ID: 1165265008

View in Genome Browser
Species Human (GRCh38)
Location 19:34654682-34654704
Sequence CATGCAGTTCCTTCTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165265008 Original CRISPR CATGCAGTTCCTTCTGGGTG GGG (reversed) Intronic
900935194 1:5760678-5760700 CTTGCAGTTCCATCTGGCTGGGG - Intergenic
902854779 1:19193633-19193655 CATGGAATTGCTTGTGGGTGGGG - Intronic
902973912 1:20074980-20075002 CAGGCACATCCCTCTGGGTGTGG + Intronic
903228248 1:21906135-21906157 TATGGAGTTCCTTCCAGGTGTGG - Intronic
904895048 1:33810933-33810955 GATGCAGTGTCTTCTGGGTGGGG - Intronic
907724011 1:57001755-57001777 CAGGCAGTTCCTTCTGGCTTCGG + Intronic
907734439 1:57098065-57098087 AATAAAGTTCCTGCTGGGTGCGG - Intronic
907823671 1:57994763-57994785 CCTGGAGATCCTTGTGGGTGGGG + Intronic
908325299 1:63017648-63017670 CATTCAGTTCCCTCTGGGCCTGG + Intergenic
910050161 1:82964064-82964086 CATGCAGATTCTTCTGGTGGAGG + Intergenic
911036295 1:93552459-93552481 CATGCAGCTGCTTTTGGGGGAGG + Exonic
911203520 1:95070129-95070151 CATTCCTTTCCTTCTGGATGTGG - Intronic
911720534 1:101186596-101186618 CTTGCAGTTCCATGTGGCTGGGG - Intergenic
912080520 1:105931083-105931105 CTTACAGTTCCATCTGGCTGGGG - Intergenic
912165545 1:107038939-107038961 CTTGCAGTTCCATGTGGCTGGGG - Intergenic
914991667 1:152504287-152504309 ACTGCAATTTCTTCTGGGTGGGG - Intergenic
918722419 1:187870256-187870278 TATTCCTTTCCTTCTGGGTGTGG - Intergenic
919468910 1:197954633-197954655 CATTGAGTTGCTTCTGGGTGGGG - Intergenic
920035695 1:203063950-203063972 CCCGCAGGTCCTTCTTGGTGAGG - Exonic
920852765 1:209639846-209639868 CCTGCAGGTCCTTCTGGGTAGGG + Intronic
921466496 1:215493639-215493661 CTTGCAGTTCCATGTGGCTGGGG - Intergenic
923275939 1:232396463-232396485 CCTCCAGTTCCTTCATGGTGTGG + Intergenic
923887636 1:238176880-238176902 CACTCAGTTCCTTCTTGCTGTGG + Intergenic
924144953 1:241064293-241064315 AATGCAGATTCTGCTGGGTGTGG + Intronic
1064360723 10:14661896-14661918 CATGCAGTTCTCTCTGTCTGTGG + Intronic
1064379902 10:14832233-14832255 CTTGCTGTTCCTTCTGCCTGCGG - Intronic
1064386368 10:14895464-14895486 AAGGCAGTTCCGGCTGGGTGCGG - Intronic
1066210549 10:33233147-33233169 CAAGCCTTTCCTTCTGGGTGGGG + Intronic
1072604059 10:96963363-96963385 GATGCAGTTCCTTCTTGATGTGG + Intronic
1073287433 10:102397250-102397272 CATGCAGTTCTTTCTTCCTGAGG - Intronic
1074053670 10:109902930-109902952 GAAGCAATTCCTTCTGGGAGTGG - Intronic
1075491747 10:122877428-122877450 CATTGAGTCACTTCTGGGTGGGG + Intronic
1075908297 10:126102049-126102071 CAGGCAGGTCGTTCTGGGTCAGG + Intronic
1078011031 11:7573247-7573269 CAGGCAGTTCATTCTGGATGGGG + Intronic
1078345932 11:10548505-10548527 TCAGCAGTTCCTTGTGGGTGTGG + Intergenic
1078643431 11:13116678-13116700 TATGCCGTTCCTTCTGCCTGGGG + Intergenic
1078870472 11:15339567-15339589 CATGCTGTTCCTTTTAAGTGGGG + Intergenic
1080132544 11:28813987-28814009 CTTGCTCTTCCTTCTGGCTGAGG - Intergenic
1080445148 11:32331562-32331584 CAGGCAGTTTCTTTTGGGTCTGG - Intergenic
1083173294 11:60935181-60935203 CACCCGGTTCCCTCTGGGTGGGG + Intronic
1084327516 11:68410307-68410329 CATGGAGTTCCTTCGTGGAGCGG + Intronic
1085817464 11:79755244-79755266 CATGCTGTTCCTTCTGCCTGGGG + Intergenic
1086737178 11:90321115-90321137 CACTGAGTTGCTTCTGGGTGGGG - Intergenic
1089259457 11:117213708-117213730 CATCCATTTACTTCTTGGTGTGG + Intronic
1089583403 11:119495460-119495482 CAGGCAGGTCCCTCTGGCTGTGG - Intergenic
1090251411 11:125254387-125254409 CAGGCAGATCCCACTGGGTGAGG - Intronic
1090495445 11:127206766-127206788 AATGCAGTTCCTCCTGCCTGAGG + Intergenic
1091982848 12:4880438-4880460 CTTGCAGTTCCATGTGGCTGGGG + Intergenic
1093055016 12:14547343-14547365 CTTGCAGTTTCTTCAGGTTGAGG + Intronic
1093134812 12:15437677-15437699 CCTGCAGATCTTCCTGGGTGTGG - Intronic
1094013695 12:25838215-25838237 CATGCACAGCCTTCTGTGTGAGG - Intergenic
1094038995 12:26103268-26103290 CATTCAGTACCCTGTGGGTGAGG - Intergenic
1095403342 12:41840011-41840033 GATACATTTCCTTCTGGATGTGG + Intergenic
1095858522 12:46888838-46888860 GATGCAGATACTTCTGGCTGGGG + Intergenic
1096327329 12:50676036-50676058 AAATCAGTTCCTTCTGGGTTAGG + Intronic
1099420557 12:82453837-82453859 TATGGAGTTCCTGCTGTGTGAGG + Intronic
1101427753 12:104601688-104601710 GATCTAGATCCTTCTGGGTGTGG + Intronic
1102730466 12:115104358-115104380 CATGCAGTTCTCTCTGGGGCAGG - Intergenic
1103343067 12:120231446-120231468 AATGCAGTTCCTGTTGAGTGAGG - Intronic
1103383591 12:120514250-120514272 TAGGCAGCTCCTTCTGGGGGTGG + Intronic
1104353401 12:128064294-128064316 GATGCAGTCCCTCCTGGATGAGG - Intergenic
1105882335 13:24615729-24615751 TATGCAGTTCCTGCTGCCTGGGG + Intergenic
1107404938 13:40103334-40103356 AATGCAGTGCCTTATGGGAGGGG + Intergenic
1108154865 13:47574977-47574999 GCTGCAGTTTCTCCTGGGTGGGG + Intergenic
1108930728 13:55815052-55815074 TATGCAGTCTCTTCTGTGTGAGG + Intergenic
1112190291 13:97170617-97170639 CACTCAGTTGCTTCTGGGTGGGG + Intergenic
1112460703 13:99601406-99601428 GCTGCAATTCCTTCTGCGTGAGG - Intergenic
1112720883 13:102243339-102243361 AATGGAGTTCCTTCTGGGAAAGG - Intronic
1113803354 13:113097742-113097764 GATGCAGTTTCTGCAGGGTGTGG + Intronic
1116184386 14:41578021-41578043 CTTGCAGTTCCTCATGGCTGGGG - Intergenic
1117303502 14:54451089-54451111 CTTGGATTTCTTTCTGGGTGTGG - Intergenic
1118239766 14:64044829-64044851 CTTACAGTTCCATGTGGGTGGGG - Intronic
1119424497 14:74526980-74527002 CTTCCAGTTCATTCTGGGTCTGG - Intronic
1119775479 14:77245565-77245587 CTTGCAGTTCCATGTGGCTGGGG + Intronic
1120689892 14:87580791-87580813 AATCCAGTTCCCTCTGGCTGTGG - Intergenic
1121638710 14:95471256-95471278 CTGGCTGCTCCTTCTGGGTGTGG - Intronic
1121870064 14:97399160-97399182 AATTCAGTTCCTTGTGGTTGTGG - Intergenic
1124691231 15:31825274-31825296 CTTGCAGTTCCATGTGGCTGGGG + Intronic
1125804903 15:42485511-42485533 CAGGCACTTACTTCGGGGTGTGG - Intronic
1126474367 15:49050814-49050836 CTTGCAGTTCCACCTGGCTGTGG + Intergenic
1128764359 15:70242060-70242082 CATCCACTTCCTCCTTGGTGGGG - Intergenic
1129160461 15:73744798-73744820 CCTGCAGTCCCTTCTGGCTTGGG - Intronic
1129383855 15:75184854-75184876 CATGCCTTTCTTACTGGGTGTGG - Intergenic
1129682520 15:77665798-77665820 CAGGCAGTTCCCTCTGCCTGTGG + Intronic
1131278704 15:91003742-91003764 CATGCATTTCTTTCTGGCTAAGG + Intronic
1131661324 15:94521051-94521073 CATGCAGCTCCTTCTGCACGGGG - Intergenic
1132930672 16:2457521-2457543 CACCCACTTCCTTCTGGGTGGGG + Exonic
1133280423 16:4661966-4661988 TATGGAGTCCCTGCTGGGTGGGG + Intronic
1133598406 16:7315143-7315165 CATGCATTTCATTTTGTGTGTGG + Intronic
1133898588 16:9952136-9952158 CATGACTTTCTTTCTGGGTGAGG - Intronic
1134773082 16:16827826-16827848 GATGGAGTTGCTGCTGGGTGTGG - Intergenic
1135185887 16:20315531-20315553 AATTCAGTTCCTTATGGGTGAGG - Intronic
1135945522 16:26861503-26861525 AATGGAGTTCCTTGAGGGTGAGG + Intergenic
1136041539 16:27583394-27583416 CATACAGTGACTTCTGGGGGTGG - Intronic
1136366023 16:29809670-29809692 CATGCAGACCCATCTGGGGGGGG + Exonic
1137389190 16:48067370-48067392 CTTACAGTTCCATCTGGCTGGGG - Intergenic
1137469400 16:48741065-48741087 CATGCATTTGGTTCTGGGGGTGG + Intergenic
1139630119 16:68226123-68226145 CATTCAGTTCATTTTGGGTTGGG - Intronic
1140331217 16:74058746-74058768 CTTGCAGTTCCATGTGGCTGGGG - Intergenic
1140805957 16:78532630-78532652 CTTACAGTTCCTTGTGGCTGGGG + Intronic
1141648352 16:85379213-85379235 CATGCAGTGCCATCTGGCAGAGG + Intergenic
1143408038 17:6690981-6691003 CTTGCAGTTCCTTCAGGGCCAGG + Intronic
1144347433 17:14362141-14362163 CAATCATTTCCTTCTGGGTGAGG + Intergenic
1147537114 17:41328187-41328209 CATGCAGATCTTTCCGGGTCAGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150604151 17:66676587-66676609 TTTGCACTTGCTTCTGGGTGGGG + Intronic
1151474348 17:74337307-74337329 CATGCAGTCCCTACTAGGGGAGG - Intronic
1151921095 17:77156131-77156153 CATGCAGTTGCTCCTGGTGGAGG + Intronic
1153538907 18:6134046-6134068 CATGCAGTTCCACATGGCTGGGG + Intronic
1157233666 18:45942684-45942706 TATGGAGTTTCTTTTGGGTGGGG + Intronic
1157434438 18:47656554-47656576 CATGCTGCTCCTTCTGTCTGGGG - Intergenic
1157742270 18:50103858-50103880 CATGCAGTTCCAAATGGGTAGGG + Intronic
1160106828 18:75986233-75986255 AATGCATTTCCTTGTGGGTGTGG - Intergenic
1160106833 18:75986297-75986319 AATGCATTTCCTTGTGGGTGTGG - Intergenic
1160412668 18:78685649-78685671 CAAGCCCTTCCTTCTGGGTGTGG - Intergenic
1160974644 19:1786884-1786906 CATCCAGCTCCTCCTGTGTGTGG - Intronic
1161392346 19:4028134-4028156 GCTGCAGTTCCCTGTGGGTGTGG - Exonic
1161694012 19:5755213-5755235 CAAACACTTCCTGCTGGGTGGGG - Intronic
1162697141 19:12485027-12485049 CCTGCAGCTCCTTCTGAGCGCGG + Intronic
1165210049 19:34227551-34227573 AATGCAGTTACTTTTGGGGGTGG + Exonic
1165257246 19:34585728-34585750 CATGGAGTCACTTCTGGATGGGG + Intergenic
1165265008 19:34654682-34654704 CATGCAGTTCCTTCTGGGTGGGG - Intronic
1166104263 19:40589724-40589746 CATACAGTTCCCTCAGGCTGGGG - Intronic
1166229707 19:41419280-41419302 CACGCAGATCCCTCAGGGTGAGG + Exonic
925331461 2:3062070-3062092 CCTCCATTTCCTTCTCGGTGAGG + Intergenic
926607937 2:14915972-14915994 CTTGCAGTTCCATGTGGCTGGGG - Intergenic
926749753 2:16189336-16189358 CATGCTGCTCCTTCTGCCTGGGG - Intergenic
926804679 2:16696264-16696286 CTTGCAGTTCCATATGGCTGGGG - Intergenic
927012874 2:18924189-18924211 CATGGACTTCCTTCTGTGTTTGG - Intergenic
929615225 2:43301476-43301498 CATGGAGCTCCAACTGGGTGGGG + Intronic
929716598 2:44317170-44317192 CATTTAGTTCCTGCTGGGTATGG + Intronic
932905070 2:75740194-75740216 CTTGCAGTTCCATGTGGCTGGGG + Intergenic
935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG + Intergenic
937555712 2:123152694-123152716 AATGCAGTTCTTTCTCGGTTGGG - Intergenic
937911862 2:127079671-127079693 CAAGCTGTTCCTTCAGGGTGAGG - Intronic
938314362 2:130315804-130315826 CATGCAGCTACTGCTGGCTGCGG + Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
941395258 2:164965974-164965996 CACTGAGTTGCTTCTGGGTGGGG + Intergenic
941950238 2:171148178-171148200 TATGCAGCTGCTGCTGGGTGTGG - Intronic
943247434 2:185473462-185473484 CATGCAGTTCCTCCTGCCCGTGG + Intergenic
943346965 2:186749898-186749920 CATGCACTTACATTTGGGTGGGG + Intronic
944010271 2:194966060-194966082 CTTGCAGTTCCCTGTGGCTGAGG + Intergenic
945495033 2:210499360-210499382 CATCCAGTTTCTCCTGGATGAGG - Intronic
945498881 2:210543454-210543476 TATGATGTTCCTTCTGGCTGGGG + Intronic
946299773 2:218815457-218815479 ACTGCAGTTCCTGCTTGGTGTGG - Intergenic
946844612 2:223848330-223848352 CATTCAGTTCCTTTAGGTTGTGG + Intergenic
947054547 2:226085558-226085580 CTTACAGTTCCTTGTGGTTGGGG + Intergenic
948724178 2:239921762-239921784 GCTCCAGTTCCCTCTGGGTGAGG + Intronic
948887472 2:240891441-240891463 CCTGCAGATCCTCCTGGCTGGGG + Intronic
1169189415 20:3648336-3648358 CAAGCAGTGCCCTCTGGGAGAGG - Exonic
1171129283 20:22634134-22634156 CATGCTGTTCCCTCTGCCTGGGG - Intergenic
1172224976 20:33299447-33299469 CATGCAGGTGGTTCTGGGTCTGG - Intronic
1173147197 20:40535057-40535079 CAGGGAGTGCATTCTGGGTGAGG - Intergenic
1174865181 20:54128812-54128834 CTTGCAATTCCTTCTCTGTGGGG - Intergenic
1174883409 20:54305304-54305326 CAGGCAGGTCCTTCTGGGGTTGG + Intergenic
1175002564 20:55645070-55645092 CATTCAGTTCCTTGTGCTTGTGG + Intergenic
1175391785 20:58632145-58632167 CATGGAGCTCCTTCTCAGTGGGG - Intergenic
1175548861 20:59802625-59802647 AAGGCAGTTCCTGCTTGGTGAGG + Intronic
1175668881 20:60884156-60884178 CATGCAGTGCCTTCTTGGTGCGG - Intergenic
1175815251 20:61880246-61880268 CAGGCAGATGCCTCTGGGTGGGG - Intronic
1175996181 20:62813245-62813267 CCTGCAGGTCCTGCTGGGCGGGG - Exonic
1176297845 21:5083700-5083722 AATCCAGGTCCTTGTGGGTGTGG - Intergenic
1178379044 21:32093092-32093114 CTTACAGTTCCATGTGGGTGGGG + Intergenic
1179859184 21:44178249-44178271 AATCCAGGTCCTTGTGGGTGTGG + Intergenic
1180752830 22:18136891-18136913 TGTGCAGTTACTTCTGAGTGAGG + Intronic
1181005017 22:20009196-20009218 CATGCAGGGTCTTCTGGGTTGGG - Intronic
1181168045 22:20993733-20993755 CGTGGAGTTCGTGCTGGGTGAGG + Exonic
1182182233 22:28362375-28362397 CTTGCAGTTCCATGTGGCTGGGG - Intronic
1183601965 22:38844864-38844886 CCTGCTGTTCCTTCTGGGCCTGG - Intergenic
949563638 3:5225742-5225764 CATTGCTTTCCTTCTGGGTGTGG + Intergenic
949847084 3:8382705-8382727 TATTCTGCTCCTTCTGGGTGGGG + Intergenic
950205324 3:11075806-11075828 CATGCTCTTCCTTCTGCCTGTGG + Intergenic
950500758 3:13362053-13362075 CATGAAGCTCCTTCAGGGTGAGG - Intronic
951003210 3:17589588-17589610 CTTGCAGTTCCATGTGGCTGGGG - Intronic
951169903 3:19529039-19529061 CATGCTATTCCTTCTGACTGCGG - Intronic
952611606 3:35216550-35216572 CATCCACTTCCTTCTTGTTGAGG + Intergenic
953073801 3:39549628-39549650 CATGAAGTTCCTGCTGGTTATGG - Intergenic
953173205 3:40525799-40525821 CATGCACTGTCTTCTGGGTTTGG - Exonic
953518280 3:43618204-43618226 CATGGAGTTCCCTCAGGGAGTGG - Intronic
954297212 3:49680973-49680995 CATGCTGTACCTTCTGGAGGTGG + Intronic
954366871 3:50151059-50151081 GATCCAGTTCCTAGTGGGTGGGG + Intergenic
958774277 3:98462519-98462541 CATGCAGCTGCTTCTGGATTTGG + Intergenic
959405675 3:105959528-105959550 TATGCAGTTCCGGCTGGGCGCGG + Intergenic
959794086 3:110401697-110401719 AATGTAGTTCCTACTGGGTATGG - Intergenic
961698069 3:128720157-128720179 CAGGCTGTTCCTTCTGTGTCTGG - Intergenic
963220535 3:142805592-142805614 AATGGAGTTCCTTTTGGGAGGGG + Intronic
964477092 3:157107005-157107027 CATGCAGTTCCTATGGGCTGTGG + Intergenic
964700694 3:159562727-159562749 CATGTGGTTGCTTCTGGGAGAGG - Intronic
966123246 3:176547042-176547064 CTTGCAGTTCCATATGGCTGGGG + Intergenic
966912494 3:184567190-184567212 CATGAAGATGATTCTGGGTGTGG - Intronic
969720009 4:8888365-8888387 CATTCAGTTCCTCCTGGGCTGGG - Intergenic
970273602 4:14372867-14372889 CTTGCAGTTCCATGTGGCTGAGG - Intergenic
971974488 4:33666232-33666254 GATGCAGTTTCTTCATGGTGTGG + Intergenic
972913515 4:43847893-43847915 CATACAGTTCCATGTGGCTGGGG + Intergenic
976141295 4:81995140-81995162 CAATCAGTTCTTTTTGGGTGGGG - Intronic
977256355 4:94744999-94745021 CATGGATTTATTTCTGGGTGAGG - Intergenic
978746578 4:112201766-112201788 CTAGAAGTTCCTCCTGGGTGTGG + Intergenic
979426531 4:120573516-120573538 CTTACAGTTCCATGTGGGTGGGG + Intergenic
979594512 4:122519458-122519480 CTTACAGTTCCTTGTGGCTGGGG - Intergenic
980299289 4:130966301-130966323 CATACAGTTCCATGTGGCTGGGG - Intergenic
985639319 5:1056223-1056245 CATCCACGTCCTTCTGGGTCAGG - Intronic
985680220 5:1252223-1252245 CTTCCAGTTCCTTCTGCCTGAGG + Intergenic
986081220 5:4396045-4396067 CTTACAGTTCCTTGTGGCTGCGG + Intergenic
986515349 5:8556342-8556364 CTTGCAGTTCCATGTGGATGGGG - Intergenic
986633120 5:9793837-9793859 CAAGCTGATCATTCTGGGTGTGG + Intergenic
986751856 5:10794677-10794699 CATGAAGTTACTTCTGGGAGGGG + Intergenic
987170840 5:15255790-15255812 AATGCAGTTCCTTTATGGTGTGG + Intergenic
988539887 5:32099330-32099352 TAGGCAGTGCCTTCTGGGAGGGG + Intronic
989307740 5:39977126-39977148 GATTCAGTTCATTTTGGGTGAGG - Intergenic
990197008 5:53329162-53329184 CATGTACTTCCTTTTGGTTGTGG + Intergenic
990626031 5:57612497-57612519 CCTGCATTCCCCTCTGGGTGTGG + Intergenic
992003923 5:72460155-72460177 CCCGCAGTACCTTGTGGGTGAGG + Exonic
994264505 5:97699457-97699479 CATTCAGTTGCTGCTGGGGGAGG - Intergenic
997995317 5:138581134-138581156 CAAGAAGTTCCTACTGGGAGTGG + Intergenic
998492860 5:142562397-142562419 AATTCAGTTCCTTGTGGCTGCGG + Intergenic
999303033 5:150502780-150502802 CAGGGAGTTCCTTCTGGGGTAGG + Intronic
1000768445 5:165320034-165320056 CTTGCAGTTCCATATGGCTGGGG + Intergenic
1001288010 5:170437771-170437793 CTTGCAGTTCCATCTGAGAGAGG - Intronic
1001500741 5:172231530-172231552 CATGCATATCCTACTGGATGTGG - Intronic
1002307375 5:178291723-178291745 CATGCAGGTGCTGGTGGGTGAGG + Intronic
1002937530 6:1686339-1686361 CATGCACTTGCTTCTGGGTGTGG - Intronic
1006044221 6:31280799-31280821 GAAGCAGTTGCATCTGGGTGTGG - Intronic
1006625180 6:35392627-35392649 CAAGCAGGTCATTGTGGGTGGGG + Intronic
1007713575 6:43839708-43839730 CAGGCACATCCTTCTGGGTTGGG + Intergenic
1008545731 6:52581624-52581646 AATACAGTTCCATCTGGATGTGG + Intergenic
1010799336 6:80156394-80156416 AATGCAGGTTCTTTTGGGTGTGG - Intronic
1011811106 6:91133286-91133308 CATGCAGTTCTTAGTGGCTGAGG + Intergenic
1013403462 6:109820865-109820887 CATGCAGGTCTTTATGGCTGTGG - Intronic
1013596362 6:111664284-111664306 CTGACAGATCCTTCTGGGTGCGG + Intronic
1014958551 6:127653008-127653030 CATACAGTTCCATATGGCTGGGG - Intergenic
1016075787 6:139794361-139794383 CTTGCAGTTCCATATGGCTGGGG + Intergenic
1016469669 6:144361895-144361917 CAGGCAGTTCTGGCTGGGTGAGG - Intronic
1016648471 6:146436956-146436978 AATGCAGTTCATTCTTGGTGTGG - Exonic
1017257448 6:152349924-152349946 CTTACAGTTCCTTGTGGCTGGGG - Intronic
1018632533 6:165833598-165833620 CAAGCAGTTCCTTCAGCATGAGG + Intronic
1018962929 6:168461097-168461119 CTTACAGTTCCATGTGGGTGGGG + Intronic
1019916064 7:4133496-4133518 CACACAGCTCCTTCTGGGTGGGG + Intronic
1020398064 7:7740355-7740377 CTTGCAATTCCATTTGGGTGGGG - Intronic
1020637849 7:10717995-10718017 CATGTAGTCCCTACTGCGTGTGG - Intergenic
1020761256 7:12269988-12270010 CATGCACTTCATTCTCGCTGAGG + Intergenic
1021529945 7:21632962-21632984 CATACAGTTCCATGTGGCTGGGG + Intronic
1022837351 7:34130851-34130873 CATGCTGTTCCTTCTAGCTGGGG - Intronic
1026212287 7:68316306-68316328 CATTCCCTGCCTTCTGGGTGGGG + Intergenic
1027735789 7:81931511-81931533 CGTGCAGTTCCTTCTAGTTTTGG + Intergenic
1032205104 7:129856717-129856739 CATGCAGTTCAAACTGTGTGTGG - Intronic
1032738358 7:134713398-134713420 CATGCAGTTCCCTCTGACTGTGG + Intergenic
1033567262 7:142591260-142591282 CTTGCAATTTGTTCTGGGTGTGG - Intergenic
1034391963 7:150793967-150793989 CAGGCTGTGCCTTCTGGGCGGGG - Exonic
1034875474 7:154721064-154721086 CATCAGGTTCCTTCTGAGTGAGG + Intronic
1038398750 8:27267132-27267154 CACTGAGTTGCTTCTGGGTGGGG - Intergenic
1042613107 8:70619307-70619329 CATGCTTTTCCTTGTGGGTAGGG + Intronic
1042703226 8:71639629-71639651 CATTCAGTTCCTAATGTGTGTGG - Intergenic
1043263673 8:78234431-78234453 CTTGCAGTTTCTTTTGGTTGTGG + Intergenic
1043858254 8:85286382-85286404 CTTTCAGTACCTTCTGAGTGGGG + Intergenic
1043870646 8:85427881-85427903 CACTGAGTTGCTTCTGGGTGGGG + Intronic
1045663090 8:104458265-104458287 CATGCAGGACCTTATGGGTTGGG - Intronic
1046395263 8:113632707-113632729 CATGCACTTCCTCCTCTGTGAGG - Intergenic
1047976148 8:130132664-130132686 GATGCAGTTCCTTCAGGGCAGGG + Intronic
1048171068 8:132106861-132106883 CAGGCAATTCCTGCTGAGTGAGG + Intronic
1050589992 9:7150683-7150705 CCTGCAGGCCCTTTTGGGTGTGG + Intergenic
1052614666 9:30822195-30822217 CTTGCAGTTCCACATGGGTGGGG - Intergenic
1058763719 9:108161473-108161495 CATCCAGCTCCTCTTGGGTGAGG + Intergenic
1059298930 9:113297611-113297633 CAAGCAGTTCCTTTGGGGTGTGG - Exonic
1059336030 9:113568975-113568997 CATGCTCTTCCTTCTGGCAGTGG + Intronic
1060070715 9:120544634-120544656 AATAGAGTTCCTGCTGGGTGTGG - Intronic
1060118431 9:120965231-120965253 AATGCAGTCCCAGCTGGGTGCGG + Intronic
1060733740 9:126053351-126053373 CATGCTGTTCCCTCTGCCTGGGG + Intergenic
1186497179 X:10020890-10020912 CTTGCCCATCCTTCTGGGTGAGG + Intronic
1188488856 X:30714429-30714451 AATTCAGTTCCTTGTGGTTGTGG + Intronic
1188875629 X:35426791-35426813 GATGAAGTTTCTTCTGGATGTGG - Intergenic
1189317585 X:40066875-40066897 AGGGCAGTTCGTTCTGGGTGGGG - Intronic
1189410041 X:40761872-40761894 CATGCAGGTAGTTATGGGTGGGG + Intergenic
1190594673 X:52041145-52041167 CATGTGGTTCCTTCTGGTGGAGG + Intergenic
1190614151 X:52212928-52212950 CATGTGGTTCCTTCTGGTGGAGG - Intergenic
1191739704 X:64423682-64423704 CACAGAGTTGCTTCTGGGTGGGG + Intergenic
1192368714 X:70496283-70496305 CAGCCAGTCCTTTCTGGGTGGGG + Intronic
1193935581 X:87615848-87615870 TATGGAGTTCCTTTTGGGAGTGG + Intronic
1195616156 X:106913760-106913782 AATCCAGGTCCTTCAGGGTGTGG + Intronic
1195910830 X:109887086-109887108 CATTCAGGTGGTTCTGGGTGAGG + Intergenic
1198728297 X:139700397-139700419 CGTGCTGTTCCTCCTGGGGGAGG - Intronic
1198991142 X:142515914-142515936 CATGCAGTTCCACATGGCTGGGG + Intergenic
1199162242 X:144627536-144627558 CATGCTGTGGCTGCTGGGTGTGG - Intergenic
1199606167 X:149581359-149581381 ACTGCAGTTCCTTCTGGGGGAGG - Intergenic
1199632954 X:149788009-149788031 ACTGCAGTTCCTTCTGGGGGAGG + Intergenic
1201192207 Y:11454195-11454217 AATTCAGTTCCTTGTGGTTGTGG - Intergenic
1201513226 Y:14788400-14788422 CATTCAGTTCCATCAGGTTGCGG + Intronic
1202199993 Y:22336167-22336189 CATGGAGTTCCTTGGGGCTGTGG + Intronic