301-123096323 GGGAGGCTGAGCTGGGAGGATGG - Intronic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961077595 3:123996371-123996393 CTGGGGCTGAGCAGTGATGATGG + Intergenic
961306983 3:125964909-125964931 CTGGGGCTGAGCAGTGATGATGG - Intergenic
961476734 3:127151296-127151318 CTGTGGCTGAGCGTGGACAACGG - Intergenic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961686605 3:128637131-128637153 GGGAGGCTGAGCTGGGAGGATGG + Intronic
961822637 3:129582955-129582977 CTGTCCCTGGACAGGGAGGATGG - Intronic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
962425343 3:135264458-135264480 GTCTGGCTGAGCGGAGAGGATGG + Intergenic
962779330 3:138696754-138696776 CTTTGGCAAAGCAGGGAGGGGGG - Intronic
963068474 3:141282404-141282426 CTGTGGGAGACCAGGGTGGAAGG - Intronic
963729571 3:148958309-148958331 GTGTGGCTGGGCAGGGGAGATGG - Intergenic
963789104 3:149565080-149565102 CGGGGGCTGAGCTGGGAGGATGG + Intronic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
965111385 3:164428516-164428538 AGGTGTCTGAGCTGGGAGGATGG - Intergenic
965256364 3:166418616-166418638 CTGGGGCAGGGCTGGGAGGAGGG - Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966537719 3:181052933-181052955 GTGGGGCTGAGGTGGGAGGATGG - Intergenic
966871020 3:184290709-184290731 CTGTGGTTGAGCTGGGAGCAGGG + Intronic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968330818 3:197867917-197867939 GTGGGGCTGAGGCGGGAGGATGG + Intronic
968699645 4:2048419-2048441 CTGTGGCTGGGCAGGGACCCTGG + Intergenic
968720050 4:2195720-2195742 CTCAGGCTGAGGTGGGAGGATGG - Intronic
968771542 4:2510747-2510769 CTCTTGCTGAGCACGTAGGAGGG - Intronic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
969262499 4:6042970-6042992 CTGGGGGTGAGCACGGAGGCAGG + Intronic
969403242 4:6971027-6971049 CTGTGGCTGAGCTGGGGGTCAGG + Intronic
969461828 4:7333113-7333135 GTGTGGCCGTGCAGGCAGGAAGG + Intronic
969520244 4:7673997-7674019 ATGGCGCTGAGCAGGGAGGAAGG + Intronic
969527238 4:7710100-7710122 CTGGGGCAGAGCAGAGAGGCTGG - Intronic
969871834 4:10109575-10109597 CTGAGGCTGAGCTGGGAGGCAGG - Intronic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
972531402 4:39964462-39964484 CGGAGGCTGAGGTGGGAGGATGG + Intronic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
974725551 4:65794413-65794435 CTGTGGCTTTGCAGGGTGTAGGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975299110 4:72768448-72768470 CTGTCGGTGAGCATGGAAGAGGG - Intergenic
977044966 4:92058086-92058108 CAGTGGCTAAGAAGGGAGTAGGG + Intergenic
978127774 4:105154918-105154940 GTGGGGCTGAGGCGGGAGGATGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
978381376 4:108132771-108132793 AGGAGGCTGAGCGGGGAGGATGG - Intronic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
978628466 4:110714910-110714932 AAGTGGCTGAGGTGGGAGGATGG + Intergenic
981202375 4:141995773-141995795 ATGTTGCTGTGAAGGGAGGAGGG - Intergenic
981569532 4:146136951-146136973 CTGTGGCTCAGCTCAGAGGAAGG - Intergenic
981712734 4:147724979-147725001 CTGGTGCTGAGCAGGTAGGATGG + Intergenic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
983054311 4:163083765-163083787 CAGTGGCAGAGCTGGGAGGAGGG + Intergenic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983742909 4:171157607-171157629 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
984183890 4:176518963-176518985 CTGTGTCTCAGAAGGCAGGATGG - Intergenic
985382907 4:189414107-189414129 GTGTGACTGAGCAGGAAGCAGGG - Intergenic
985511624 5:317145-317167 GTGTGGCTGGGCAGGGGGCACGG - Intronic
985689278 5:1298275-1298297 CTGAGGCTGAAAAGGGAGGGAGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
985847678 5:2364435-2364457 CTGAGGCTGAGCAGGGTGGCTGG + Intergenic
986017611 5:3771317-3771339 CTGTGGCTGTGCAGGAATGTCGG - Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
986639980 5:9862717-9862739 GGGAGGCTGAGCTGGGAGGATGG - Intergenic
986643665 5:9895457-9895479 CTGTGGCTGAGCCGGGCAGCAGG + Intergenic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
986709871 5:10480871-10480893 CTGTGGGTGGGCAGGGAGCTAGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987345352 5:16974029-16974051 CCGGGGCTGAGGTGGGAGGATGG - Intergenic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
988052157 5:26044274-26044296 GGGGGGCTGAGGAGGGAGGATGG + Intergenic
988242993 5:28637816-28637838 CTGAGGCTGAGAAAGGAGAATGG + Intergenic
988297331 5:29382582-29382604 ATGTTACTGAGCAAGGAGGATGG + Intergenic
989035669 5:37169205-37169227 CTGTGGCAGAGCAGGTTGGAAGG + Exonic
989083436 5:37650294-37650316 AGGAGGCTGAGCGGGGAGGATGG + Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989817884 5:45758638-45758660 GTGGGGCTGAGTTGGGAGGATGG + Intergenic
990497268 5:56361077-56361099 GGGTGGCGGGGCAGGGAGGATGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
992131053 5:73693209-73693231 ATGTGGCAGAGCAGTGGGGAAGG - Intronic
992171209 5:74103818-74103840 TTGTGGCTGACCAGGCAGGATGG + Intergenic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992679975 5:79143889-79143911 GTGTGGCTTAGCAGGGAGTGGGG - Intronic
992965017 5:81990782-81990804 CTGTGGCTGACCAGAGTGCATGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993680698 5:90874163-90874185 CTGTGGCTGTGCTGGGTGAACGG - Intronic
994808300 5:104479695-104479717 CTGTGGCTCAGCAGGGTACAAGG - Intergenic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995792897 5:115911776-115911798 CTTTGGGGGAGCAGGAAGGAAGG + Intronic
996728371 5:126692853-126692875 TTGGGGCTGAGGTGGGAGGATGG - Intergenic
996856913 5:128018727-128018749 CAGTGGCAGAGCAGGGAGAGGGG - Intergenic
997471180 5:134117821-134117843 CTGTGGCTGCGCGGGGAGGAGGG - Intronic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
997567873 5:134903728-134903750 GTGAGGCTGAGATGGGAGGATGG - Intergenic
997598411 5:135122604-135122626 ATGAGGCTAAGCAGAGAGGAAGG - Intronic
997601002 5:135138346-135138368 GCATGGCTGAGCTGGGAGGAGGG - Intronic
997830798 5:137148034-137148056 CTGTGGCTGTCCGGAGAGGAAGG - Intronic
997967770 5:138373233-138373255 GTGGGGCTGAGGTGGGAGGATGG + Intronic
998004154 5:138646285-138646307 CTGAGACTGAGCAGGGAGGCAGG - Intronic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998407108 5:141880186-141880208 TGGTGGTGGAGCAGGGAGGATGG - Intergenic
998563169 5:143191019-143191041 CTGTGGCTGAGCATGGGAGCAGG + Intronic
999327184 5:150650552-150650574 CCATGTCTGAGCGGGGAGGAGGG + Exonic
999420950 5:151442639-151442661 TAGTAGCTGAGCAGGGTGGAAGG - Intronic
1000006578 5:157190646-157190668 CTCTGGCTGAACTGGGAGGTGGG + Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000321166 5:160135614-160135636 GTGGGGCTGAGAGGGGAGGATGG + Intergenic
1001552199 5:172611106-172611128 TTGGGGGTGAGCAGGCAGGATGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1002716528 5:181231535-181231557 CACTGGCTGGGAAGGGAGGAGGG - Intronic
1002774514 6:317479-317501 CTGGGGCTGAGCTCGGAGGGAGG - Intronic
1003122579 6:3330069-3330091 CTGGGGCTGGGCAGGGCGGTGGG - Intronic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1003688521 6:8328240-8328262 CTTGGGCTGACCAGAGAGGAGGG + Intergenic
1003848135 6:10195371-10195393 CAGTGGCTGAGCGGGGAGCGGGG - Intronic
1004067117 6:12258342-12258364 AGGAGACTGAGCAGGGAGGATGG + Intergenic
1004163927 6:13239044-13239066 CTGTGGAGGAGCAGGGAGTGGGG + Intronic
1004164962 6:13249004-13249026 CTGTGGCTGGCAAGGGAGGACGG - Intronic
1004188643 6:13445149-13445171 CCGAGGCTGAACAGGGAGGAGGG + Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1006175240 6:32117451-32117473 CTGTGGGTGGGCAAGGAGGGTGG - Intronic
1006425818 6:33962330-33962352 CTGTGTCTGAGAAGGAAGGAAGG - Intergenic
1006574548 6:35035104-35035126 CAGTGGCTGAGCAGGCTGGCCGG + Intronic
1006657532 6:35608580-35608602 CGGTGGCTGAGGTGGGAGGATGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006785960 6:36667450-36667472 CTGCCACTGAACAGGGAGGAGGG - Intergenic
1007263371 6:40579280-40579302 CAGGGGCTGAGCTGGGAAGAAGG - Intronic
1007418777 6:41707042-41707064 TTGGGGCTGGGCAGGCAGGAGGG - Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007620732 6:43212958-43212980 CCGTGGCTCATCAGGGAGGCAGG + Intronic
1007767757 6:44171033-44171055 CTGTGGCTCAGTAGGCTGGAGGG + Intronic
1007807591 6:44462092-44462114 AGGCGGCTGAGCTGGGAGGATGG + Intergenic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008173256 6:48234827-48234849 CTGGTGATGAGCAGGGAGGGTGG - Intergenic
1008352247 6:50505716-50505738 CAGTGACTGAGAAGGGAGGGTGG + Intergenic
1008715792 6:54288345-54288367 CTGAGTCTGAGCAGGGATGAGGG + Intergenic
1009710641 6:67314069-67314091 CGGTGGCTGAGGCGGGAGAATGG - Intergenic
1009884166 6:69604486-69604508 GTGAGGCTGAGAAGGCAGGATGG - Intergenic
1010049840 6:71489936-71489958 CTGTGACTCAGCAGTCAGGAAGG - Intergenic
1010189289 6:73178346-73178368 GGGAGGCTGAGCTGGGAGGATGG + Intronic
1010328018 6:74587746-74587768 CTGTGGCTGAGCAGGTATGCAGG - Intergenic
1010439190 6:75873940-75873962 GTGTTGGTGAGAAGGGAGGATGG - Intronic
1011080405 6:83484509-83484531 AGGTGGCTGAGGTGGGAGGACGG + Intergenic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1012222064 6:96660751-96660773 GGGTGGCTGAGGTGGGAGGATGG + Intergenic
1012881486 6:104796213-104796235 GGGAGGCTGAGCTGGGAGGAGGG - Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1015052829 6:128862917-128862939 CTGTGGCTGAGCTGGTATGTAGG + Intergenic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016797163 6:148130484-148130506 CTGTAGCTGAGCAGGCAGGAAGG - Intergenic
1016916200 6:149246769-149246791 AGGAGGCTGAGCTGGGAGGAGGG - Intronic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1016995995 6:149962874-149962896 CTGTGACTGAGCAGGGACACAGG - Intergenic
1017002595 6:150006291-150006313 CTGTGACTGAGCAGGGACACAGG + Intergenic
1017012189 6:150070295-150070317 CTGTGACTGAGCAGGGACACAGG + Intergenic
1017071207 6:150576793-150576815 TTGGGGCTGGGCTGGGAGGAGGG + Intergenic
1017581693 6:155872031-155872053 AGGTGGCTGAGGTGGGAGGATGG - Intergenic
1017669438 6:156756077-156756099 GGGAGGCTGAGAAGGGAGGATGG + Intergenic
1017900600 6:158715783-158715805 CTGTGGCAGAGACGGGAGAAGGG - Intronic
1018952564 6:168388803-168388825 CCGGGGATGGGCAGGGAGGAGGG - Intergenic
1018956900 6:168416306-168416328 CCGTGGCTGGGCAGGCAGGCAGG - Intergenic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019193271 6:170266695-170266717 CTGTGGCTGGGCAGCACGGAAGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019278885 7:190542-190564 CAGTGGCGGGGCAGGGAGGGGGG + Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019488752 7:1301350-1301372 CTGTGCCTGACCACGCAGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019711740 7:2521111-2521133 CGGGGTTTGAGCAGGGAGGAAGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019759616 7:2800820-2800842 CAGTGGGGGAGCCGGGAGGAAGG - Intronic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1019996152 7:4725621-4725643 GTGTGGCTGTGTTGGGAGGACGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021275628 7:18647643-18647665 CAATGGCTGAGCAGGGAAAATGG - Intronic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1022301522 7:29106632-29106654 CTATGGCAGAACAGGGAAGAGGG + Intronic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022440698 7:30430612-30430634 CTGTAGCTGAACAGTGGGGAGGG - Intronic
1023392364 7:39722362-39722384 GTCTGGCTGAGAAGGGAAGATGG + Intergenic
1023582948 7:41701219-41701241 CTGTGGCTTGGCTGGGTGGAGGG - Intronic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024254206 7:47527801-47527823 GAGTGGCTGAGGTGGGAGGATGG + Intronic
1024615757 7:51110263-51110285 CAGAGGCTGCGCAGGGTGGAGGG - Intronic
1024637425 7:51301877-51301899 ATGTGGCTGGGCAGAGAGGCAGG - Intronic
1024961939 7:54985861-54985883 GTGTGGCTGAGCAGGACAGAGGG + Intergenic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025212573 7:57028687-57028709 CTGGGGGTGGGCAGGAAGGAGGG - Intergenic
1025659380 7:63548140-63548162 CTGGGGGTGGGCAGGAAGGAGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026117717 7:67510218-67510240 CAGAGGCTGAGAAGGGTGGAAGG - Intergenic
1026309040 7:69167816-69167838 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1026479341 7:70764831-70764853 CTGTGGTTGGGCAGGGAGAGGGG - Exonic
1026807263 7:73436133-73436155 CTCTGGCTGGGAAGGGGGGAAGG + Intergenic
1026855460 7:73750874-73750896 CTGTGGCTGAGATGGGAGATTGG + Intergenic
1026899001 7:74027147-74027169 CTGTGGGGGAACAGGGAGGTGGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1026999580 7:74643193-74643215 CTGTGGTTGCGCATGGAGGCAGG + Intergenic
1027342520 7:77224321-77224343 CTGTTGCTGACTATGGAGGAAGG - Intronic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029045851 7:97627486-97627508 CAGTGGCAGAGCAGGGAGAAAGG + Intergenic
1029075780 7:97932769-97932791 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
1029170528 7:98626733-98626755 GTGCCGCTGCGCAGGGAGGACGG + Intronic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029451465 7:100643590-100643612 CTGTTCCTGAGCTGGGGGGATGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029492325 7:100878205-100878227 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1029547564 7:101218376-101218398 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1030034953 7:105401049-105401071 CAGTGACTGAGGAGAGAGGAGGG - Intergenic
1030590753 7:111478498-111478520 CAGAGGCTGAGATGGGAGGAAGG - Intronic
1031859857 7:126966237-126966259 GTGGGGCTGAGGTGGGAGGATGG - Intronic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032409778 7:131686443-131686465 CGGGGGCTGAGGTGGGAGGATGG + Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033036674 7:137882102-137882124 GTGTGGCTTGGAAGGGAGGATGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033576072 7:142686122-142686144 CTGTGGCTTAGCAGAGGTGACGG - Intergenic
1033679838 7:143583533-143583555 CTATCGCTGCGCAGGAAGGATGG - Intergenic
1033691996 7:143745910-143745932 CTATCGCTGCGCAGGAAGGATGG + Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034328214 7:150257516-150257538 CTGGCCCTGATCAGGGAGGAGGG + Intronic
1034338693 7:150339082-150339104 CTGTGGGGGAGCGGGGAGCATGG + Intronic
1034765001 7:153711948-153711970 CTGGCCCTGATCAGGGAGGAGGG - Intergenic
1035064348 7:156094454-156094476 CTGTGGCTGACCAGGTGGGAGGG + Intergenic
1035220576 7:157404069-157404091 AGGGGGCTGAGCTGGGAGGACGG - Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035253689 7:157613132-157613154 CTGCGGCTGAGGCGGGAGGCGGG - Intronic
1035309254 7:157954696-157954718 CTGGGGCTCGGCAGGGAGGCGGG - Intronic
1035705160 8:1669584-1669606 CTGGGGCGGCCCAGGGAGGAGGG + Intronic
1035719316 8:1779742-1779764 CTGTGTCCTAGCATGGAGGAGGG + Intronic
1036748553 8:11428247-11428269 CTGTGGGGTAGCAGGAAGGAAGG + Intronic
1037997008 8:23359982-23360004 GTGTGTGTGAGCAGGAAGGAGGG - Intronic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038240525 8:25803674-25803696 CAGTGGGTGAGCAGGTAGGGAGG + Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039244152 8:35589650-35589672 CTGCAGCTGAGCAAGGAGTATGG - Intronic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040355826 8:46617481-46617503 CTGGGGCTGCCCCGGGAGGAAGG - Intergenic
1040465560 8:47691765-47691787 CTGTGGCTTAGCAGGACCGATGG + Intronic
1041469107 8:58189370-58189392 GGGAGACTGAGCAGGGAGGATGG - Intronic
1041682192 8:60605072-60605094 CTGAGGCTGTGCAGGGTGGTGGG - Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042361648 8:67890604-67890626 CAGTGGCTGAGATGGGAGGATGG - Intergenic
1042427741 8:68668735-68668757 CTGTTGATGGGCAGAGAGGAAGG + Intronic
1042437352 8:68782965-68782987 CTGAGGCTGAGAGGGGAGAATGG + Intronic
1042604404 8:70531169-70531191 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1042807494 8:72787290-72787312 GTGGGGCTGAGCTGGGAGGATGG + Intronic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043508021 8:80921928-80921950 GGGTGGCTGAGGTGGGAGGATGG + Intergenic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044708328 8:95030472-95030494 GGGAGGCAGAGCAGGGAGGATGG - Intronic
1044715536 8:95096236-95096258 CACTGGCTGAGCAGCCAGGAGGG + Intronic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045484792 8:102622457-102622479 GGGTGGCTGAGATGGGAGGATGG - Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1045539958 8:103074845-103074867 GGGAGGCTGAGAAGGGAGGATGG - Intergenic
1045844301 8:106615501-106615523 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1045966729 8:108033412-108033434 CAGTGGCTTAGAGGGGAGGAAGG - Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046211553 8:111082631-111082653 CTGTGAATGAGCAGTGTGGAAGG - Intergenic
1046219978 8:111201193-111201215 CTGGAGCAGAGCAGGCAGGAAGG + Intergenic
1046695284 8:117332958-117332980 CTAAGGCTGAGCACGGAGGCTGG + Intergenic
1046906728 8:119581680-119581702 CCAAGGCTGAGCAGGGTGGATGG - Intronic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1046946486 8:119978961-119978983 GTGGGGGTGAGCAGGGAGCAGGG - Intronic
1047024529 8:120811686-120811708 CTGGTTCTGAGCAGCGAGGAGGG - Exonic
1047292618 8:123542769-123542791 CTGGGGCCGAGGTGGGAGGATGG - Intergenic
1047409656 8:124614057-124614079 GGGTGGCTGAGGTGGGAGGATGG + Intronic
1047975586 8:130127155-130127177 GTGTGGCTGAGTAGGAAGGAAGG + Intronic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048398904 8:134044762-134044784 CTGGGGCCGAGCATGGAAGAGGG + Intergenic
1048450609 8:134530045-134530067 CTGTGGCATAGCAGGCAGGAGGG + Intronic
1048980735 8:139702436-139702458 GTGTGCCTGAGCCGGGAGGGCGG - Intronic
1049098983 8:140565838-140565860 GGGTGGCTGAGGTGGGAGGATGG + Intronic
1049211229 8:141387287-141387309 CTGGAGCTCAGCAGGCAGGAGGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049349283 8:142155354-142155376 CTGGAGCTGAGCAGGGAGCCTGG - Intergenic
1049353577 8:142177061-142177083 CAGAGGCTGGGCAGGGTGGAAGG - Intergenic
1049359014 8:142203005-142203027 CTGTGACTGTGCAGGGTGAACGG + Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1049722153 8:144123376-144123398 CTGAGGCTGGGAAGGGAGGTGGG + Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1049998685 9:1053254-1053276 CTGTGGCAGGGCAGGCAGGGTGG - Intronic
1051162381 9:14222688-14222710 GGGAGGCTGAGCTGGGAGGATGG + Intronic
1051613288 9:18982139-18982161 TTTTGGCTGAGCTGGGTGGAGGG - Intronic
1051640249 9:19218189-19218211 AAGAGGCTGAGCTGGGAGGATGG - Intergenic
1051780583 9:20684408-20684430 CTGGGGCTGAGCTGGGAGACGGG + Intronic
1051866383 9:21687885-21687907 AAGAGGCTGAGAAGGGAGGATGG - Intergenic
1052420198 9:28234084-28234106 CTGTGGCTGAGCTGGTACTAAGG - Intronic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1052922568 9:33983579-33983601 CTGTGTCTCACCAGGGAGGGCGG - Intronic
1053084993 9:35211854-35211876 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053306907 9:36991002-36991024 CCGAGGCTGAGCTGGGAGGATGG + Intronic
1053379853 9:37639763-37639785 GGGTGGCTGAGGCGGGAGGATGG - Intronic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053649634 9:40152770-40152792 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1053756117 9:41311177-41311199 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054330148 9:63744533-63744555 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1054534947 9:66223434-66223456 CTGTGATGGAGCAGGGAGCAGGG + Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1054909088 9:70437689-70437711 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1055139373 9:72858435-72858457 CTGGGGCTGTCCAGGCAGGAGGG + Intergenic
1056005048 9:82260731-82260753 GTGTTGGTGAGCAGGGAGGAGGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056109946 9:83384938-83384960 CTCTGGCTGAGCTGGGAGCTGGG + Intronic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1056852561 9:90096705-90096727 CCCTGGTTGAGCAGGGAAGAGGG + Intergenic
1057178752 9:93017916-93017938 CTGTGTCTGAGCAGGATGGGAGG + Intronic
1057186679 9:93061088-93061110 CTGGGGCTGACCTGGGAGCAGGG - Intronic
1057212553 9:93208135-93208157 CTGTGGCGGAGCCTGGAGCAGGG + Intronic
1057592138 9:96381825-96381847 CTGTGCCTGGGCGGGGAGGTAGG - Intronic
1057943257 9:99303299-99303321 CTGGGGAGGAGCAGGAAGGATGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058668922 9:107344262-107344284 CTGGGACTGAGGAGTGAGGAAGG + Intergenic
1058710985 9:107679018-107679040 CAGAGGCTGAGAAGGGAGAATGG - Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1058952198 9:109914405-109914427 CTGTGGCTGAGCTGGGCATATGG - Intronic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059036876 9:110763690-110763712 GTGTGCCTGTGCAGGGAGGGAGG + Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059220305 9:112609789-112609811 GGGAGGCTGAGCGGGGAGGATGG - Intronic
1059316937 9:113433918-113433940 AGGAGGCTGAGCTGGGAGGATGG - Intergenic
1059946052 9:119409489-119409511 TCCTGGGTGAGCAGGGAGGAGGG - Intergenic
1060005145 9:119993120-119993142 CTTTGGCAGAGCAGGGATGTGGG + Intergenic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1060973717 9:127753294-127753316 ATGTGGGGGAGCAGGGCGGAGGG + Intronic
1061180714 9:129023598-129023620 CTGAGGCTGAGCAAGGGGCAGGG + Intronic
1061287055 9:129629858-129629880 GGGAGGCTGAGCAGGGAGGATGG + Intronic
1061292411 9:129658694-129658716 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1061408076 9:130403543-130403565 CGGTGGCTGAGGTGGGAGGTCGG + Intronic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1061520981 9:131117692-131117714 CTGGGGCTTAGCAGGGAAGCTGG - Intronic
1061661067 9:132130698-132130720 GGGTGGCAGAGCAGGGAGCAAGG - Intergenic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1061912969 9:133734697-133734719 GTGAGGCCGGGCAGGGAGGATGG + Intronic
1062036828 9:134386200-134386222 CGGCGGCTGAGCGGGCAGGAAGG - Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062572372 9:137191572-137191594 CCTTGGCTGAGAAGGGAGCAGGG - Intergenic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1202797376 9_KI270719v1_random:135959-135981 CTGTGATGGAGCAGGGAGCAGGG - Intergenic
1203524692 Un_GL000213v1:76024-76046 CAGAGGCTGAGCAGGGTGGGGGG + Intergenic
1185474114 X:403463-403485 CTGTGGCAGAGAAGGGAAAATGG - Intergenic
1185483948 X:468266-468288 CTGGGGCAGGGCAGGAAGGAGGG - Intergenic
1185854225 X:3519396-3519418 CGGAGGCTGAGGCGGGAGGATGG - Intergenic
1186078563 X:5906751-5906773 GGGAGGCTGAGCGGGGAGGATGG - Intronic
1186159526 X:6762085-6762107 CAGGGGCTGAGGCGGGAGGATGG + Intergenic
1186400448 X:9253769-9253791 CGGGGGCTGAGGAGAGAGGATGG + Intergenic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1186735818 X:12462882-12462904 TGGAGGCTGAGCTGGGAGGATGG + Intronic
1186751441 X:12625623-12625645 CAGTGGCTGAGAAGGGTGCAGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187298253 X:18023664-18023686 CTGTGACGGAGAAGGGAGAAGGG - Intergenic
1187349855 X:18503286-18503308 CAGAGGCTGAGATGGGAGGATGG - Intronic
1187428122 X:19197005-19197027 CTGTGGCAGAGTAGGGATGGGGG - Intergenic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189384087 X:40522339-40522361 CTGTGGTACAGCAGAGAGGAGGG + Intergenic
1189943016 X:46146534-46146556 CAGAGGCAGAGCGGGGAGGATGG - Intergenic
1190335147 X:49257634-49257656 CGGTGAATGGGCAGGGAGGAGGG - Intronic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1191707156 X:64105352-64105374 CTCTGGCTCAGCTGGGAAGACGG - Intergenic
1192261681 X:69509332-69509354 GTGTGGCAGAACTGGGAGGATGG - Intronic
1192752916 X:74013131-74013153 CTCTGGCTGTGCAGGAAGGTTGG - Intergenic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1195296751 X:103486091-103486113 CTGTGGCTGAATAGGAATGAAGG + Intergenic
1197230836 X:124002110-124002132 CAGTTACTGAGGAGGGAGGATGG + Intronic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197971388 X:132118841-132118863 CTGTGGGGGAGCAGAGATGAAGG - Intronic
1198191860 X:134315399-134315421 CTGAGGCTGGGCAGGGTGGCTGG - Intergenic
1198484266 X:137070866-137070888 AGGGGGCTGAGCAGGGAGGCAGG - Intergenic
1198528464 X:137525592-137525614 CTGTGTGTGAGCAGGAAGGCAGG + Intergenic
1198937610 X:141915171-141915193 GTGAGGCAGAGCAGGGAGGGGGG + Intergenic
1198961444 X:142187693-142187715 GTGAGGCAGAGCAGGGAGGGTGG - Intergenic
1199044942 X:143158877-143158899 CTGTGTCTTAGCATGGAAGAAGG + Intergenic
1199153518 X:144518708-144518730 GAGTGGCTGAGCAGGGAGGTGGG - Intergenic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1200023896 X:153238691-153238713 CTGATTCTGAGCAGGCAGGAGGG - Intergenic
1200072883 X:153537713-153537735 CGGGGGCTGGGCAAGGAGGAGGG - Intronic
1200080596 X:153574473-153574495 CTGAGACTGAGCAGAGAGCATGG + Intronic
1200359825 X:155592889-155592911 CTGAGGCTGGGCATGGAGGCTGG - Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200941654 Y:8788378-8788400 CTGTGGCTGAAGAGGGATAATGG - Intergenic
1201229800 Y:11853145-11853167 CTGTGGCTGAGTGGGGAGAATGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201559457 Y:15300734-15300756 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1202297670 Y:23376923-23376945 ATGAGGCTGAGATGGGAGGACGG - Intergenic
1202573139 Y:26293674-26293696 ATGAGGCTGAGATGGGAGGACGG + Intergenic