ID: 1165271048

View in Genome Browser
Species Human (GRCh38)
Location 19:34707957-34707979
Sequence AAGCAGTTGTACCTTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165271043_1165271048 16 Left 1165271043 19:34707918-34707940 CCAGCTGCTGTTGATTCTGCTGC No data
Right 1165271048 19:34707957-34707979 AAGCAGTTGTACCTTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165271048 Original CRISPR AAGCAGTTGTACCTTGGCCA AGG Intergenic
No off target data available for this crispr