ID: 1165272793

View in Genome Browser
Species Human (GRCh38)
Location 19:34724892-34724914
Sequence CTGGGGTTTTTCAGAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165272793_1165272803 19 Left 1165272793 19:34724892-34724914 CCCCCTTCTCTGAAAAACCCCAG No data
Right 1165272803 19:34724934-34724956 AGTCCGTGCTCCAGACCCACCGG No data
1165272793_1165272807 29 Left 1165272793 19:34724892-34724914 CCCCCTTCTCTGAAAAACCCCAG No data
Right 1165272807 19:34724944-34724966 CCAGACCCACCGGCCCACCTGGG No data
1165272793_1165272805 28 Left 1165272793 19:34724892-34724914 CCCCCTTCTCTGAAAAACCCCAG No data
Right 1165272805 19:34724943-34724965 TCCAGACCCACCGGCCCACCTGG No data
1165272793_1165272801 -4 Left 1165272793 19:34724892-34724914 CCCCCTTCTCTGAAAAACCCCAG No data
Right 1165272801 19:34724911-34724933 CCAGGTCTTGACCTCATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165272793 Original CRISPR CTGGGGTTTTTCAGAGAAGG GGG (reversed) Intergenic
No off target data available for this crispr