ID: 1165261096

View in Genome Browser
Species Human (GRCh38)
Location 19:34618691-34618713
Sequence TTTCACATGCAGGGTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 25, 3: 90, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165261096 Original CRISPR TTTCACATGCAGGGTGTGTA AGG (reversed) Intronic
900340553 1:2186704-2186726 TTACACCTGCCGGGTGAGTAGGG + Intronic
903039461 1:20517868-20517890 TTTTACACACAAGGTGTGTAGGG + Intergenic
904059060 1:27693421-27693443 TTTTACATGCAAGGTGTGTAAGG - Intergenic
904570110 1:31457572-31457594 GTTTATATGCAAGGTGTGTAAGG - Intergenic
905532671 1:38694537-38694559 TTTGGGATGCAGGGTGTGGAGGG - Intergenic
906655854 1:47548037-47548059 TTTAACATGCGGGGTGGGTGGGG - Intergenic
906859552 1:49344347-49344369 TTTTACATGTAAGGTGTATAAGG + Intronic
907511137 1:54960940-54960962 TTTTACATGCAAGGTGTGTAAGG + Intergenic
908733373 1:67250150-67250172 ATTTACATGCAAGGTGTGTCAGG - Intronic
909201059 1:72690727-72690749 TTTTACATGCAAGGCATGTAAGG - Intergenic
909575877 1:77175525-77175547 TTTTACATGCAAGGTGTATAAGG + Intronic
909600954 1:77461011-77461033 TTTCACATACAGGCTGGGTGTGG - Intronic
911881817 1:103249240-103249262 GTTCACATGCTGGTAGTGTATGG - Intergenic
912407823 1:109456025-109456047 ATTTACATGCAAGGTGTGTAAGG - Intergenic
912461558 1:109835960-109835982 TTTTACATACAAGGTGTGTAGGG + Intergenic
912979694 1:114360185-114360207 TTTTACATGCAAGATGTATAAGG + Intergenic
914371091 1:147024959-147024981 CTTCACATGCAGGGTGTTCCAGG - Intergenic
916035622 1:160920123-160920145 TTTTAAATGCAAGGTGTGTGAGG - Intergenic
917232127 1:172849135-172849157 GTTTACATGCAAGGTGTGTAAGG - Intergenic
917293771 1:173497284-173497306 TTTTACATGTAAGGTGTGTAAGG + Intergenic
918465168 1:184813988-184814010 GTTTACATGCAAGGTATGTAAGG + Intronic
918652123 1:186978355-186978377 ATTTACATGCAGGGTGCTTAAGG + Intronic
918772294 1:188576879-188576901 TTTCACATGCAAGGTGTATAAGG + Intergenic
919910868 1:202109944-202109966 GTTCTCATGTAGGGTGTATAGGG + Intergenic
920499336 1:206476586-206476608 TTTCACCTGCAGGCGGTGAAAGG + Intronic
920716268 1:208343115-208343137 TAGCACATGCATGTTGTGTAGGG - Intergenic
921113763 1:212066157-212066179 TTTCATATTCCTGGTGTGTAGGG + Intronic
922189456 1:223304488-223304510 GTTACCATGCAGGGTGTGTATGG - Intronic
924483422 1:244456907-244456929 TTTTACATACAAGGTGTGTAAGG + Intronic
1064745079 10:18470777-18470799 TCTCAAATGCTGGGTGTGGATGG + Intronic
1065065845 10:21963353-21963375 TTTTACATGCAAGGTGTGTAAGG + Intronic
1067151099 10:43735543-43735565 TTGCACGTGAAAGGTGTGTACGG + Intergenic
1067822921 10:49546448-49546470 TTTTACATGCAAGGTATGTAAGG - Intergenic
1068204817 10:53836304-53836326 TTACACATGCAGGCTGTACAAGG + Intronic
1071357114 10:84809172-84809194 TTTTACATACAAGGTGTATAAGG - Intergenic
1071392190 10:85187070-85187092 TTTTACATATAGGCTGTGTATGG - Intergenic
1071774266 10:88767531-88767553 TTTCACCAATAGGGTGTGTAAGG + Intronic
1073485175 10:103812690-103812712 TTTCCCCTGCAGGCTGTGTGTGG - Intronic
1076521367 10:131083403-131083425 TTTCCAATGCAGTGTGTGTTGGG - Intergenic
1077522226 11:3043216-3043238 TCTCAGATGCAGGTTGTGTAAGG - Intronic
1077927004 11:6691057-6691079 TTTTACATCCAAAGTGTGTAGGG + Intergenic
1077936062 11:6786767-6786789 GTTCACATGCATGGTGGGTGTGG + Intergenic
1079235521 11:18686416-18686438 TTTTACATGCAAGGTGTGTACGG + Intergenic
1079765159 11:24383109-24383131 TTCCAGATGCAGGCTGTGAAAGG - Intergenic
1080058332 11:27930929-27930951 TTTTATATGCAAGGAGTGTAAGG - Intergenic
1080810587 11:35700462-35700484 TTTTACAAGCAAGGTGTGTGAGG - Intronic
1082866593 11:57905444-57905466 TTTTACATGTAAGGTGTGTAAGG - Intergenic
1083504265 11:63140746-63140768 TTTGACATACAAGGTGCGTAGGG + Intronic
1084323375 11:68385734-68385756 ATTCACTTGAAGGGTGTGTCTGG + Intronic
1084878475 11:72152206-72152228 TTTTACATGCAAGGTGTGTAAGG - Intergenic
1085356105 11:75838641-75838663 TTACAAATGCAGGCTGGGTACGG - Intronic
1085974720 11:81638275-81638297 TTTTACATGTAAGGTGTGTAAGG + Intergenic
1086737851 11:90329337-90329359 TTTCCCATGCAGAGTATCTAGGG + Intergenic
1090769776 11:129909672-129909694 TTTCTCATGGAAGGTGTGGAAGG - Intronic
1091104114 11:132902408-132902430 TGGCACATGCTGGGTGTGCACGG + Intronic
1091704714 12:2685982-2686004 TTCCAAAGGCAGGGTGTGCAGGG + Intronic
1091711287 12:2742321-2742343 TTCCAAAGGCAGGGTGTGCAGGG + Intergenic
1091939110 12:4460170-4460192 TTTCACATGCAAGTTTTGTGTGG - Intergenic
1092653338 12:10657872-10657894 TTTAACATGCAAGGTGTGTAAGG + Intronic
1093101322 12:15033079-15033101 TTTTACATACAATGTGTGTAGGG - Intergenic
1093717072 12:22394830-22394852 TTTCACATCCAGACTGTATAAGG - Intronic
1093846361 12:23976711-23976733 TTTTATATGCATGGAGTGTAAGG + Intergenic
1094431224 12:30371938-30371960 GTTTACATACAAGGTGTGTAGGG - Intergenic
1098005155 12:65988702-65988724 TTTTATATTCAAGGTGTGTAAGG - Intergenic
1098294188 12:68987215-68987237 TTTTACGTGCAAGGTGTGTGAGG + Intergenic
1098438145 12:70490608-70490630 TTTTACATGCAAGGTGTGCAAGG - Intergenic
1099037830 12:77612474-77612496 TCTCACCTCCAGGGTGTGTAAGG - Intergenic
1099320629 12:81144183-81144205 TTTCACAAGCAAGGTTTATATGG - Intronic
1100800391 12:98224593-98224615 GATCACATGGAGGGTGGGTAGGG - Intergenic
1104541211 12:129666813-129666835 TTTTACATACAAGGTGTGTAGGG + Intronic
1105778417 13:23683892-23683914 TTTTACATGTAAGTTGTGTAAGG + Intergenic
1106336741 13:28790350-28790372 TTTTACATGCAGAGTGTATAAGG - Intergenic
1106471286 13:30057159-30057181 TTTTACATGCAAGGTGTATAAGG + Intergenic
1107326634 13:39250657-39250679 TTTCACAAGCAGTGTGCCTAAGG - Intergenic
1107426832 13:40302357-40302379 TTTTACATGCAAGGTTTGTAAGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110797941 13:79661423-79661445 TTTCACACCCAGGCTGTGGAGGG + Intergenic
1110852611 13:80262585-80262607 TTTCACTACCAGGGTGGGTAGGG + Intergenic
1111189858 13:84792770-84792792 TTTTACATACAAGGTGTATAAGG + Intergenic
1111989353 13:95101366-95101388 TTTTAGATGAGGGGTGTGTAGGG + Intronic
1113048290 13:106180553-106180575 CTTCAGATGGAGGGTGTGTTAGG + Intergenic
1113898414 13:113781459-113781481 GTTTACATGCAAGGTGTGTAAGG - Intronic
1114256509 14:21006887-21006909 GTTTACATGCCAGGTGTGTAAGG + Intergenic
1114334933 14:21678648-21678670 TTTTACGTGCAGGGTATGTGAGG + Intergenic
1117817732 14:59614901-59614923 TTTTACATACAAGGTATGTAGGG + Intronic
1118118466 14:62808153-62808175 TTTTACATGTAAGGTGTGTAAGG + Intronic
1118775426 14:68970918-68970940 TTTTACATGCAGGGAAAGTAAGG - Intronic
1119305282 14:73603009-73603031 TTTTACATGCAAGGTGTGTGAGG - Intergenic
1122591897 14:102859257-102859279 TTTTACATGCAAGGTGTGTAGGG - Intronic
1123468230 15:20531518-20531540 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1123649885 15:22469546-22469568 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1123681246 15:22765738-22765760 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
1123728546 15:23126728-23126750 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1123740288 15:23278365-23278387 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1123746710 15:23324193-23324215 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1123771062 15:23529802-23529824 TTTTGCATGCAAGGTGTATAGGG - Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124278978 15:28347509-28347531 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1124303721 15:28564099-28564121 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1124333456 15:28840200-28840222 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
1124532617 15:30520576-30520598 TTTCACAGGCTGGGTGTGTGGGG + Intergenic
1124766036 15:32487068-32487090 TTTCACAGGCTGGGTGTGTGGGG - Intergenic
1126072658 15:44879115-44879137 TTTTACATGCAAGATGTGTAAGG - Intergenic
1126091021 15:45052094-45052116 ATTTACATGCAAGGTGTGTAAGG - Intronic
1126301134 15:47197327-47197349 TTTCACAGGCAGTGAGTTTAAGG + Intronic
1128640744 15:69334697-69334719 TTTTACATACTAGGTGTGTAGGG + Intronic
1129643341 15:77405989-77406011 TTTCACAAGCTGCGTTTGTATGG + Intronic
1129825840 15:78634553-78634575 TTTGACAGGCTGGGTGTGTGTGG + Intronic
1130090286 15:80815116-80815138 TCTTACATGCAGGGTATATATGG - Intronic
1130395177 15:83495050-83495072 TTCCACCTGCAGAGGGTGTATGG + Intronic
1131861619 15:96659862-96659884 TTTCACAGCCTGGGTGTCTATGG - Intergenic
1131914518 15:97250309-97250331 TTTTACAAACAAGGTGTGTAGGG - Intergenic
1132150745 15:99456382-99456404 ATTCACATGCAGGGTGGAAATGG + Intergenic
1134013319 16:10871217-10871239 TTCCTCTTGCAGGGAGTGTATGG - Intergenic
1135931314 16:26739777-26739799 ATTGACATTCAGGGTGTGTCAGG - Intergenic
1138008911 16:53360223-53360245 TTTGACAGGCTGGGTGTGTGGGG - Intergenic
1138015410 16:53423781-53423803 GTTTACATGCAAGGTGTGTGAGG - Intergenic
1138262265 16:55632669-55632691 TTTTACATGCAAGGCATGTAAGG + Intergenic
1140282528 16:73567606-73567628 CTTCACATGGAGGTTGAGTATGG - Intergenic
1141259455 16:82439649-82439671 TTTCACAGGCAGGTTGTGGGTGG + Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1145100671 17:20074062-20074084 TTTCCCATCCAGGGTGAATAGGG + Intronic
1145114466 17:20196205-20196227 TTTTACCTGTAAGGTGTGTAAGG - Intronic
1149476898 17:56969621-56969643 GTTCACATGCAAGCAGTGTAAGG + Intergenic
1150349547 17:64432324-64432346 TTTCACATGCAAGGTATGTAAGG + Intergenic
1151492791 17:74442810-74442832 TGTCACACGCACGGTGTGCATGG + Intronic
1151690305 17:75680033-75680055 TTTCAAAGGAAGGGTGTGTCAGG - Intronic
1152213127 17:79014215-79014237 TTTTACATGCACAGTGTGTAAGG + Intergenic
1153349369 18:4061208-4061230 TTTTACATGCAGGGCATGTAAGG + Intronic
1154365461 18:13704159-13704181 TTTTACATGCAAGGCGTGTGAGG + Intronic
1155266540 18:24100158-24100180 GATCACATTCAGGGTGTTTAGGG + Intronic
1157040492 18:44033370-44033392 GTTGACAAGGAGGGTGTGTAAGG + Intergenic
1158727189 18:59984242-59984264 TTTGACATCCACTGTGTGTATGG + Intergenic
1159431636 18:68359899-68359921 ATTTACATGCAAGGTATGTAAGG + Intergenic
1159874464 18:73794916-73794938 CTTCACATGCAGGTTTTGTGTGG - Intergenic
1160401253 18:78612978-78613000 TTTCTCTGGCAGGGTGTGGAGGG - Intergenic
1160500511 18:79399466-79399488 TTCCACATGTCGGGTGTATATGG + Intronic
1162711688 19:12599683-12599705 TTTTACATGCAAGGTGTGTAAGG + Intronic
1163929220 19:20372798-20372820 ATTTACTTGCAAGGTGTGTAAGG + Intergenic
1165261096 19:34618691-34618713 TTTCACATGCAGGGTGTGTAAGG - Intronic
1166402229 19:42491353-42491375 TTTTACATGCAAGGTATATAAGG - Intergenic
1168387137 19:55973667-55973689 TTTCACAAGTAAGCTGTGTAAGG - Exonic
926450864 2:13002160-13002182 TAGCACATGCAGGGTGTGGTTGG + Intergenic
926503255 2:13680490-13680512 GTTTATATGCAAGGTGTGTAAGG + Intergenic
926710327 2:15874480-15874502 TTAAACATGCAGTGTGTGTAGGG - Intergenic
926955777 2:18297718-18297740 TTCCACATGCTGGATGTGTTGGG - Intronic
928459192 2:31454572-31454594 ATTTACATGCAAGGTGTGCAAGG - Intergenic
929527623 2:42720629-42720651 TTTCCCATGCAAGGTGGGAAGGG - Intronic
930504592 2:52266948-52266970 TTTTACATGCAAAGTGTGTAAGG + Intergenic
932966060 2:76475821-76475843 GTTTACATGCAAGGTGTGTAAGG + Intergenic
934104592 2:88683967-88683989 TTTTACATGGAAGGTGTGTAAGG + Intergenic
934577008 2:95408989-95409011 TTTCACATTCTGGGTTTGTCTGG + Intronic
934639265 2:96017394-96017416 TTTCACATCCTGGGTTTGTCTGG + Intergenic
934647674 2:96068519-96068541 GTTCCCAGGCAGGGTGTGCAGGG + Intergenic
934794384 2:97088017-97088039 TTTCACATCCTGGGTTTGTCTGG - Intronic
936495262 2:113014939-113014961 TTTCAGAAGCAGGCTGTGTGGGG + Intergenic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
937712214 2:124990948-124990970 TTTTACATGCAAGGTATGTAAGG + Intergenic
938761860 2:134433352-134433374 ATTCACATGCAATCTGTGTATGG + Intronic
940239015 2:151542919-151542941 TAGCACATGGAGGGTGTGGAAGG - Intronic
940499124 2:154472812-154472834 TTTTACATGCAAGGTGTGTGAGG - Intergenic
941639667 2:167973644-167973666 TTTTACATGCAAGGTGTGTGAGG + Intronic
942162208 2:173202541-173202563 TTTCACCTCAAGGGAGTGTAAGG - Intronic
943179680 2:184526687-184526709 ATTTACATGTAAGGTGTGTAAGG - Intergenic
943341032 2:186682469-186682491 TTTGACATGTAGGGATTGTAGGG + Intergenic
943466692 2:188237152-188237174 TTCTACATGCAAGTTGTGTAAGG + Intergenic
943536075 2:189152436-189152458 TTTCACATACATTGTGTGTATGG - Intronic
943666227 2:190611751-190611773 GTTTACATGCAAGGTGTGTAAGG - Intergenic
943969321 2:194383293-194383315 TTTTACATGCAAGGTGTGTAAGG - Intergenic
945454951 2:210040930-210040952 TTTCAAATGCAAAGTTTGTAGGG - Intronic
945704408 2:213211549-213211571 GTTTACATGCAAGGTGTGTAAGG - Intergenic
1170594120 20:17792665-17792687 TTCCAAATTCAGGGAGTGTAAGG + Intergenic
1171318982 20:24222026-24222048 TTTTACATGCAAGGTGTGTAAGG - Intergenic
1171511869 20:25692635-25692657 TTTCATTTCCAGGGTGTGAATGG + Intronic
1173751968 20:45484016-45484038 TTTTACATGCAAGGTGTGTCAGG - Intergenic
1175607070 20:60319713-60319735 TTTCAGATCCAGGCTGTGTGGGG + Intergenic
1183325725 22:37192230-37192252 TTTTATATGCAAGGTGTGTAAGG - Intronic
1184292106 22:43502892-43502914 ATTGACAGCCAGGGTGTGTATGG - Intronic
1184848481 22:47103472-47103494 TACCAGATGCAGGGTGGGTAGGG + Intronic
949556736 3:5160043-5160065 GTTCACATGCAGGCTGTGTGGGG - Intronic
950501248 3:13365328-13365350 TTTTACAGGCAGGGAATGTAAGG + Intronic
950605636 3:14077253-14077275 GTTTACATGCAAGGTGTGTAAGG - Intronic
951250143 3:20384787-20384809 GTTTACATGCAAGGTGTGTAAGG + Intergenic
951256029 3:20450758-20450780 ATTAACATGCAAGGTGTGTAAGG - Intergenic
951507122 3:23459652-23459674 GTTCACATGCTGAGTTTGTATGG - Intronic
951800688 3:26592579-26592601 CTTCATATGCAAGGTGAGTATGG - Intergenic
952807744 3:37373113-37373135 TTTTACATGCAAGGTGTATAAGG + Intergenic
953153724 3:40348960-40348982 TTTTACACACAAGGTGTGTAAGG + Intergenic
956300623 3:67768675-67768697 TTTCACTTGCAGAGTCTGTGTGG + Intergenic
958592225 3:96172509-96172531 ATTTACATGCAAGGTGTGTTAGG + Intergenic
958694961 3:97515253-97515275 TTTCAATTGCAGGGTGTGTGTGG + Intronic
959371827 3:105536594-105536616 TTTATCATGCTGGCTGTGTAAGG + Intronic
960654465 3:119987374-119987396 GTTTATATGCAAGGTGTGTAAGG + Intronic
961337873 3:126194811-126194833 TTTTACATGCAAGGTATGTGAGG - Intronic
961595961 3:128016797-128016819 TTTTACATGCAAGGTGTGTGAGG + Intergenic
962234554 3:133696039-133696061 CTTCACAAGAAGGGTGAGTATGG + Intergenic
962427607 3:135285933-135285955 TTTTACATACAAGGTGTGTAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963508698 3:146220887-146220909 TTTCACCTGCAGGCTGTTCAGGG + Exonic
965023192 3:163261923-163261945 ATTCACATGCAGGTTTTGTGTGG + Intergenic
965205521 3:165715871-165715893 ATTTACATGCAAGGTGTTTAAGG - Intergenic
965736217 3:171823795-171823817 TTTCACCTCCAGGATGAGTAAGG - Intergenic
966721373 3:183065522-183065544 TTCTACATGTAAGGTGTGTAAGG + Intronic
968847589 4:3054440-3054462 TTTTACATGCAAGGTGTGTGAGG + Intergenic
970711993 4:18874907-18874929 TTTTATGTGCAAGGTGTGTAAGG - Intergenic
970772431 4:19630038-19630060 TTTAACATGCAACGTGTGTTTGG + Intergenic
971006510 4:22380002-22380024 TTTTACATGCAAGGTGTGTAAGG + Intronic
971443727 4:26718951-26718973 TTCCACATGCAGGGACTATAGGG - Intronic
972795801 4:42418182-42418204 TTTTGCATGCAGGGAGAGTAGGG - Intronic
973814019 4:54602077-54602099 GTTTACATACAAGGTGTGTAAGG - Intergenic
975061598 4:70009641-70009663 TTTTACATGCTAAGTGTGTAAGG - Intergenic
976475436 4:85477338-85477360 GTTCAGATTCAGGGTATGTAAGG - Intronic
977733238 4:100380045-100380067 TTTCACTACCAGGGTGGGTAGGG - Intergenic
978440123 4:108725355-108725377 TTTTACATGCAAGGTGTGTAAGG - Intergenic
979055155 4:115984244-115984266 TTCCACAGGCAGGGTGTGGTGGG - Intergenic
979591485 4:122485726-122485748 TTTTACATGCCAGGTGTGTAAGG - Intergenic
979832918 4:125322618-125322640 TTTCACTTGCATGTTGTGTCTGG - Intronic
980778562 4:137466729-137466751 TTTTACATGCAAGGTGTGTGAGG + Intergenic
981201189 4:141981359-141981381 GTTTACTTGCAAGGTGTGTAAGG + Intergenic
981202569 4:141998132-141998154 GTTTACATGCAAGGTGTGTAAGG - Intergenic
983214008 4:164986097-164986119 TTTCCCATTAAAGGTGTGTAAGG + Intergenic
983989425 4:174099444-174099466 TTTTAGATTCAGGGTGTATATGG - Intergenic
984400645 4:179259676-179259698 ATTTACATGCAAGTTGTGTAAGG - Intergenic
984441468 4:179775890-179775912 TTTTACATGCAAGGTGTGTAAGG + Intergenic
984527537 4:180875366-180875388 TTCCACTACCAGGGTGTGTAGGG + Intergenic
985620720 5:953600-953622 TTTCCCCTGCAGTGTGTGCAGGG + Intergenic
985687302 5:1289382-1289404 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687357 5:1289592-1289614 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687366 5:1289634-1289656 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687388 5:1289718-1289740 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687419 5:1289844-1289866 TGTCACTTGCAGGGTGAGTGAGG - Intronic
985687431 5:1289886-1289908 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687443 5:1289928-1289950 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687455 5:1289970-1289992 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687467 5:1290012-1290034 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687491 5:1290096-1290118 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687567 5:1290390-1290412 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687576 5:1290432-1290454 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687597 5:1290516-1290538 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687642 5:1290684-1290706 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687653 5:1290726-1290748 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687664 5:1290768-1290790 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687675 5:1290810-1290832 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687687 5:1290852-1290874 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687699 5:1290894-1290916 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687711 5:1290936-1290958 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687756 5:1291104-1291126 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687824 5:1291355-1291377 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687880 5:1291565-1291587 TGTCACGTGCAGGGTGAGTGAGG - Intronic
985687926 5:1291733-1291755 TGTCACGTGCAGGGTGAGTGAGG - Intronic
986392235 5:7297732-7297754 TTTGACAGGCTGGGTGTGTAGGG - Intergenic
990070724 5:51779952-51779974 TTTTACATGCAAGTTTTGTAAGG - Intergenic
990290655 5:54347725-54347747 GTTTACATGCAAGGTGTGTAAGG + Intergenic
992985342 5:82223004-82223026 TTTCAAAGGCAGGCTGTGTGTGG + Intronic
993422304 5:87717724-87717746 TTTTACATACAATGTGTGTAGGG - Intergenic
993745393 5:91591158-91591180 TTTTATATGCAAGGTGTGTAAGG - Intergenic
994467828 5:100161500-100161522 TTTTACATGCAAGGTGTGTAAGG - Intergenic
994562756 5:101397169-101397191 TTTTACGTGCAAGGTGTGTGAGG + Intergenic
995320423 5:110827367-110827389 ATTTACATGCAAGGTGTGTAAGG + Intergenic
996057491 5:118997985-118998007 CTTTACATGCAAGATGTGTAAGG - Intergenic
998983408 5:147729064-147729086 TTTTACATGCAAGGTGTGTAAGG + Intronic
999362104 5:150993859-150993881 TTTTACATGCAAGGTGTGTTTGG - Intergenic
1000066546 5:157697600-157697622 TTCTACATGTAAGGTGTGTAGGG + Intergenic
1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG + Intergenic
1000415792 5:160982327-160982349 TTTTACATACAAGGTGTCTAAGG + Intergenic
1000948214 5:167448225-167448247 TTTCACATCCATGGTGTCTTTGG - Intronic
1001263615 5:170255405-170255427 TTCCACATGCAGTGTGTGCACGG - Intronic
1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG + Intergenic
1002437069 5:179238265-179238287 TTTCACCTGCTGGGTGTCCACGG + Intronic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1004765745 6:18724318-18724340 TTTTACATGCAAGGTGTGTAAGG + Intergenic
1005066905 6:21827168-21827190 TTTAATATGCAGGGTGGGTTGGG + Intergenic
1006819544 6:36881220-36881242 GTTTACATGCAAGGTGTGTAAGG + Intronic
1009726819 6:67545376-67545398 TTTTACATGCAAGTTATGTAAGG + Intergenic
1011341680 6:86322410-86322432 TTTTACATGCAAGGTGTATGAGG + Intergenic
1013500718 6:110748294-110748316 TTTCACATCCAGGCTGTCAAAGG + Intronic
1013538256 6:111083248-111083270 TTTCAGAAGCAGGGTCTGCAGGG + Intergenic
1013946948 6:115732694-115732716 TTTCACATGCAGGTTGTATGTGG - Intergenic
1014097516 6:117476896-117476918 TTTTACATGCAAGTTGTGTAAGG - Intronic
1014111716 6:117625157-117625179 GTTTACATGCAAGGTGTGTGAGG + Intergenic
1014200532 6:118604522-118604544 TTCTATATGCAAGGTGTGTAAGG - Intronic
1014810965 6:125885147-125885169 TTTCTCCTGCAGGGTGTGGTTGG + Exonic
1016296278 6:142576543-142576565 TTTTACAAGCAAGGTATGTAAGG + Intergenic
1017261906 6:152397337-152397359 TTTCGCATGCAGGGTGGATCAGG - Intronic
1018151600 6:160944960-160944982 GTCCACATGCAGGGTGAGAAGGG + Intergenic
1018802033 6:167230625-167230647 CTTTACATACATGGTGTGTAGGG + Intergenic
1019486754 7:1292947-1292969 TTTCACATCCAGGCAGTGAATGG + Intergenic
1022746957 7:33182210-33182232 TTTTATATGCAAGGTGTGTCAGG - Intronic
1025830397 7:65044109-65044131 TTTCACATTCAGGTTCTGCAGGG - Intergenic
1025917557 7:65877893-65877915 TTTCACATTCAGGTTCTGCAGGG - Intronic
1027024825 7:74843543-74843565 TTTCACTGGCAGGGTGGGTGTGG - Intronic
1027062939 7:75100576-75100598 TTTCACTGGCAGGGTGGGTGTGG + Intronic
1027597127 7:80187427-80187449 AATCACATGCAGAGTGGGTAAGG + Intronic
1027960952 7:84944316-84944338 GTTTACATGCAAGGTGTGTAAGG + Intergenic
1028639234 7:93024403-93024425 TTTCACATGCAGGGAGGGAGAGG - Intergenic
1029956186 7:104642714-104642736 TCTCACATGCAGGGTGCGACAGG + Intronic
1034250155 7:149683670-149683692 TTTTACATGCAAGGTGTATAAGG - Intergenic
1034555211 7:151845908-151845930 TTTCACACACACAGTGTGTATGG + Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1035071884 7:156150994-156151016 TTTCTCATGCAGAGTTTTTAGGG - Intergenic
1035572573 8:682550-682572 TTTCAGCTGCTGGGTGTGAAGGG - Intronic
1037955420 8:23053360-23053382 GTTTACATGCAAGTTGTGTAAGG + Intronic
1040707550 8:50147827-50147849 TGGCACATGCAGTGTGTTTATGG - Intronic
1041228655 8:55727244-55727266 TTTTACATGCAAGGTGTGTAAGG - Intronic
1041393666 8:57370079-57370101 TTTTACGTGCAAGGTGTGTAAGG + Intergenic
1041605011 8:59771557-59771579 ATTTACATGCAAGGTGTGTAAGG - Intergenic
1043706279 8:83355152-83355174 TTTTACATACAAGGTGTGTAAGG - Intergenic
1044032778 8:87259040-87259062 GTTTACATACAAGGTGTGTAAGG - Intronic
1044658930 8:94576873-94576895 TTTTACATGCAACGTGTGTAGGG - Intergenic
1045318464 8:101063380-101063402 TTTGTCATGCAGGGTATGTGGGG + Intergenic
1046385526 8:113504082-113504104 GTTTACATGCAAGGTGTGTAAGG - Intergenic
1047581513 8:126221399-126221421 ATTTACATGCAAGGTATGTAAGG - Intergenic
1048491015 8:134894082-134894104 TTTCAGATACAGGGTGTGTCAGG + Intergenic
1049500611 8:142961940-142961962 CTTTACATGTAAGGTGTGTAAGG + Intergenic
1056970739 9:91199685-91199707 TTTTTCCTGCAGGGTGTTTAAGG + Intergenic
1057174195 9:92983911-92983933 GTTTACATGCAAGATGTGTAGGG - Intronic
1058147183 9:101425080-101425102 TTTCTCAAGCAGGGTATATAAGG - Intronic
1058355597 9:104080528-104080550 TTTTACATACAAGGTGTGTAAGG - Intergenic
1058418050 9:104808407-104808429 TTCCACATGAAGGTTGTGTAGGG - Intronic
1058628186 9:106957896-106957918 TTGCACATGAAGGGTTGGTAGGG + Intronic
1059690309 9:116678450-116678472 TTTTACATATAAGGTGTGTAGGG + Intronic
1060306666 9:122419809-122419831 TTTTACATACAAGGTGTGTAGGG - Intergenic
1061830510 9:133290343-133290365 TTCTACATGTAAGGTGTGTAAGG - Intergenic
1185828536 X:3276294-3276316 TTTCACTTGCTGGGCGTGGACGG - Intronic
1187320272 X:18231543-18231565 TTTTACATACAAGGTGTGTAAGG + Intergenic
1188686892 X:33080462-33080484 TTTTACATACAAGGTGTGTAGGG - Intronic
1188802874 X:34553091-34553113 TTTTACATGCAAAGTGTGTGAGG + Intergenic
1189879165 X:45471296-45471318 TTCCACTTCCAGGGTGGGTAGGG + Intergenic
1190136258 X:47801666-47801688 TTTTACATGCAAGGTGTGTAAGG - Intergenic
1190137585 X:47811143-47811165 TTTTACATGCAAGGTGTGTAAGG - Intergenic
1190477879 X:50846197-50846219 TTTTACATACAAGGTATGTAAGG - Intergenic
1190880893 X:54491998-54492020 TTTCAGATGCAGGGATTGTGGGG - Intronic
1191617340 X:63183261-63183283 TTTTACATGCAAGGTTTATAAGG + Intergenic
1191618958 X:63195662-63195684 TTTTACATGCAAGGTTTATAAGG - Intergenic
1191823046 X:65334459-65334481 TTTTACATGCAAGATGTGCAAGG - Intergenic
1192888684 X:75364550-75364572 TTTTACATGCAAGGTGTGTAAGG + Intergenic
1193643872 X:84043933-84043955 TTCCACTAGCAGGGTGGGTAGGG + Intergenic
1194051655 X:89077002-89077024 TTTTACATGCAAGATGTGTAAGG - Intergenic
1194059488 X:89179778-89179800 ATTTACATGGAAGGTGTGTAAGG - Intergenic
1194169929 X:90568669-90568691 TTTTACATGTAAGGTGTGCAAGG - Intergenic
1194331935 X:92593455-92593477 TTTTACATGCATGTTGTGAAAGG + Intronic
1194828207 X:98589815-98589837 TTCTACATGCAAGGTGTGTGAGG - Intergenic
1195219808 X:102735871-102735893 TTTTACATGCAAGGTGTGCAAGG - Intronic
1195650658 X:107280180-107280202 TTTTACATGCAAGGTGTGTAAGG - Intergenic
1195877123 X:109553122-109553144 TTTTACATGCAAGGTGTGTAAGG + Intergenic
1196074340 X:111558501-111558523 GTTTACATGCAAGGTGTGTAAGG - Intergenic
1196162163 X:112497884-112497906 TTTTATATGCAAGGTGTGTAAGG - Intergenic
1199994574 X:153013394-153013416 TTTTACAAGCAAGGTGTGTAAGG - Intergenic
1200516170 Y:4146442-4146464 TTTTACATGTAAGGTGTGCAAGG - Intergenic
1200780327 Y:7209748-7209770 GTTCACATGCATGATGTGTGTGG - Intergenic