ID: 1165266038

View in Genome Browser
Species Human (GRCh38)
Location 19:34664431-34664453
Sequence CTGGTGTCCCTGGGCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 2, 2: 5, 3: 66, 4: 549}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165266038_1165266049 7 Left 1165266038 19:34664431-34664453 CCAGCCCTGCCCAGGGACACCAG 0: 1
1: 2
2: 5
3: 66
4: 549
Right 1165266049 19:34664461-34664483 GGGTGTCACAAGCAAGTAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 105
1165266038_1165266050 14 Left 1165266038 19:34664431-34664453 CCAGCCCTGCCCAGGGACACCAG 0: 1
1: 2
2: 5
3: 66
4: 549
Right 1165266050 19:34664468-34664490 ACAAGCAAGTAGGTGGCTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 105
1165266038_1165266051 19 Left 1165266038 19:34664431-34664453 CCAGCCCTGCCCAGGGACACCAG 0: 1
1: 2
2: 5
3: 66
4: 549
Right 1165266051 19:34664473-34664495 CAAGTAGGTGGCTCAAGGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 264
1165266038_1165266048 4 Left 1165266038 19:34664431-34664453 CCAGCCCTGCCCAGGGACACCAG 0: 1
1: 2
2: 5
3: 66
4: 549
Right 1165266048 19:34664458-34664480 TGAGGGTGTCACAAGCAAGTAGG 0: 1
1: 0
2: 2
3: 16
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165266038 Original CRISPR CTGGTGTCCCTGGGCAGGGC TGG (reversed) Intronic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900184928 1:1328530-1328552 CTGGGGGCCTTGGGCTGGGCTGG - Exonic
900186276 1:1334691-1334713 CTGGGTTACCTGGGCAGGCCTGG - Exonic
900300546 1:1974651-1974673 CATGTGGCCCCGGGCAGGGCTGG - Intronic
900309778 1:2028099-2028121 CAGGGCTCCCGGGGCAGGGCCGG + Intronic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900409220 1:2505241-2505263 CTGGAGGCCCAGGGCAGGGGTGG + Exonic
900529947 1:3148255-3148277 CTGGTGGCCCTGGTGAGAGCAGG + Intronic
900607652 1:3531049-3531071 CGGGCGAGCCTGGGCAGGGCGGG - Intronic
900860578 1:5226434-5226456 CAGGTGTCCCTGGGAAGCACTGG + Intergenic
900900333 1:5511531-5511553 CTGGTGTCGCAGTGCAAGGCTGG + Intergenic
900910971 1:5596814-5596836 CACGAGTGCCTGGGCAGGGCTGG + Intergenic
900977268 1:6025571-6025593 CAGGTGGCCCTGGGGAGGACGGG - Intronic
901002620 1:6156079-6156101 CTGGTGTCCCGAGGCTGGTCGGG - Intronic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
901436500 1:9250179-9250201 CTGCTGTCCCGGGTGAGGGCGGG + Intronic
901737531 1:11321968-11321990 CTGGGTGCTCTGGGCAGGGCAGG - Intergenic
902159829 1:14520905-14520927 CTCCATTCCCTGGGCAGGGCAGG + Intergenic
902330227 1:15727660-15727682 CAGCTGTCCCTGGTCAGGGAGGG + Exonic
902529848 1:17083920-17083942 CTGGTATCTCTGGGCTGTGCCGG + Intronic
902923979 1:19683488-19683510 CGGAGGTCCCTGGGGAGGGCTGG - Intronic
902988723 1:20171372-20171394 CTGGTGGCAGTGGGCAGGGCAGG + Intronic
903003439 1:20282650-20282672 CTGGGGCCCCTGGCCAGGCCAGG + Intergenic
903182426 1:21611656-21611678 CTTGTGCTCCTGGGCAGGGAGGG - Intronic
903302641 1:22390286-22390308 CTGGTGTACCTGGGCACAGGTGG - Intergenic
903579242 1:24358482-24358504 CTGGGGACGCTGGGCAGGGTGGG + Exonic
903860539 1:26361807-26361829 CTGGTGCCATTGGGCAAGGCAGG + Exonic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
904454737 1:30640767-30640789 TTGGTGTCTCTGAGCAGGGCAGG + Intergenic
905658326 1:39700829-39700851 CTGGTGGCTGTGGGCAGGGAGGG - Intronic
905662089 1:39735478-39735500 CTGCTGTCCATGTGCAGGCCAGG + Intronic
905793469 1:40802486-40802508 CTTGCGTCCCTGGGAGGGGCGGG - Intronic
907387289 1:54134297-54134319 CTGCTGTCCCTGGGGTGGCCAGG - Intronic
907486508 1:54781685-54781707 CTGGTGTTCCTGGCCAAGGCGGG - Exonic
907788316 1:57635803-57635825 CTGGTGTCCTTGGCCAGGTGCGG + Intronic
907865541 1:58396236-58396258 CTGGAGCCCCTGGGAATGGCTGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
909782293 1:79561778-79561800 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
910876072 1:91879407-91879429 TTGGTGTCGGGGGGCAGGGCAGG - Intronic
911475423 1:98367245-98367267 TAGATGTCCCTTGGCAGGGCAGG - Intergenic
912500599 1:110119595-110119617 CTGGACTGCCTGGGCTGGGCTGG - Intergenic
913222160 1:116667912-116667934 CCGGAGGACCTGGGCAGGGCTGG + Intergenic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
915405410 1:155656410-155656432 ATGATGTTCCTGGGCAGGGGTGG + Intergenic
916578145 1:166085303-166085325 CTGGGGACCCTGGGCAGCTCAGG + Intronic
917011727 1:170481793-170481815 CTGCTGTACCTGGACAGAGCAGG - Intergenic
919781482 1:201224155-201224177 GTGGTGACCCTGAGCAGGGTGGG - Intronic
921309338 1:213827306-213827328 ATGGGGTCTCTGGGCAGAGCTGG + Intergenic
922674944 1:227544183-227544205 CTGGGGTCCCTGTGCAGGGTGGG + Intergenic
922701835 1:227765806-227765828 CCTGTGGCCCTGGGCAAGGCTGG + Intronic
923013379 1:230106750-230106772 CTGGTGAGCTTGGGCAGTGCTGG + Intronic
923455589 1:234162512-234162534 CTGGTGTGACAGGGCAGGACTGG + Intronic
1063455952 10:6182812-6182834 CCAGTGTCCATGGCCAGGGCAGG + Intronic
1063676037 10:8141267-8141289 GTGGGGTCCCGGGGCAGGGCGGG + Intergenic
1064030278 10:11879174-11879196 TGGTTGTCCCTGGTCAGGGCTGG - Intergenic
1064030285 10:11879198-11879220 TTGTTGTCCCTGGTCAGGGCTGG - Intergenic
1064030362 10:11879490-11879512 TGGTTGTCCCTGGTCAGGGCTGG - Intergenic
1064030578 10:11880348-11880370 CCAGTGTCCCTGGACTGGGCCGG - Intergenic
1064110984 10:12538777-12538799 GTGGGGTCCCAGGGCAGGTCAGG + Intronic
1064278376 10:13928694-13928716 GGGGTGTCCCTGGGCAGGAGAGG + Intronic
1066043807 10:31579259-31579281 ATGGTGATTCTGGGCAGGGCTGG - Intergenic
1066322176 10:34314501-34314523 CTAGTGCCCCTGGGCATGGCTGG - Intronic
1067048429 10:42998913-42998935 CTGTTGTCCATGGCCAGGACTGG - Intergenic
1067797593 10:49332040-49332062 CAGGTGGCTCTGCGCAGGGCTGG - Intergenic
1067877337 10:50018238-50018260 CTGGGGTCCATGGGCTGGGCTGG + Intergenic
1068222729 10:54064352-54064374 CGGGTGGCCATGGGCAGGCCCGG + Intronic
1069631497 10:69899807-69899829 CTAGCGTCCCTGTGCTGGGCGGG - Intronic
1069878737 10:71578780-71578802 CTGGTGTATCTGGGCAGGCCAGG + Intronic
1069912858 10:71770545-71770567 CTGGTCTCCCAGGGGAGGGTGGG - Intronic
1069913382 10:71773064-71773086 CTGGGTTCTCTGGGCAGGGAAGG + Intronic
1070768996 10:79071328-79071350 CTGGTTACACAGGGCAGGGCAGG + Intronic
1071520904 10:86331005-86331027 ATGGTGTTCCTGGGGAGGCCTGG - Intronic
1072631535 10:97150183-97150205 CTGGTGTCTCGGGGCATGGCTGG + Intronic
1073107248 10:101039227-101039249 GTGCTGTCCCTGGGCTGGGTGGG + Intronic
1073125327 10:101145754-101145776 CAGGTGTCCCTTGGCAGCTCAGG - Intergenic
1073424786 10:103449841-103449863 CTGGTGGCACTGGGCACGGTGGG - Exonic
1073562612 10:104509767-104509789 GTGGGGTCCCTGGGCCTGGCTGG + Intergenic
1073593018 10:104774256-104774278 CTGCTGTCCCAGGGAAGGGCTGG - Intronic
1074126133 10:110530277-110530299 TTGGATTTCCTGGGCAGGGCCGG + Intergenic
1074365692 10:112855753-112855775 GAGGTCTCCCTGTGCAGGGCAGG + Intergenic
1075090433 10:119441313-119441335 CTGGTGTCCATAGGCAGGGAAGG + Intronic
1075422065 10:122309020-122309042 ATGATGTCCCTGGGAGGGGCAGG - Intronic
1075587461 10:123667991-123668013 CTGTTGTCCCAGGGGAAGGCAGG + Intronic
1075871125 10:125773495-125773517 CTGGGGTCTCAGGACAGGGCAGG - Intronic
1076474939 10:130745333-130745355 CTGATGTACCTGGGCTGGGCTGG + Intergenic
1076680760 10:132170087-132170109 CGGGCGTCCTTGGACAGGGCTGG - Exonic
1076785080 10:132745655-132745677 GTGGTGGCCCTGGGCATGGTGGG + Intronic
1076804903 10:132850479-132850501 CTGGGTCCCCTGGGCAGGGTGGG - Intronic
1076823171 10:132952079-132952101 CAGGTGCCCCAGGGCAGGGTAGG - Intergenic
1076850596 10:133090656-133090678 CTGGAGGCCGTGGCCAGGGCAGG + Intronic
1076904980 10:133357152-133357174 CAGGTCCCCCAGGGCAGGGCGGG - Intronic
1077282627 11:1752583-1752605 CTGGAGCCCATGGGCTGGGCAGG + Intronic
1077289729 11:1783522-1783544 CTGGGGGCCCTGGGCTGGGAGGG - Intergenic
1077420551 11:2447954-2447976 CTGGCCTCCCTGGGCTGGCCGGG + Intronic
1077478919 11:2803818-2803840 CTGGGGTCCATGGGCATAGCAGG - Intronic
1077674117 11:4182255-4182277 CTTGTGGCTCTGGGCAGTGCAGG - Intergenic
1078105974 11:8358198-8358220 CTGGTGTCCCAGGAGAGGGCAGG - Intergenic
1081230145 11:40576228-40576250 CTGGTGTCCCTGGGGCTTGCTGG - Intronic
1081355898 11:42113321-42113343 GTGGTGTCTCTGGGCAGTGCAGG - Intergenic
1081812523 11:45922045-45922067 CTAGGCTGCCTGGGCAGGGCCGG - Intronic
1082767741 11:57182203-57182225 CGGGTGTCCATTGGCAGGTCTGG - Exonic
1083323882 11:61863614-61863636 CTGGAGACCCTGGGTAAGGCTGG + Intronic
1083329717 11:61891756-61891778 ACGGTGCCCCGGGGCAGGGCTGG - Intronic
1083713992 11:64565348-64565370 CTGGTGTCCCTCCCCAAGGCAGG + Intronic
1083804796 11:65067280-65067302 CTGGAGCGCCTAGGCAGGGCTGG - Intronic
1083896320 11:65621681-65621703 CTTGGATCCCAGGGCAGGGCCGG + Intronic
1084387959 11:68855714-68855736 CTGGGGACGCTGGGCCGGGCCGG - Intergenic
1084393857 11:68896329-68896351 CTGGGGTCCAAGGGCAGGGCAGG - Intronic
1084904357 11:72334611-72334633 CTGATGCCCCTGGAGAGGGCAGG - Intronic
1085392975 11:76191901-76191923 CTGGGGTCCCGGGTCAGGCCAGG - Intronic
1089158940 11:116423265-116423287 CTGGTCTAGCTGGGCAGGCCTGG - Intergenic
1089215514 11:116832391-116832413 CTGGTGGCTCTGAGCAGGGTAGG - Intronic
1089708344 11:120297279-120297301 CAGGTGTCCCAGGGCAGGGCAGG - Intronic
1090481394 11:127071812-127071834 CGGGAGCCCCTGGGGAGGGCAGG + Intergenic
1091288560 11:134423299-134423321 CTGGAGTCCCTGTGGAGGGCGGG + Intergenic
1091818525 12:3457172-3457194 TTGGTGTCCCTGAGCACTGCTGG + Intronic
1092169278 12:6363332-6363354 GTGGTGTCACTGGGCTGCGCGGG + Intronic
1092185929 12:6478418-6478440 CTGGGGTACGTGAGCAGGGCCGG - Intergenic
1092289574 12:7151074-7151096 CTGGTGGGGCTGGGCAGGGAGGG + Intronic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1094056254 12:26272448-26272470 TTGGTGTCCCTGGTGTGGGCGGG - Intronic
1094701891 12:32878146-32878168 CTGGGGTACGTGAGCAGGGCCGG + Exonic
1095954513 12:47798522-47798544 CTGGTGGGGCTGGGCTGGGCTGG + Intronic
1096493852 12:52027732-52027754 CTGGTGGCCCTGGGCACAGGGGG + Intronic
1097008483 12:55935897-55935919 CTGGGGTCCCTGGCCAGAGGCGG + Intronic
1097102376 12:56598775-56598797 CTGGTGTACCTGGACAGGGCAGG + Exonic
1097733235 12:63152157-63152179 CTGGAGCCCCTCTGCAGGGCGGG + Intergenic
1098180275 12:67840045-67840067 CTGGTGGTGGTGGGCAGGGCAGG + Intergenic
1098230905 12:68370881-68370903 CTGCTGTGCCTGGGCACTGCAGG - Intergenic
1100380498 12:94057372-94057394 CAGGTGCCCCTGGGATGGGCAGG + Intergenic
1102012221 12:109625776-109625798 CTGGTGTACTTGGCAAGGGCAGG - Intergenic
1102529113 12:113533083-113533105 CTGGTGACACTGAGCAGAGCAGG - Intergenic
1102591795 12:113961806-113961828 CTGCTGTCTCTGGGCAGGCAGGG - Intronic
1104071522 12:125350018-125350040 GTGGTGCCCCCGAGCAGGGCTGG - Exonic
1104568778 12:129907346-129907368 CTCTTCTCCCAGGGCAGGGCAGG - Intergenic
1104768931 12:131348280-131348302 CAGGAGGCCGTGGGCAGGGCTGG + Intergenic
1104775730 12:131389207-131389229 CTGGAGTCCCCGGGCTGGGCTGG + Intergenic
1104810822 12:131619368-131619390 CAGGAGGCCGTGGGCAGGGCTGG - Intergenic
1105015805 12:132786301-132786323 CTGGTGACCCTGGCCGGGGATGG + Intronic
1105613828 13:21994296-21994318 CTGGTGTCTTTGGTCAGGGATGG + Intergenic
1106425560 13:29625393-29625415 TTGCTGCCCCTTGGCAGGGCAGG - Intergenic
1107372853 13:39771428-39771450 CGGGTCTCCCTGGGGAGCGCTGG - Intronic
1107907247 13:45072556-45072578 CAGTTTTCCCGGGGCAGGGCTGG - Intergenic
1108228836 13:48317665-48317687 CTGGTGCTCCTGGGCGGTGCCGG + Intronic
1109687796 13:65843899-65843921 TGGGTGTCCTTGGGCAGGCCTGG - Intergenic
1110999950 13:82165625-82165647 CGGGTGGCCATGGGCAGGACAGG + Intergenic
1113418956 13:110155096-110155118 CTGCTGTCACCAGGCAGGGCAGG + Intronic
1113485652 13:110650648-110650670 GTGCTGCCCCTGGGCAGGACAGG + Intronic
1113654236 13:112058053-112058075 CGGGAGTCAATGGGCAGGGCGGG + Intergenic
1113709431 13:112454003-112454025 CTGGGGGCTCTGGGCAGGGCAGG + Intergenic
1113792635 13:113037364-113037386 ATGGTGCCGCTGGGCAGGGGTGG - Intronic
1114614451 14:24060850-24060872 CTGGGGTCCCTGGGCTAGGAAGG - Intronic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1115258364 14:31426884-31426906 CTGCTGTCCCTGGCCACTGCAGG - Intronic
1118983541 14:70734400-70734422 CTGGTGAACCCTGGCAGGGCCGG + Exonic
1119153280 14:72385634-72385656 CTTGTGTCCCTGGGCAGGGCAGG - Intronic
1119647330 14:76357133-76357155 CTGGTGGCACTGGGCAGGAGTGG - Intronic
1119666992 14:76491784-76491806 CTGGGGCCTGTGGGCAGGGCTGG + Intronic
1119756972 14:77126163-77126185 GTGGTGACCCTGGGCAGGGCAGG - Intronic
1120450786 14:84664844-84664866 CTGGTGTTCCTGAGCAGGTAGGG - Intergenic
1120765726 14:88325137-88325159 CTGGTGTCTCGGGGCATGGCTGG - Intronic
1121049630 14:90812026-90812048 CTTGTGACCCTGGGCAAGGTAGG - Intronic
1121227382 14:92331052-92331074 CTGGTTTCACAGGTCAGGGCTGG - Intronic
1121495666 14:94390050-94390072 CTGGTGTCACTGGGGTGGGGTGG + Intronic
1121538320 14:94706510-94706532 CTGGTGACCCTTGGCAGGCACGG + Intergenic
1121610339 14:95274387-95274409 CTGCTGTGCATGGGCAGGGGTGG - Intronic
1122055443 14:99095075-99095097 CTGGGCCGCCTGGGCAGGGCCGG - Intergenic
1122779628 14:104138283-104138305 CTGGTGTCCCGGGAGAGGGGCGG + Intergenic
1122983183 14:105200669-105200691 GGGGTGTCCCTGGGTGGGGCCGG - Intergenic
1123111123 14:105867243-105867265 CTGGCTGCCCTGAGCAGGGCTGG + Intergenic
1123762987 15:23446894-23446916 CTGGGGTCACTGGCAAGGGCCGG + Intronic
1124244277 15:28056505-28056527 CAGATGTCCCTGAGCAGGGAGGG - Intronic
1124371358 15:29106486-29106508 CTTGGATCCCAGGGCAGGGCGGG + Intronic
1126110288 15:45171189-45171211 CTGGTTGCCCAGGGCAGGGCTGG + Intronic
1126420814 15:48470209-48470231 CTGGTGACCACGAGCAGGGCAGG + Intronic
1127265135 15:57355047-57355069 GTGTTGGCCCTGGGCAGGGAGGG + Intergenic
1128067429 15:64774089-64774111 CCGGTGGCCCTCGGCTGGGCTGG - Intronic
1128732765 15:70032571-70032593 CTGTGGTCCTGGGGCAGGGCTGG - Intergenic
1129059357 15:72848503-72848525 CTGGGGTCTGTGGGCAGGGCTGG + Intergenic
1129756749 15:78103415-78103437 CTGGGGTCGCTGGACAGGGAGGG - Intronic
1130095532 15:80852983-80853005 CTGGTATCCCAGGGCTGGACAGG - Intronic
1130651417 15:85764131-85764153 CTGGTGACCCAGGGAAGGCCAGG + Intronic
1130966319 15:88700319-88700341 CTGGTAGCCATGGGCAGGGGAGG - Intergenic
1131846570 15:96495318-96495340 CTGGTCTTCCTGGGCTGGGGTGG - Intergenic
1132320148 15:100919497-100919519 CTGGGTTCCCCGGGCGGGGCCGG - Intronic
1132359646 15:101201717-101201739 CTGGTGGCCCTGGGCTGGTAGGG + Intronic
1132474435 16:126617-126639 CTGGTGTCCCTCAGAAAGGCTGG - Intronic
1132617968 16:851751-851773 GGGGTCTCCCTGAGCAGGGCTGG + Intergenic
1132647696 16:1006742-1006764 ATGGTTTCCGTGGACAGGGCAGG - Intergenic
1132675165 16:1118396-1118418 CTGGGGTCCCAGGGGAGGCCTGG + Intergenic
1132708603 16:1256783-1256805 TTGATGTCCCTGGGCAGCGGAGG - Exonic
1132743425 16:1427195-1427217 CTGGGGTCCGTGGGCACAGCAGG + Intergenic
1132833765 16:1942537-1942559 TTGGAGTCCCTGGGCAGGTGGGG + Intronic
1132866958 16:2097833-2097855 CTGGGGGTCCTGGGCTGGGCTGG - Intronic
1132915631 16:2341789-2341811 GGGGTGTCCCTGGGCCGGACCGG + Intergenic
1132983123 16:2749385-2749407 CTGGTCTCCCTCTGGAGGGCAGG + Intergenic
1133188194 16:4115460-4115482 CTGGTGACCCCGGCCGGGGCAGG - Exonic
1133224111 16:4332453-4332475 GTACTGGCCCTGGGCAGGGCAGG + Intronic
1133234893 16:4383156-4383178 GTGCAGTCCCTGGGCACGGCGGG + Exonic
1133303146 16:4795328-4795350 CTGCTGGCCCTGGGGAGGGCGGG + Intronic
1133349059 16:5089617-5089639 CTTGTGTCCCTGGCCACCGCTGG + Intronic
1134090755 16:11390515-11390537 CTGGCGTGTCTGGGCAGGGCTGG - Intronic
1134548091 16:15125656-15125678 CTGGGGGTCCTGGGCTGGGCTGG - Intronic
1134720262 16:16377069-16377091 CTGGGGGTCCTGGGCTGGGCTGG + Intergenic
1134947165 16:18334816-18334838 CTGGGGGTCCTGGGCTGGGCTGG - Exonic
1135591233 16:23706377-23706399 GTGGTGTTCCAGCGCAGGGCTGG + Exonic
1136067415 16:27768370-27768392 CTGACTTCCCTGGGCAGAGCTGG - Intronic
1136228266 16:28873042-28873064 CGAGTGTCCCCGGGAAGGGCAGG - Intronic
1136296282 16:29305176-29305198 CTGGTCTCACAGGGCAGGGATGG - Intergenic
1137254865 16:46766487-46766509 CAGGTGTCCCTTTGCAAGGCTGG - Intronic
1137985012 16:53099918-53099940 CTGGTGGCTGTGTGCAGGGCGGG + Intronic
1138093899 16:54197171-54197193 CTCCTGACCCTGGGCAGGACAGG + Intergenic
1139705636 16:68738426-68738448 CCGGTGTCCCTGGGCGGAGTAGG + Intronic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1141600970 16:85126216-85126238 CGGGACTCCCTGGGCATGGCAGG - Intergenic
1141629268 16:85277835-85277857 CTGGTGTCCTGGGGCCGGCCTGG - Intergenic
1141687860 16:85580540-85580562 GCGGTGTCCCTGGGCATCGCTGG - Intergenic
1141697696 16:85627950-85627972 TCGGTCTCCCTGGGGAGGGCTGG + Intronic
1141860376 16:86712325-86712347 CGGGGGTCCAGGGGCAGGGCAGG - Intergenic
1142010352 16:87710820-87710842 CTGCTGTGCCTGTGCTGGGCTGG + Intronic
1142057874 16:88011316-88011338 CTGGTCTCACAGGGCAGGGATGG - Intronic
1142148433 16:88502349-88502371 CCCGGGCCCCTGGGCAGGGCGGG - Intronic
1142206276 16:88784695-88784717 CTCCTGTCCCAGGGCCGGGCTGG - Intronic
1142281490 16:89150508-89150530 CTGGTGTCCCTGGGCAGGGGCGG - Intronic
1142712912 17:1733046-1733068 GTAGTGTCCCTGGGGAAGGCAGG + Intronic
1142717592 17:1755460-1755482 GAGGTGTCCCGGGGGAGGGCTGG - Intergenic
1143106718 17:4533910-4533932 CAGGGGTGCCTGGGGAGGGCGGG + Intronic
1143106831 17:4534341-4534363 CTTGTGTCCCTGGGTGGGGATGG + Intronic
1143164465 17:4891040-4891062 CTGGGGGCCCTGGGGAGGCCTGG - Exonic
1143517857 17:7429029-7429051 GTGGTGACTCTGGTCAGGGCAGG + Intergenic
1144044608 17:11443891-11443913 CTGATGTCTCTGGTCAGAGCTGG + Intronic
1144523077 17:15967203-15967225 CAGGTGTCCCTGCACTGGGCAGG - Intronic
1144829750 17:18124561-18124583 CTGGAGTGAGTGGGCAGGGCCGG + Exonic
1145023961 17:19453622-19453644 CTGGTGTCCCAAAGCAGGCCAGG + Intergenic
1145071700 17:19815342-19815364 CTGGGGTCCCTGGGAGGGGGAGG - Intronic
1145252877 17:21305918-21305940 CAGGCTTCCCTGGGCAGGGAAGG - Intronic
1145323698 17:21781998-21782020 CAGGCTTCCCTGGGCAGGGAAGG + Intergenic
1146257350 17:31399157-31399179 CTGGTGGCACTGCTCAGGGCTGG - Intronic
1146652398 17:34614748-34614770 CTGGTGTCCCTGGGCTGGAGGGG - Intronic
1147131914 17:38414846-38414868 CTGGTGGCCGCGGGCAGAGCTGG + Intergenic
1147323456 17:39659307-39659329 CTGGTCTCCCTGGGCCCTGCAGG - Intronic
1147717242 17:42516642-42516664 GTCATCTCCCTGGGCAGGGCGGG + Intronic
1147793255 17:43025854-43025876 CTTGTGTCCAGGGGCTGGGCTGG + Intronic
1147866882 17:43559157-43559179 CAAGTGTCTCTGGGCAAGGCAGG + Intronic
1147917698 17:43898514-43898536 CTGGGGTGCCTGTGCTGGGCAGG - Intronic
1147946369 17:44082550-44082572 CTGGTGGGGCTGGGCAGGGGCGG - Intronic
1147964432 17:44186664-44186686 CTGGCGCCGCTGGGCAGAGCCGG - Intergenic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1148677885 17:49455596-49455618 CTGGTAGCTCTGGGAAGGGCTGG + Intronic
1148872669 17:50668007-50668029 CAGGTAACCCTGGGTAGGGCTGG + Exonic
1149010657 17:51853375-51853397 CTGCTGTCCCTGTGCTGGTCAGG + Intronic
1149654761 17:58304466-58304488 CAGGTGGCCCTGCGCAGGGGTGG + Intronic
1150226921 17:63529359-63529381 GTGGGGTCCCAAGGCAGGGCTGG - Intronic
1150295329 17:64004394-64004416 CTGGAGAACCTGGGCAGGTCTGG - Intronic
1150883993 17:69064087-69064109 CTACTATCCATGGGCAGGGCAGG + Intergenic
1151243990 17:72780187-72780209 CTGCTTTCTCTGGGCAGTGCTGG - Intronic
1151369566 17:73639400-73639422 CTGCTGTCCATGTGCTGGGCAGG - Intronic
1151557739 17:74855029-74855051 CTTCGGTGCCTGGGCAGGGCTGG - Exonic
1151564285 17:74888929-74888951 ATGGTGACCCAGGACAGGGCTGG + Intronic
1151660282 17:75515192-75515214 CCGGTGGGCCTGGGCTGGGCTGG - Intronic
1151732994 17:75921935-75921957 CTGGTGTCTCGGGGTAGGCCTGG - Exonic
1151784701 17:76269832-76269854 CTGGTCTCCCTGCCCAGGGAAGG + Intronic
1152068687 17:78124840-78124862 CTGGGGCGGCTGGGCAGGGCTGG - Intronic
1152178459 17:78802812-78802834 CAGGTGTCCCGGGCCAGGCCAGG - Intronic
1152241944 17:79165493-79165515 CGGGGGCCCCTGGGCAGAGCTGG + Intronic
1152326680 17:79645602-79645624 CTGGGCTCCCTGGGCTGGACTGG - Intergenic
1152471265 17:80491167-80491189 GTGGAGTCCCATGGCAGGGCTGG + Intergenic
1152516248 17:80826520-80826542 CCGCTGTACCTGGGCTGGGCCGG - Intronic
1152539200 17:80966475-80966497 CTGGTGGCCCTGGGGACAGCAGG - Intergenic
1152633104 17:81419531-81419553 CTGGTGTCCCCCGCCTGGGCGGG + Intronic
1152768331 17:82152768-82152790 CTGGTGTGCCTTTCCAGGGCTGG + Intronic
1152777752 17:82213111-82213133 CTGGGGACCCTCGGCCGGGCCGG - Intergenic
1152805866 17:82356008-82356030 CTGGTTTCCCTGGGCATGATTGG + Intergenic
1152904105 17:82961024-82961046 CAGGCGTCCCGGGGCCGGGCGGG + Intronic
1154412304 18:14148090-14148112 CTGGGAGCCCTGGGCTGGGCAGG - Intergenic
1154494741 18:14947255-14947277 CTGGTGGCCCTGGGGGTGGCTGG + Intergenic
1155565618 18:27131220-27131242 CTGGGGTCCCTGGGCCAGGAGGG - Intronic
1155774091 18:29737365-29737387 GTGGTGGCACTGGGCAGGGTTGG + Intergenic
1155928855 18:31685253-31685275 CTGGTGTCCGCGGGCCCGGCGGG - Intronic
1156312341 18:35936060-35936082 CTGGCTTTCCTCGGCAGGGCAGG - Intergenic
1156997545 18:43485692-43485714 CTGGAGCACCTGGGCAGGACTGG - Intergenic
1157617720 18:48997059-48997081 CTGGCTGCCCTGGGGAGGGCAGG + Intergenic
1157856903 18:51112058-51112080 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
1158685985 18:59615084-59615106 CTGGTCTCCATCGACAGGGCAGG - Intronic
1159270438 18:66142238-66142260 CTGGTGTGCATGGGGAGTGCAGG + Intergenic
1160025076 18:75209679-75209701 CCGGGGACCCCGGGCAGGGCGGG + Intergenic
1160143441 18:76346629-76346651 CTGGGGACCTTGGGCAGTGCAGG - Intergenic
1160890221 19:1373825-1373847 ATGTCCTCCCTGGGCAGGGCAGG + Intronic
1160912464 19:1481286-1481308 CTGGGGTCCCTGGGCCTGGGCGG + Intergenic
1161007895 19:1945417-1945439 GAGGGATCCCTGGGCAGGGCTGG - Intronic
1161144792 19:2671110-2671132 GTGGTCACCCTGGGCACGGCAGG + Intronic
1161306744 19:3573041-3573063 CAGGGGTCCCAGGGCCGGGCCGG + Intronic
1161457645 19:4377545-4377567 CGGGTGGCACGGGGCAGGGCAGG + Intronic
1161700114 19:5789813-5789835 CTTGTGTCCCTGAGCAAGTCAGG + Intronic
1161849420 19:6730959-6730981 CTGGGCACCATGGGCAGGGCCGG - Intronic
1162147618 19:8622440-8622462 CTGCTGTATCTGGGCTGGGCTGG + Intergenic
1162534357 19:11254086-11254108 ATGGGGTCCAGGGGCAGGGCTGG - Intronic
1162964822 19:14150829-14150851 CTGGTGGCCCAGGCCAGGGAGGG - Exonic
1163685530 19:18709850-18709872 CTGATGGGCCAGGGCAGGGCAGG - Intronic
1163806881 19:19405231-19405253 CCGGTGTCTGTGGGGAGGGCGGG - Intronic
1163843195 19:19624098-19624120 GTGGTGTGCCTGGGGAGGCCTGG + Exonic
1164461702 19:28454588-28454610 CTGGGGTCCCTGGGGAGGTCCGG - Intergenic
1164539408 19:29111766-29111788 CTGGCCTCCCTTGGCGGGGCTGG + Intergenic
1164758450 19:30708517-30708539 CTGTTGTCCCTGGGGAGGACAGG + Intronic
1164932812 19:32188243-32188265 CTGGTCTCAGTGGTCAGGGCAGG - Intergenic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165350302 19:35271623-35271645 CTGGTGTTTCTGGAAAGGGCAGG - Intronic
1165358136 19:35316658-35316680 CAGGTGTGTCAGGGCAGGGCTGG - Intergenic
1165789914 19:38485220-38485242 CTGGGGTCCCTGGGATGGTCTGG - Intronic
1165828263 19:38717912-38717934 TTGATGTCCTGGGGCAGGGCAGG - Exonic
1166117255 19:40663470-40663492 ATGGGGTTCCTGGGTAGGGCGGG + Intergenic
1166182469 19:41118553-41118575 CTGGTGTACCTGGACAGGTAAGG - Intronic
1166231391 19:41427390-41427412 CTGGACTGGCTGGGCAGGGCTGG - Exonic
1166283809 19:41811355-41811377 CTGGTGTCTGGGGGCAGGGAGGG + Exonic
1166383599 19:42368592-42368614 CTGGTGTGCCTGGGGGGGCCAGG + Exonic
1166851389 19:45763153-45763175 CTGGTGTCCCAGGAGAGTGCAGG - Intronic
1167262599 19:48467529-48467551 TTGCTGTCCCTGGGCTGGGCAGG - Intronic
1167426354 19:49431647-49431669 CTGGTGGGCGTGGTCAGGGCTGG - Intronic
1168109360 19:54183422-54183444 GAGGTTGCCCTGGGCAGGGCGGG + Intronic
1168162791 19:54523121-54523143 CTTATGTCTCTGTGCAGGGCTGG - Intergenic
1168650083 19:58087099-58087121 TTAGAGTCCCTGGCCAGGGCTGG - Intronic
925365881 2:3311889-3311911 CTGGGGTCCCTGTGCAGTGTCGG + Intronic
925787970 2:7451611-7451633 GAGGTGTGCCTGGGCATGGCAGG - Intergenic
926172019 2:10558552-10558574 CTGGTTTTCCTGGGGAGGGTGGG - Intergenic
926172152 2:10559192-10559214 CTGGGGTCCTGGGGCTGGGCAGG - Intergenic
926276223 2:11405140-11405162 CAGGTGTCCCTTGACAGGCCTGG - Intergenic
926316343 2:11712984-11713006 CTCCTGTCACTTGGCAGGGCAGG + Intronic
926321721 2:11753077-11753099 CTCCTGTCCCTGGGCAAGGAGGG + Intronic
926756974 2:16244298-16244320 CAGGTGCCCCAGGGCAGGACTGG + Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
927508331 2:23628869-23628891 CAGCTGACCCTGGGGAGGGCGGG + Intronic
928022406 2:27715322-27715344 ATGGTGTCCCCGGTCCGGGCAGG - Intronic
929194626 2:39172483-39172505 CTGGGGACCCTGGGCAACGCAGG + Intergenic
929380905 2:41352174-41352196 GTTGTGTCCATGGGGAGGGCGGG + Intergenic
929783452 2:44972621-44972643 CTGGTGGCCCTGGACTGGGCTGG - Intergenic
932296411 2:70626838-70626860 CCAGTTTCCATGGGCAGGGCGGG + Intronic
932314005 2:70767799-70767821 CTGGCATCCCTCGGCCGGGCGGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932809810 2:74815453-74815475 TTGGTGTCCCTGGGGAGTTCTGG + Intergenic
933726341 2:85429717-85429739 ATGGTCTCCCTGGGCAGAGAGGG - Intronic
933776319 2:85773380-85773402 GTGGGGTCCTGGGGCAGGGCCGG + Intronic
933778768 2:85787455-85787477 CTGGGGTGCCTGGGCGGGGCTGG + Exonic
934529162 2:95074481-95074503 CTTGTGTCCTTGGGCTGCGCAGG - Intergenic
935091870 2:99902478-99902500 CAGGTGTCCCTCGTCAAGGCAGG + Intronic
935171804 2:100616003-100616025 CTTTTCTCCCTGGGCAGGGGAGG + Intergenic
935712692 2:105913274-105913296 CTGGAGTCACTGGGAAGAGCTGG + Intergenic
936146312 2:109982457-109982479 CGTGTGTCCCAGGGAAGGGCAGG + Intergenic
936198379 2:110389022-110389044 CGTGTGTCCCAGGGAAGGGCAGG - Intergenic
937008004 2:118535689-118535711 CTTGTGTCCTTCGGCAAGGCAGG - Intergenic
937316290 2:120933878-120933900 CTGAAGCCCCAGGGCAGGGCAGG - Intronic
937672174 2:124549892-124549914 CAGGTGTTCCTGAGCATGGCTGG + Intronic
938132012 2:128724798-128724820 AGGCTGTCCCTGGGCAGGCCCGG + Intergenic
938408790 2:131047100-131047122 CTGGCGCCCCTTGGCAGGACAGG - Exonic
939950638 2:148468603-148468625 CTGATGACGCTGGGCTGGGCAGG - Exonic
942659332 2:178247501-178247523 CTGGTGGCCCAGGACAGTGCTGG + Intronic
944581780 2:201138094-201138116 CTGGTGTGGATGGGCTGGGCAGG - Intronic
946882107 2:224186672-224186694 CTGGTTTTCTTGGTCAGGGCAGG - Intergenic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
947565415 2:231190228-231190250 CTGGCCCCGCTGGGCAGGGCTGG - Intergenic
947948289 2:234125287-234125309 ATGGTGTCCAGGGGCAGGGTGGG + Intergenic
948368885 2:237475189-237475211 CCGGGGTCCCCGGGAAGGGCTGG + Intergenic
948598813 2:239096699-239096721 CTGGTGTCCGTGGGGTGGGGTGG - Intronic
948710033 2:239819730-239819752 CCGATGGCCCTGGGCAGGGGTGG - Intergenic
948800742 2:240432401-240432423 CTGGCAGCCCTGGGCAGAGCAGG - Intergenic
948854006 2:240721629-240721651 CTGGTTTCCCTGGGTCGGCCTGG - Intronic
948909721 2:240996960-240996982 CTGGCCTCCCTGGTCAGGGAGGG - Intergenic
948980562 2:241492287-241492309 CTGATGACCCTGGGTAGGTCAGG + Intronic
1169111377 20:3036425-3036447 GAGGGGTCCCTGGCCAGGGCCGG + Intronic
1169207759 20:3749647-3749669 CTTGGGACCCGGGGCAGGGCTGG + Intronic
1170770716 20:19330190-19330212 GAGGTTTCCCTGGGCAGGGCTGG + Intronic
1171371101 20:24662491-24662513 CTGGGCTCCATCGGCAGGGCTGG - Intronic
1171452738 20:25247721-25247743 CTGGTGACCCGGTGCAGGGCGGG + Intergenic
1172009790 20:31839921-31839943 CTGGTGTCCCGGGAAAGGCCAGG - Intergenic
1172095880 20:32460332-32460354 TTGGTGTCACTGGGGAAGGCAGG - Intronic
1172387407 20:34543816-34543838 CTGGGCTCCGTGAGCAGGGCCGG + Intergenic
1172479341 20:35261704-35261726 CAGGAGACCCCGGGCAGGGCAGG - Intronic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1173114245 20:40225069-40225091 CTGGTTTCACTGGGCAGGATGGG - Intergenic
1173523504 20:43715879-43715901 CTGGTGATCCTGGCCAGGGAAGG - Intronic
1173569003 20:44064924-44064946 CTGGGGCCCGTGGGAAGGGCCGG + Intronic
1173578873 20:44132467-44132489 ATGATCTCCCTGGGCAGAGCTGG - Intronic
1173664796 20:44756068-44756090 CTGGGGTCCCAGGTCAGGGCTGG + Exonic
1173730601 20:45325630-45325652 CTTGTCTCCCTGGGTAGGGGGGG - Exonic
1173838235 20:46139444-46139466 CTGGGGCCACTGGGCAGGACAGG + Intergenic
1175972132 20:62692034-62692056 CTGGTGGCCGTGGGCAGAGCTGG - Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176117421 20:63439170-63439192 TTGTTGCCCCAGGGCAGGGCAGG - Intronic
1176172489 20:63702251-63702273 CTGCTGGCCCTTGGCAGGGTGGG - Intronic
1176860701 21:14010167-14010189 CTGGGAGCCCTGGGCTGGGCAGG + Intergenic
1178117705 21:29434648-29434670 CTGTTGTCCCTGGACTGTGCTGG + Intronic
1178595830 21:33951502-33951524 TGGGTGGCACTGGGCAGGGCTGG - Intergenic
1179644358 21:42766658-42766680 CTGGTGGCCCTGGCCTGGGGAGG - Intronic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179896372 21:44365836-44365858 CTGGTCTCCCTGGGAGGAGCAGG - Intronic
1179908775 21:44437272-44437294 CTGCAGCCCCTGGGCAGGGAGGG + Intronic
1179985570 21:44918866-44918888 CTGGTGGGCGTGGGCTGGGCTGG - Intronic
1180109267 21:45640467-45640489 CAGCGGTCCCTGTGCAGGGCAGG + Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180235795 21:46458794-46458816 CTGGTGTTGCTGGGCGGGGCCGG + Intergenic
1180254105 21:46610896-46610918 CTGGTTGCCCAGGCCAGGGCTGG - Intergenic
1180783530 22:18534798-18534820 CAGGGGGCCCTGGGGAGGGCTGG - Intergenic
1180982535 22:19885575-19885597 CTGGGCCCCATGGGCAGGGCTGG + Intronic
1181015624 22:20066838-20066860 CTGCTCTTCCTGGGCAGGCCGGG - Intergenic
1181127097 22:20708849-20708871 CAGGGGGCCCTGGGGAGGGCTGG - Intronic
1181240432 22:21474150-21474172 CAGGGGGCCCTGGGGAGGGCTGG - Intergenic
1181456803 22:23064474-23064496 CTGGTGTGCCTGGGCCCTGCAGG - Intronic
1181731114 22:24847585-24847607 CTGGAGTGCATGGGCAGGGCAGG + Intronic
1182376961 22:29855674-29855696 CTGCTGTGCCTGGGGTGGGCAGG + Intergenic
1182446884 22:30394949-30394971 CTGTTGAACCTGGGAAGGGCAGG + Intronic
1182916871 22:34041621-34041643 GTGGTGTTCCTGGGCTGGGCTGG - Intergenic
1183232700 22:36592942-36592964 CTGGTGGGACTGGGCTGGGCTGG - Intronic
1183364640 22:37400414-37400436 CAGGGCTGCCTGGGCAGGGCTGG + Intronic
1183373399 22:37448542-37448564 CTGGTGTCACAGAGCAGGGCAGG + Intergenic
1183456500 22:37925915-37925937 CGGGTGGCCCAGGGCAGGGCTGG - Exonic
1183597472 22:38821447-38821469 CTGGTGACCCTGGGCTTCGCAGG - Exonic
1183598871 22:38828584-38828606 CTGGGGTCACTGAGCAGGGGCGG - Intronic
1184149940 22:42631977-42631999 TTGGAGTTCCTGGGCAGGGAAGG - Intronic
1184188153 22:42878144-42878166 CTGGGGGCCCTGGGCTGGCCAGG - Intronic
1184504129 22:44890943-44890965 CTGATACCCCTGGGCTGGGCTGG - Intronic
1184671247 22:46013231-46013253 CTGGGGGCCCCGTGCAGGGCTGG - Intergenic
1184781051 22:46649817-46649839 CTGTTTTCCCTGAGCAGGGAGGG + Intronic
1184814078 22:46857306-46857328 CTGCTGCCCCTGGGTGGGGCTGG + Intronic
1184829917 22:46978140-46978162 CTGATCTCCCTGAGCAGGACTGG - Intronic
1185043499 22:48517619-48517641 CTGGTGGCCCAGGGCCCGGCGGG - Intronic
1185199661 22:49493985-49494007 CTGAGCTCCCTGGGCAGGGATGG + Intronic
949105816 3:198197-198219 CAGGTGTGCGTCGGCAGGGCTGG + Intronic
950009862 3:9715374-9715396 CTGGGTGACCTGGGCAGGGCTGG - Intronic
950417339 3:12876087-12876109 CTGGAGGCGCTGAGCAGGGCCGG + Intergenic
950484348 3:13264299-13264321 ATGGTTTCCATGGGCAGGTCAGG - Intergenic
950628711 3:14267238-14267260 CTGGAGGCCCTGGGCAGCCCTGG - Intergenic
953072114 3:39531167-39531189 CTGGTGTTCCCCTGCAGGGCTGG + Intergenic
953142104 3:40238614-40238636 CTAGTGTAACTGGGCAGAGCTGG - Intronic
953158875 3:40399828-40399850 CAGGTGTTGCTGGGCAGTGCTGG - Intronic
953354605 3:42244979-42245001 CTGTTGTCACTGAGCAGGGCAGG - Intergenic
953785111 3:45905639-45905661 CAGGTGACCCTGGGAAGGCCTGG - Intronic
953884850 3:46709384-46709406 CTGGTCTCCAGGGGCAGGGCTGG - Intronic
953926555 3:46985619-46985641 CCGGTGTCCCTGGGAAGAGGGGG - Intronic
953979507 3:47406621-47406643 CTGGGGCCCCAGGGCGGGGCAGG + Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954139852 3:48599227-48599249 CAGGTGTCCCTGTGCAGGCCAGG - Intronic
954144405 3:48627285-48627307 CTCGTGTCCCTGTGCAGCGTCGG - Intronic
954619800 3:51989052-51989074 CAGCTGTCACTGGGCAGGGCAGG - Exonic
954684010 3:52360942-52360964 CAGGGGTCCCTGGGCAAAGCTGG + Intronic
954801431 3:53189247-53189269 GTGGAGGCCCTGGGCTGGGCTGG + Intronic
954880608 3:53833507-53833529 CTGGGCTGCCTGGGCAGGGAAGG + Intronic
955219655 3:57012973-57012995 CTGCTGGCCCTGGGCAGTGAGGG + Intronic
956267328 3:67411941-67411963 CTGAAATCCCTGGGCAGGGCTGG + Intronic
957039682 3:75327627-75327649 CTGGTGGCTCTGGCCAGGGCAGG - Intergenic
958733142 3:97979768-97979790 CTGCTGTGCCTGGCCAGGGATGG + Intergenic
959462446 3:106643878-106643900 CTGCTGGCCCTGGGCAGTGAGGG + Intergenic
961048623 3:123727236-123727258 ATGGTGTACCTGGACAGGCCTGG + Intronic
961394618 3:126578389-126578411 CAAGTTTCCCTGGGCAGGGTGGG + Intronic
961447883 3:126989552-126989574 CTGGTGGGCCAGGGCACGGCCGG - Exonic
961448287 3:126991307-126991329 TGGGCCTCCCTGGGCAGGGCTGG - Intronic
961454165 3:127016088-127016110 CCTCTGTCCCTGGGGAGGGCTGG - Intronic
961463321 3:127066851-127066873 ATGGTGTCCAGGGACAGGGCTGG + Intergenic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
962302140 3:134252066-134252088 GAGGTGTCCCAGGACAGGGCAGG - Intergenic
966985399 3:185175513-185175535 CTCCTGTTCCTGGGCAGGGCTGG - Intergenic
967377837 3:188825642-188825664 GTGGTGACCCTGGGCTGGGGAGG - Intronic
967891989 3:194370066-194370088 CTTGTCTCCTTGGCCAGGGCAGG - Intergenic
968450834 4:675232-675254 CTGGTGTCCATGGGGCTGGCGGG - Intronic
968585275 4:1413478-1413500 GTGGTGTCCCTGGCCACTGCAGG + Intergenic
968653282 4:1768258-1768280 CAGGTGTCCCGGGATAGGGCCGG - Intergenic
968656587 4:1780960-1780982 CTGGGGTCCCTTGGCAGGCGTGG + Intergenic
969268386 4:6081149-6081171 CTGGTGTTTGTGGTCAGGGCAGG - Intronic
969573545 4:8023942-8023964 CTGGTGGCCACGGGCAGGCCAGG + Intronic
969594774 4:8142803-8142825 GTGTTGTCCTTGGGGAGGGCAGG - Intronic
970434822 4:16023265-16023287 CAGGAGTCCCTGGGCTTGGCAGG - Intronic
972505790 4:39718754-39718776 CTGCTGGCCCTGGGCAGTGAGGG - Intronic
972511164 4:39770033-39770055 CTGGGGTCCCTGGGCTAGGTGGG - Intronic
972725815 4:41745933-41745955 CTGGGGGCCCTGGACAAGGCTGG - Exonic
972960386 4:44447122-44447144 GTGGTGTCCCTGCAGAGGGCAGG - Intronic
975005590 4:69279914-69279936 CTGGTTGCCCAGTGCAGGGCGGG + Intergenic
976342836 4:83964308-83964330 CTGGAGTGCCTGGGCAGGACTGG + Intergenic
977756938 4:100682747-100682769 GTGGGGTCCCTGGGCAGCCCTGG - Intronic
978347640 4:107788507-107788529 CAGGTGGCCATGGGCAGGACAGG + Intergenic
980495658 4:133585682-133585704 CTGGTCTCCTTGGCCAGGGGAGG - Intergenic
981573459 4:146177839-146177861 CAAGTGTCCCTGAGCAGGGTGGG + Intronic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
983930601 4:173449468-173449490 CTGGTCTCCCAGGGCATAGCTGG + Intergenic
984726815 4:183029633-183029655 GTGTTGTTCCTGGGCAGTGCAGG - Intergenic
985664280 5:1173909-1173931 CGTGTGTCCCTGGGCACGGGTGG - Intergenic
985732379 5:1556526-1556548 CTGCTGGCCCTGGGGAGGCCAGG - Intergenic
985752124 5:1686698-1686720 CTGCTCTCCCTGGGCAGGGTCGG + Intergenic
986168389 5:5295511-5295533 CTGACATCCCTGGGCAAGGCTGG + Intronic
986322278 5:6641609-6641631 CTGGTGTCCCCTTCCAGGGCAGG + Intronic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
990016762 5:51073084-51073106 CTGTTTTCACTGGGTAGGGCTGG + Intergenic
990047802 5:51456363-51456385 ATCAGGTCCCTGGGCAGGGCTGG - Intergenic
992048855 5:72925600-72925622 CTGCTGGCCCTGGGCAGTGAGGG + Intergenic
992084459 5:73265506-73265528 ATGGTATCCCTGGGCAAGGGTGG + Intergenic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
994551415 5:101239447-101239469 CCGGTTTCCCTGGCTAGGGCTGG + Intergenic
995145476 5:108783847-108783869 CTGATGTCTCTGGACAGGGGAGG + Intronic
996542700 5:124647072-124647094 CTGCTGTCTATAGGCAGGGCTGG + Exonic
997197113 5:131987598-131987620 CTGATGTCTCTGGGGAGGCCAGG + Intronic
997932476 5:138083852-138083874 CTGGAGGGGCTGGGCAGGGCGGG + Intergenic
998179113 5:139924070-139924092 CTAGTGATCCTGGGGAGGGCTGG - Intronic
999149022 5:149414618-149414640 CTGGTGTCCCCTGGGAAGGCAGG - Intergenic
999260352 5:150234698-150234720 CTGGAGTCTCTAGTCAGGGCAGG + Intronic
999310593 5:150549306-150549328 CTGGTATGGCTGGGCATGGCCGG - Intronic
1001425493 5:171619513-171619535 CTGGGATCCCTGGGCGGGGTAGG + Intergenic
1001791799 5:174464077-174464099 CCTGTGTCCCTGTGCAGAGCAGG + Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002192220 5:177484231-177484253 CCCGTGACCCAGGGCAGGGCAGG - Intronic
1002195494 5:177498715-177498737 GTGCTGCCCCTAGGCAGGGCAGG - Intergenic
1002198765 5:177515144-177515166 CTGGGGTCCTTGAGGAGGGCTGG - Intronic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002425492 5:179172260-179172282 ATGTTGTCCCTGGGAAGAGCAGG + Intronic
1002596747 5:180328668-180328690 GTGCTGTCCCTGAGCAGGGCAGG - Intronic
1002959022 6:1896902-1896924 CTGATGTCTCTGGGAAGGACAGG + Intronic
1003292251 6:4789407-4789429 GTGGTGTCTCTGGGCACGGTGGG + Intronic
1005512071 6:26520564-26520586 GTGGTTACCCTTGGCAGGGCCGG - Intergenic
1006116151 6:31777116-31777138 CTGGGTCTCCTGGGCAGGGCTGG + Exonic
1006220310 6:32484276-32484298 CTGGGCGCCCTTGGCAGGGCGGG - Intergenic
1006429377 6:33985666-33985688 CTGGTGTGAATGGGCGGGGCCGG - Intergenic
1006520061 6:34566025-34566047 CTTGTGTCACTGAGCAGGGTTGG - Intergenic
1006981943 6:38154252-38154274 CGGGGGGCCCTGGGGAGGGCCGG - Exonic
1007699743 6:43759632-43759654 CTGCTGCCCCTGGGGAGGTCTGG + Intergenic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1011101570 6:83728162-83728184 CTGTAGTCCCTGGGAAGGGAAGG + Intergenic
1011983527 6:93416854-93416876 CTGGCGTCCCGGGGCTGGGGCGG + Intronic
1012397905 6:98821156-98821178 CTGGTGTTTCTGAGCGGGGCAGG - Intergenic
1013792740 6:113855289-113855311 CTGGTCTCCCTGGCAACGGCCGG - Intergenic
1015494485 6:133865855-133865877 CTGGAGAGCCTGGGCAGGGGCGG + Intergenic
1017644460 6:156526373-156526395 CCGGAGACCCTGGGCAGGGTGGG - Intergenic
1017950085 6:159129019-159129041 CTGATGGGCCTGGGGAGGGCAGG - Intergenic
1018957286 6:168418760-168418782 CTGGGGAGCCTGGGCAGGGAGGG - Intergenic
1019316937 7:391224-391246 CTGGTGTCCCTGCCCAGAGTGGG + Intergenic
1019478690 7:1256168-1256190 CTGGTGTGCGTGGGGAAGGCGGG - Intergenic
1019511878 7:1421781-1421803 CTGGTGCCCCTGCACAAGGCTGG + Intergenic
1019586907 7:1809962-1809984 CTGGTGTCGCTGGGCACGGGCGG - Intergenic
1019621906 7:1996508-1996530 CTGGCGACCGTGAGCAGGGCAGG - Intronic
1019663914 7:2241955-2241977 CAGGTCTCCAGGGGCAGGGCCGG - Intronic
1019950821 7:4370901-4370923 CTGGGGTCACTGGGCAGCACGGG + Intergenic
1020013705 7:4819482-4819504 CTGGAGTTTCGGGGCAGGGCAGG - Intronic
1020073562 7:5243124-5243146 CTGGTGGCACAGGGCAGGACAGG + Intergenic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1023601366 7:41884682-41884704 CTGGAGACCCAGGGAAGGGCTGG - Intergenic
1023829589 7:44031012-44031034 CGGGGGTCCCTGGTGAGGGCTGG + Intergenic
1025211228 7:57020469-57020491 GTGGTGGCAGTGGGCAGGGCCGG - Intergenic
1025257606 7:57395779-57395801 CTGGAGCCCCTGGGAGGGGCGGG + Intergenic
1025660725 7:63556378-63556400 GTGGTGGCAGTGGGCAGGGCCGG + Intergenic
1026881485 7:73909271-73909293 CTGGGCTTCCAGGGCAGGGCTGG - Intergenic
1026892142 7:73988500-73988522 CTGGGGGCTGTGGGCAGGGCTGG - Intergenic
1026942244 7:74293830-74293852 CTCCTGTCCCGGGGCAGGGCTGG - Intronic
1026970604 7:74465268-74465290 CTGGTGGCCCGGGGCAGGTGGGG - Intronic
1027421145 7:78019463-78019485 CTGGAGGCCGAGGGCAGGGCGGG - Exonic
1027698294 7:81437340-81437362 CTGCTGGCCCTGGGCAGTGAGGG - Intergenic
1029446305 7:100614806-100614828 CTGGAGGACCTGGGCTGGGCAGG + Intronic
1031902857 7:127429279-127429301 CTGCTGGCCCTGGGCAGTGAGGG + Intronic
1032257433 7:130308427-130308449 CTGCTGTCCCTGGGCTCGCCTGG + Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1034439720 7:151080588-151080610 CTGGCGTCCCTGGGCCGGGGTGG - Intronic
1034554234 7:151839829-151839851 ACGGTGTCCCTGGGGAAGGCGGG - Intronic
1036999913 8:13705673-13705695 CAGGTTTCCCTGGGCCTGGCGGG + Intergenic
1037822171 8:22140308-22140330 CTGGAATCTCTGGGCTGGGCTGG - Intronic
1037900217 8:22683872-22683894 CTGCAGGCCCTGGGCAGGCCTGG + Intergenic
1038642171 8:29337455-29337477 CCGGTGCCCCTGGTCGGGGCTGG - Intronic
1038768410 8:30452384-30452406 TAGATGTCACTGGGCAGGGCTGG + Intronic
1044727944 8:95208233-95208255 GTGCTGTCCCTGGAAAGGGCTGG - Intergenic
1045847871 8:106658288-106658310 CAGGTGTGCCTGGGCCGGGGCGG + Intronic
1046190423 8:110788397-110788419 GTGGCGTGCCTGGGGAGGGCAGG + Intergenic
1047799944 8:128298447-128298469 GTGGGGTCCTTGGGCAGGGCAGG + Intergenic
1048205585 8:132412727-132412749 CTGCTGTCCCAGGGCAGGGGAGG - Intronic
1048274507 8:133056066-133056088 CAGGTCTCCCTGGGCAGGGCAGG + Intronic
1048581486 8:135732729-135732751 CCAGTGTCCCAGGGCTGGGCTGG + Intergenic
1049237969 8:141522145-141522167 CTGGTGCCACTGGGGTGGGCAGG + Intergenic
1049319328 8:141987609-141987631 CTGCTGTTCCGGGGCTGGGCAGG - Intergenic
1049449991 8:142655419-142655441 CTGCTTTCCCTGGGCAGTCCTGG - Intergenic
1049474533 8:142790600-142790622 CTAGTGTCCATGGGCCGGGCCGG + Intergenic
1049544061 8:143221429-143221451 CCGATGCCCCTGGGGAGGGCCGG + Intergenic
1049600546 8:143505470-143505492 CAGGTGACCCTGGGCGAGGCAGG + Intronic
1049687153 8:143943593-143943615 CTGCAGTCCCAGGGCGGGGCGGG - Intronic
1049752914 8:144294039-144294061 CTGTTCTCCCTGGGGAGGGATGG + Intronic
1049782466 8:144435235-144435257 CTTCTGGCCCTGGGCAGGGATGG - Intronic
1052866013 9:33465058-33465080 CTGGTGTGGATTGGCAGGGCAGG + Intronic
1053025698 9:34726493-34726515 TTGGTTTCCCTGGACAAGGCTGG + Exonic
1053037224 9:34835555-34835577 TTGGTTTCCCTGGACAAGGCTGG + Intergenic
1055450986 9:76431297-76431319 CTGGGGTCCCTGCTAAGGGCTGG - Intronic
1057014235 9:91636501-91636523 CTGGATGCTCTGGGCAGGGCAGG + Intronic
1057139563 9:92718367-92718389 CTGGGGGCCCTGAGCAGGGGAGG + Intronic
1057230306 9:93317714-93317736 CTGGGGGCCCTGGGCAGGCCAGG + Intronic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1057644074 9:96856467-96856489 CTGCTCTCTCTGGGGAGGGCGGG - Intronic
1058668661 9:107342474-107342496 CTGCAGCCCCTGGGCAGGGGAGG + Intergenic
1058868631 9:109183752-109183774 CTGCTGCCCCTGGGCAGTGGTGG - Intronic
1058917251 9:109579412-109579434 CTTGTGTGACTTGGCAGGGCTGG + Intergenic
1058917971 9:109585968-109585990 CTGATATCCCTGGGAAAGGCTGG - Intergenic
1059408342 9:114116322-114116344 CAGGTGTCCCAGGAGAGGGCAGG + Intergenic
1060048182 9:120357669-120357691 CTTGGGTCCCTGGGCAGGGTGGG + Intergenic
1060674119 9:125496900-125496922 CTGGTGTCTGTGGCCAGGCCTGG - Intronic
1061119788 9:128635647-128635669 CCTGTGTCCCAGGTCAGGGCAGG - Exonic
1061178311 9:129010201-129010223 CTGCTCGGCCTGGGCAGGGCAGG + Exonic
1061620113 9:131806495-131806517 CTGGTGTCTCTGGGCTCAGCAGG - Intergenic
1061680950 9:132242155-132242177 CCGGGGTCCCGGGGCGGGGCCGG + Exonic
1061884748 9:133585821-133585843 CTGGGGGCCCAGGGCAGAGCTGG + Intronic
1061945690 9:133907257-133907279 CTTGTTGGCCTGGGCAGGGCAGG - Intronic
1062024034 9:134332296-134332318 CCCGGGTCCCAGGGCAGGGCAGG + Intronic
1062028910 9:134353118-134353140 CTGGTGTGGCTGGGAGGGGCAGG + Intronic
1062213005 9:135374562-135374584 CTGCTGTCCCTGGACAGTGGGGG - Intergenic
1062218805 9:135403455-135403477 CTGGGGTCCCTGGCCGTGGCAGG - Intergenic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062446380 9:136597097-136597119 CTGGCATCCCTGGGCAGGACAGG + Intergenic
1062483677 9:136763833-136763855 CTGGGCTGCCTGGGCTGGGCTGG - Intronic
1062538550 9:137031536-137031558 CAGGTGTCGCTGGGCAGCTCTGG + Exonic
1062556475 9:137115234-137115256 CTGGAGCGTCTGGGCAGGGCCGG + Intergenic
1062690183 9:137837590-137837612 CAGGTGGGCCGGGGCAGGGCAGG + Intronic
1185507786 X:642898-642920 CTGGTGTCCCTGGAGAGGCTTGG + Intronic
1188236790 X:27741340-27741362 CTGGTGGCTCTGGGGAGGGGAGG - Intronic
1189484698 X:41421195-41421217 CTGGTGGCACTGGGCAGAGCTGG + Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1192204693 X:69088233-69088255 CTGATTTCCCTGGCTAGGGCTGG + Intergenic
1192495286 X:71612477-71612499 CGGGTGACCCTGGGCAGCTCCGG - Exonic
1193365194 X:80623364-80623386 CTGAGCTCCCTGGGCAGGGGGGG - Intergenic
1196199099 X:112865375-112865397 CTGGTGACTCAGGGCACGGCTGG - Intergenic
1196208739 X:112971098-112971120 TTGGTGGCCCTGGGCAGTGATGG + Intergenic
1196441833 X:115725962-115725984 AATGTGTCCCGGGGCAGGGCCGG - Intergenic
1197774363 X:130110210-130110232 CTGGGGGCCCAGGGAAGGGCGGG - Intronic
1200117602 X:153776224-153776246 CTGGGGTGGGTGGGCAGGGCTGG - Intronic
1200134964 X:153870359-153870381 CTGGGAACCCAGGGCAGGGCAGG - Intronic