ID: 1165274844

View in Genome Browser
Species Human (GRCh38)
Location 19:34739618-34739640
Sequence CTCGTTCACCATGACTCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165274844_1165274847 3 Left 1165274844 19:34739618-34739640 CCAGGTGAGTCATGGTGAACGAG 0: 1
1: 1
2: 1
3: 11
4: 72
Right 1165274847 19:34739644-34739666 AAGGAAGATTTTGTTAAAAAGGG 0: 1
1: 0
2: 13
3: 97
4: 1167
1165274844_1165274846 2 Left 1165274844 19:34739618-34739640 CCAGGTGAGTCATGGTGAACGAG 0: 1
1: 1
2: 1
3: 11
4: 72
Right 1165274846 19:34739643-34739665 AAAGGAAGATTTTGTTAAAAAGG 0: 1
1: 0
2: 4
3: 129
4: 1334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165274844 Original CRISPR CTCGTTCACCATGACTCACC TGG (reversed) Exonic
909521428 1:76573067-76573089 CTATTTCCCCATGACTCCCCTGG - Intronic
912175929 1:107156754-107156776 CTCTTTCCCCATGACTGACACGG - Intronic
923173929 1:231445320-231445342 CCCATTCACCATCCCTCACCCGG - Intergenic
1063361456 10:5462925-5462947 CTCCTTCACCTTGTCCCACCAGG + Intergenic
1069060669 10:63891463-63891485 CTGGTTCACCATGAATGACCAGG - Intergenic
1071468755 10:85963650-85963672 CTCCTTCACCATGATTCTCCTGG + Intronic
1071565277 10:86668389-86668411 CCGGTCCACCATGACTCACACGG - Intergenic
1080034382 11:27697488-27697510 CTTGTTCATTTTGACTCACCAGG - Intronic
1085036689 11:73305237-73305259 CTAGATCACCATGACTCACTGGG + Intergenic
1088619656 11:111669117-111669139 CTCCTTTACTATGACTCACATGG + Intronic
1090163133 11:124516825-124516847 CACGATCACCATGTCTCCCCAGG - Intergenic
1093516740 12:19996328-19996350 CTAATTCACCATATCTCACCTGG + Intergenic
1094711199 12:32964300-32964322 CTCCTTCACCCTGACTCCTCAGG - Intergenic
1097680825 12:62647453-62647475 TTGGTTCACCATGGCTCATCTGG - Exonic
1106257031 13:28031369-28031391 CCCTTCCACCATGAGTCACCTGG - Intronic
1114741466 14:25102575-25102597 CACTTTCACCATGGCTCGCCTGG - Intergenic
1120850468 14:89164695-89164717 CTCCACCACCATGACTCACCGGG + Intronic
1124243785 15:28053290-28053312 CACGTTCACCTTCACACACCTGG + Intronic
1125334261 15:38612322-38612344 ATCCTTCCCCATGAGTCACCTGG - Intergenic
1125350562 15:38762653-38762675 CTCATTCACCAAAACACACCTGG - Intergenic
1128560547 15:68663914-68663936 TTTGTTCATCATTACTCACCAGG + Intronic
1132211757 15:100029092-100029114 CTGGTTCACCCTGAGCCACCAGG + Intronic
1143452208 17:7042889-7042911 CTCCTTCACCCTGAATGACCCGG + Intronic
1149481656 17:57008320-57008342 ATGGTTCACCAAGACTCACAAGG - Intergenic
1150060296 17:62063066-62063088 CTTATTCACCATGACTTATCAGG - Exonic
1157378120 18:47184796-47184818 CTGGTGCAGCATGACTCAGCAGG + Intergenic
1161503716 19:4632618-4632640 CGCCATGACCATGACTCACCAGG + Intergenic
1165251838 19:34544895-34544917 CTCATTCACCATGACTCACCTGG + Intergenic
1165268590 19:34683247-34683269 CTCGTTCACCATGACTCATGTGG - Intronic
1165274844 19:34739618-34739640 CTCGTTCACCATGACTCACCTGG - Exonic
926888853 2:17621995-17622017 CTCTCTCATTATGACTCACCAGG - Intronic
927805003 2:26139303-26139325 CGAGTTTACCATGACTCCCCAGG - Intergenic
930944298 2:57052956-57052978 CAGGTTCACCATGAATGACCAGG + Intergenic
934759071 2:96843548-96843570 CTCTTTCACCATCACTATCCAGG + Intronic
934993812 2:98939263-98939285 CTCTGCCACCATGGCTCACCTGG - Intergenic
936686036 2:114827427-114827449 CTTGTTGACCATGACTCATGGGG + Intronic
939933507 2:148259811-148259833 CTGGTGCAGCATGACTCAGCGGG - Intronic
943567100 2:189528996-189529018 CCCGTACACCAGTACTCACCAGG + Intergenic
1170460309 20:16571539-16571561 CTCTCTCACCATGGCTCACCAGG + Intronic
1172300313 20:33845276-33845298 CTTGTTCACCATCACTCAGCAGG + Intronic
1173137072 20:40447859-40447881 ATCTTTCTCCATGACTCCCCTGG - Intergenic
1180844696 22:18974733-18974755 CTCACTCACCATCACCCACCCGG - Intergenic
1182588281 22:31359308-31359330 CTCTATCACCTTGACTCTCCAGG - Intergenic
1183787040 22:40035551-40035573 CTCGCTCACCATGGATCCCCAGG - Exonic
952419131 3:33115330-33115352 CTCGTGCACCGTGAGTCATCAGG + Intronic
953308456 3:41852975-41852997 CACATTCACAATGACTCACCTGG + Intronic
955081600 3:55662893-55662915 CTCATTCAGCATGTCTCATCAGG - Intronic
956322318 3:68010372-68010394 CTCGTTCAGATTGCCTCACCTGG + Intronic
961861142 3:129917742-129917764 CTTGTCCACCAGGGCTCACCTGG - Intergenic
964738545 3:159941774-159941796 CTGGGTCACAACGACTCACCTGG - Intergenic
964811312 3:160667650-160667672 CCCAATCAACATGACTCACCAGG + Intergenic
969570887 4:8007622-8007644 CTCGTTCAGGATGAGTCACAGGG + Intronic
975394486 4:73859030-73859052 CTCAGTCACCATCCCTCACCTGG + Intergenic
975396184 4:73876035-73876057 CTCGGTCACCAAGTGTCACCTGG - Intergenic
981027572 4:140092429-140092451 CTCGGTTAACATGCCTCACCCGG - Intronic
981175582 4:141679047-141679069 CTTTTTCCTCATGACTCACCAGG + Intronic
981305429 4:143242063-143242085 CTGGTGCAGCATGACTCAGCGGG + Intergenic
990946978 5:61260041-61260063 CTCGGTCTCCATCTCTCACCTGG + Intergenic
994787729 5:104186226-104186248 CTGGTGCAGCATGACTCAGCGGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996671876 5:126127516-126127538 CTCCTTCCCCATGAGTCCCCAGG + Intergenic
999201041 5:149816570-149816592 ATTGTTCACCATGACTTACCTGG + Intronic
1001894030 5:175363470-175363492 CTCGTGCAGCATGACACAGCGGG + Intergenic
1004035754 6:11921132-11921154 CTCTCTCACCCTGACACACCAGG - Intergenic
1006441042 6:34053805-34053827 TTTGTTCACAATGAATCACCTGG - Intronic
1008071965 6:47107045-47107067 CTCCTCCACCATGACCAACCAGG + Intergenic
1009681435 6:66897732-66897754 CTGGTCCAACATGACTCAGCGGG + Intergenic
1012036252 6:94144369-94144391 ATCATTCACCATGACTGACTGGG + Intergenic
1014752072 6:125267950-125267972 CTGGTGCACCATGACTCAGAGGG + Intronic
1017786884 6:157763601-157763623 CTCCTCCTCCATGAGTCACCCGG + Intronic
1018190109 6:161303081-161303103 CTCCTCCACCCTCACTCACCAGG - Intergenic
1031588151 7:123557633-123557655 CTCGTTCTGCATGCCTTACCGGG - Exonic
1037659175 8:20912429-20912451 CTCTTTCACCATGCCTGACTAGG - Intergenic
1037939134 8:22938349-22938371 CTCCTGCCCCATGACCCACCTGG + Intronic
1040974576 8:53175915-53175937 ATTCTCCACCATGACTCACCTGG - Intergenic
1045551927 8:103180577-103180599 CTCGTTCCTCGTGACTCACCAGG + Intronic
1055569804 9:77605152-77605174 CTCATTCACCATAGCTCAGCTGG - Intronic
1061467403 9:130792498-130792520 CCCTTTCTCCATGACACACCAGG + Intronic
1188404273 X:29787211-29787233 CTCATTCACCCTGTCTCTCCAGG - Intronic
1189119833 X:38382783-38382805 CTCATTCACCATCTTTCACCTGG - Intronic
1192430188 X:71106590-71106612 CTCCTTCTGCATGACTCATCAGG - Exonic
1192635674 X:72814274-72814296 ATCGTTCACCATGACTAAGCAGG - Intronic
1192646040 X:72906529-72906551 ATCGTTCACCATGACTAAGCAGG + Intronic
1195349573 X:103983908-103983930 CTCGTTCAGCATGGTGCACCAGG + Intergenic
1195357870 X:104054931-104054953 CTCGTTCAGCATGGTGCACCAGG - Intergenic
1195894802 X:109734185-109734207 CTAGTTCACCATTACGCATCAGG - Intergenic